Blood, 15 August 2001, Vol. 98, No. 4, pp. 1261-1263
BRIEF REPORT
A novel 
fusion gene expresses hemoglobin A (HbA) not Hb
Lepore: Senegalese 0+
thalassemia
Samia Zertal-Zidani,
Rolande Ducrocq,
Catherine Weil-Olivier,
Jacques Elion, and
Rajagopal Krishnamoorthy
From INSERM U 458, Biochimie Génétique,
Hôpital Robert Debre, Paris, France, and CHU Louis
Mourier-Service de pédiatrie générale, Renouilliers,
Colombes, France.
 |
Abstract |
This study identified and characterized a novel 
fusion gene
in which the -globin gene promoter is linked to intact -globin coding sequences in a Senegalese family. It results from a 7.4-kb deletion that removes the -globin coding sequences, the
intergenic region as well as the -globin gene promoter and causes
0+ thalassemia with hemoglobin A
expressed at the 11% to 15% range. The phenotype of this naturally
occurring hybrid gene not only clarifies, in an in vivo context,
the respective strength of - and -globin gene promoters, but also
emphasizes the importance of -globin intragenic sequences in the
expression of -globin chains.
(Blood. 2001;98:1261-1263)
© 2001 by The American Society of Hematology.
| |
Introduction |
Molecular studies of various deletions within the human
-globin gene cluster have provided important insights into the
regulatory mechanisms of globin gene expression and hemoglobin (Hb)
switching.1-3 In thalassemias ( thal),
depending on the location and deletion size, expression of the adult
- and -globin genes is either abolished or reduced, resulting,
respectively, in ()0 or ()+ thal
phenotypes.1 Some of the deletions, around 7.4 kb, result in a fusion gene that expresses an abnormal Hb, termed "Hb Lepore." Hb Lepore consists of 3 variants characterized by 3 different -to- sequence transitions at the fusion junction: Hb
Lepore-Hollandia (aa1-22 aa50-146), Hb
Lepore-Baltimore (aa1-50 aa86-146), and
Hb Lepore-Boston-Washington (aa1-87
aa116-146).
We report here identification and characterization of a new form of
deletional thal in a Senegalese family with an unusual phenotype
of (0+) thal. Like other Lepore-type
deletions, this Senegalese deletion involves a DNA segment of around
7.4 kb and results in a novel fusion gene in which a -globin gene
promoter drives the expression of an intact -globin gene and thus
provides a novel mechanism for + thalassemia. This
naturally occurring mutation also offers a rare opportunity to
evaluate, in an in vivo context, the strength of the -globin
promoter in driving the expression of a linked -globin gene.
| |
Study design |
Hematologic parameters, HbA2, HbS, and HbF levels
were determined by standard procedures. The -globin haplotype, the
-globin gene status, and common sequence polymorphisms within the
-globin gene (sequence framework) and mutations in the A
and G
promoters were analyzed as described previously.4-7 The
deletion leading to the fusion gene was identified by a
polymerase chain reaction (PCR)-based procedure.8 The
complete sequence of the hybrid gene was determined by amplifying a
1667-bp fragment (from the promoter region up to the polyA
addition signal) using a forward primer 5'GACACACATGACAGAACAGCCAAT3'
(GenBank coordinates: 54586-54610), homologous to the
-promoter8 and a 3' reverse primer
5'GCTCGCTTTCTTGCTGTCCA3' (coordinates: 63611-63630) under the following
conditions: denaturation, 95°C for 40 seconds; annealing, 56°C for
50 seconds; and extension, 72°C for 2 minutes, during 30 PCR cycles.
| |
Results and discussion |
Case history
The proband is a Senegalese child born and living in France,
diagnosed at birth as having homozygous sickle cell anemia (SCA) based
on his Hb phenotype (high HbS and HbF with no HbA) and DNA analysis.
With no history of sickle cell-related symptoms nor transfusion on
periodic clinical follow-up until the age of 5, his case was referred
again to explore the molecular basis of his mild presentation. The DNA
analysis by PCR using a forward primer in the -promoter
5'GTACGGCTGTCATCACTTAGACCTCA3' coordinates: 62024-62050 and a reverse
primer 5'CACTGATGCAATCATTCGTC3' coordinates: 62773-62754 within the
-globin gene, confirmed his SCA status (results not shown). His Hb
analysis showed the presence of HbA (11.7%) (Figure
1A-B). Given such conflicting DNA and Hb
phenotype assessment (respectively, SCA and S+
thalassemia), family study was undertaken.
View larger version (28K):
[in this window]
[in a new window]
| Figure 1.
Hemoglobin
and DNA analysis of the Senegalese 0+
thalassamia and the rearranged gene structure of the novel fusion gene.
