| |
|
|
|
|
|
|
|||
|
PLENARY PAPER
From the Laboratoire de Chimie Biologique, Institut de
Biologie et de Médecine Moléculaires, Université
Libre de Bruxelles, Gosselies, Belgium; Centre de Biologie du
Développement, CNRS UMR 5547, Université Paul Sabatier,
Toulouse, France; and Service Transgenèse, Institut de
Pharmacologie et Biologie Structurale, CNRS UMR 5089, Toulouse, France.
In vitro studies have indicated that the granulocyte-macrophage
colony-stimulating factor (GM-CSF) gene expression is regulated at the
posttranscriptional level by the AU-rich element (ARE) sequence present
in its 3' untranslated region (UTR). This study investigated the
importance of the ARE in the control of GM-CSF gene expression in vivo.
For this purpose, transgenic mice bearing GM-CSF gene constructs
containing or lacking the ARE (GM-CSF AU+ or GM-CSF
AU Many messenger RNAs (mRNAs) that encode cytokines
or oncogenes are transiently expressed due to multiple regulatory
controls. A common feature of these mRNAs is the presence of a
conserved AU-rich element (ARE) in their 3' untranslated region
(UTR).1 AREs have been classified in 3 categories based on
the number and distribution of the pentanucleotide AUUUA they
contain.2 Class I AREs are characterized by the presence
of 1 to 3 pentamers distributed into a large part of the 3'UTR coupled
with a nearby U-rich region. Class II AREs have at least 2 overlapping
copies of the nonamer UUAUUU(U/A)(U/A) in a U-rich environment.
Finally, class III AREs do not contain any pentamer but present U-rich stretches. All 3 categories of AREs confer mRNA instability through different mechanisms all implying mRNA deadenylation as a first step of
mRNA decay (for review, see reference 2). Moreover, some class II AREs
have been shown to mediate translation regulation.3-6 Although AREs of most oncogene mRNAs fall into classes I and III, class
II mainly includes AREs from cytokine mRNAs. In this regard, the ARE
present in granulocyte-macrophage colony-stimulating factor (GM-CSF)
mRNA constitutes the prototype of class II ARE and was the first of
these elements shown to regulate mRNA stability.7 Indeed,
insertion of GM-CSF ARE into the 3' UTR of the otherwise stable
Granulocyte-macrophage CSF is a 23-kd glycoprotein that stimulates the
growth and differentiation of granulocyte and macrophage progenitor
cells, both in vitro and in vivo.12 Moreover, GM-CSF acts
on mature granulocytes and macrophages, increasing their survival,
migration, and antimicrobial activity.13 A number of
different cell types including T and B lymphocytes, macrophages, fibroblasts, and endothelial cells can produce GM-CSF when stimulated. This production can be the result of increased transcription, as in T
lymphocytes, or posttranscriptional stabilization of the mRNA, as in
macrophages, eosinophils, and fibroblasts. In the latter cases, in
vitro studies have shown that this stabilization resulted from
inhibition of ARE-dependent degradation.8,14 It is
therefore conceivable that the ARE plays an important role in the
control of GM-CSF production in vivo. The fact that multiple regulator
checkpoints govern the expression of GM-CSF suggests that impaired
regulation of this cytokine might have untoward consequences.
In the present study, we have investigated the role