(A) High-performance liquid chromatography (variant system, Biorad
Laboratories, Richmond, CA) profiles of the hemolysates from the
proband's father (i), mother (ii), a control sample of Hb Lepore
heterozygote (iii), and the proband (iv). In this system, Hb Lepore
migrates at the position of HbA2. The level of the
proband's HbA was assessed to be 11.7% of total hemoglobin. (B)
Isoelectrofocusing profiles of the following hemolysates from a control
sample of Hb Lepore heterozygote (1), in vitro mixed HbA/ Hb Lepore and
HbA/HbS (2), mother (3), father (4), and a healthy individual (5). Hb
Lepore is clearly distinguished from HbS and no Hb Lepore was detected
in the father even after overloading. (C) Agarose electrophoretic
profile of the PCR products. PCR products obtained by using
primers8 E1, 5'GACACACATGACAGAA CAGCCAAT3';
GenBank coordinates: 54586-54610; E2
5'CGATCTTCAATATGCTTACCAAG3'; coordinates: 61848-61870; and
E3 5'CATTCGTCTCTTTCCCATTCTA3', coordinates: 62763-62742 are
in lanes 1 to 3 and those with E1 and E3, in
lanes 4 and 5. In this system, the E2-E3 pair
generates a 915-bp fragment for a normal -globin gene and the
E1-E3 pair, a 777-bp fragment for Lepore-type
chromosome, whereas E1-E3 are too far to
produce a PCR fragment under our experimental conditions. The template
DNA used is from the proband's mother (lane 1), the father (lanes 2 and 4), and an individual heterozygous for Hb Lepore (lanes 3 and 5).
(D) Schematic representation of the normal human - and -globin
gene arrangement, the Lepore Boston-Washington gene, and the herein
described fusion gene. The boxes,  and  , respectively
represent the -globin gene promoter and exons and,  and  ,
respectively represent the -globin gene promoter and exons. The
position and orientation of the E1, E2, and
E3 primers are also indicated. A indicates HbA; F, HbF;
A2, HbA2; S, HbS; L, Hb Lepore; B, PCR blanks;
M, molecular size marker.
|
|
Table 1 summarizes the phenotype and DNA
data of the Senegalese family. Three other siblings, 2, 3, and 4, also
had discrepant DNA and phenotype data and none had sickle cell-related
symptoms. Such a discrepancy may arise from the preferential
amplification of the S allele in PCR, with concomitant
failure to amplify the A allele. To explore further, we
designed various primers within the structural gene, which all allowed
amplification of both s and A sequences.
We thus postulated that the primer/template mismatches, causal for
amplification failure, lie in the promoter region of the low expressing
A allele. Indeed, we were unable to amplify this
+ thal allele with its promoter region by PCR until we
used primers designed for the detection of Lepore-type deletion. In
this procedure, one primer is homologous to the -promoter region and
the other to the -globin gene sequence. A 777-bp fragment,
indicative of a 7.4-kb deletion8 was obtained (Figure 1C).
Sequencing of this fragment revealed that (1) the deletion removes all
the coding sequences of the - globin gene, the entire intergenic
sequences, and the -globin gene promoter regions (the
initially used upstream primer falls within this deleted region), and
that (2) the deletion junction occurs on a 37-bp region within the 5'
untranslated sequence, approximately 21 nucleotides downstream from the
cap site of the -globin gene (Figure 1D). The exact fusion point
cannot be defined because of the sequence identity between - and
-globin genes in this region. The 7.4-kb Senegalese deletion occurs
in a region known to be a hot spot for recombination (accounting for
75% of the meiotic recombination events within the -globin
locus).9 This deletion results in a novel fusion
gene distinct from the classical Lepore gene. This is substantiated by
the following findings: (1) no Hb Lepore was found in individuals who
inherited this allele, and (2) the translated regions of the fusion
gene has normal -globin gene sequence including codon 22, which
confers the characteristic charge difference between Hb Lepore and HbA.
It is very likely that the novel fusion gene herein described results
from a mechanism quite similar to the event (crossing-over between
misaligned chromosomal pairs) that generates Hb Lepore. However the
striking difference is that the novel fusion gene produces HbA, not Hb
Lepore10 because the -to- sequence transition occurs
in the 5' untranslated region. The chromosome carrying the "anti
fusion" counterpart should have duplicated -globin genes
and may correspond to a reported case with unusually high HbA2 level (15%).11
In the heterozygous state, the Senegalese deletion results in a silent
carrier state as observed in the father: normal range of HbA (94.6%)
and HbA2 (2.7%). But a modest increase in HbF (2.7%) is
similar to what is observed in Hb Lepore heterozygotes. Further increment in -chain output in the 4 (0+) thal/S siblings (HbF
12.4%-30.4%) may be related to the presence, in trans, of a sickle cell gene of "Senegal
haplotype."12
The new hybrid gene is expressed at low level, very likely due
to the weak -globin promoter. Indeed, the -promoter lacks (as
compared to - promoter) both CACCC and CAATT conserved
sequences,13 which are required for appropriate expression
of the -globin gene.14 Interestingly, the hybrid gene
with -promoter is able to produce -globin chain 5-fold higher
than -globin chain and matches the expression level of Hb Lepore.
This suggests that sequences within the -globin gene contribute to
the overall expression of -globin.15,16 Altogether this
study brings direct in vivo evidence that the marked reduction in the
expression of fusion genes including the classical Lepore genes is
essentially due to the 5' flanking sequences of the -globin gene and
not to the -globin coding sequences that are present within the
Lepore gene.
Benign presentation of the disease could be attributed to the presence
of significant levels of HbA and HbF. This study also emphasizes the
importance of confronting genotype and phenotype data in assessing an
unusually mild course of SCA.
| |
Acknowledgments |
S.Z.-Z. is the recipient of a fellowship from the Association
Française de Recherche Génétique (AFRG).
| |
Footnotes |
Submitted February 12, 2001; accepted April 13, 2001.
Supported by a grant No. TS3*-CT93-0244DG12HSMU from the European union.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Rajagopal Krishnamoorthy, INSERM U 458, Hôpital Robert Debre, 48 Boulevard Sérurier, 75019 Paris,
France; e-mail: krishna{at}infobiogen.fr.
| |
References |
1.
Weatherall DJ.
The thalassemias. In:
Stamatoyannopoulos G,Nienhuis AW,Majerus PW,Varmus H, eds.
The Molecular Basis of Blood Diseases. Philadelphia: Saunders; 1994:157-195.
2.
Van der Ploeg LH, Konings A, Oort M, Roos D, Bernini L, Flavell RA.
Gamma-beta-thalassaemia studies showing that deletion of the gamma- and delta-genes influences beta-globin gene expression in man.
Nature.
1980;283:637-642[CrossRef][Medline]
[Order article via Infotrieve].
3.
Driscoll MC, Dobkin CS, Alter BP.
Gamma delta beta-thalassemia due to a de novo mutation deleting the 5' beta-globin gene activation-region hypersensitive sites.
Proc Natl Acad Sci U S A.
1989;86:7470-7474[Abstract/Free Full Text].
4.
Sutton M, Bouhassira EE, Nagel RL.
Polymerase chain reaction amplification applied to determination of -like globin gene cluster haplotypes.
Am J Hematol.
1989;32:66-69[Medline]
[Order article via Infotrieve].
5.
Dodé C, Krishnamoorthy R, Lamb J, Rochette J.
Rapid analysis of 
3.7 thalassemia and anti 3.7 triplication by enzymatic amplification analysis.
Br J Haematol.
1992;82:105-111.
6.
Ghanem N, Girodon E, Vidaud M, et al.
A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms.
Hum Mutat.
1992;1:229-239[CrossRef][Medline]
[Order article via Infotrieve].
7.
Gottardi E, Losekoot M, Fodde R, Saglio G, Camaschella C, Bernini LF.
Rapid identification by denaturing gradient gel electrophoresis of mutations in the gamma-globin gene promoters in non-deletion type HPFH.
Br J Haematol.
1992;80:533-538[Medline]
[Order article via Infotrieve].
8.
Craig JE, Barnetson RA, Prior J, Raven JL, Thein SL.
Rapid detection of deletions causing delta beta thalassemia and hereditary persistence of fetal hemoglobin by enzymatic amplification.
Blood.
1994;83:1673-1682[Abstract/Free Full Text].
9.
Chakravarti A, Buetow KH, Antonarakis SE, Waber PG, Boehm CD, Kazazian HH.
Nonuniform recombination within the human beta-globin gene cluster.
Am J Hum Genet.
1984;36:1239-1258[Medline]
[Order article via Infotrieve].
10.
Efremov GD.
Hemoglobins Lepore and anti-Lepore.
Hemoglobin.
1978;2:197-233[Medline]
[Order article via Infotrieve].
11.
Schroeder WA, Huisman TH, Hyman C, Shelton JR, Apell G.
An individual with Miyada-like hemoglobin indistinguishable from hemoglobin A2.
Biochem Genet.
1973;10:135-147[CrossRef][Medline]
[Order article via Infotrieve].
12.
Green NS, Fabry ME, Kaptue-Noche L, Nagel RL.
Senegal haplotype is associated with higher HbF than Benin and Cameroon haplotypes in African children with sickle cell anemia.
Am J Hematol.
1993;44:145-146[Medline]
[Order article via Infotrieve].
13.
Poncz M, Schwartz E, Ballantine M, Surrey S.
Nucleotide sequence analysis of the delta beta-globin gene region in humans.
J Biol Chem.
1983;258:11599-11609[Abstract/Free Full Text].
14.
Antoniou M, Grosveld F.
Beta-globin dominant region interacts differently with distal and proximal promoter elements.
Genes Dev.
1990;4:1007-1013[Abstract/Free Full Text].
15.
Collis P, Antoniou M, Grosveld F.
Definition of the minimal requirements within the human -globin gene and the dominant control region for high level expression.
EMBO J.
1990;9:233-240[Medline]
[Order article via Infotrieve].
16.
Antoniou M, Geraghty F, Hurst J, Grosveld F.
Efficient 3'-end formation of human -globin mRNA in vivo requires sequences within the last intron but occurs independently of the splicing reaction.
Nucl Acid Res.
1998;26:721-729[Abstract/Free Full Text].
Top
Abstract
Introduction
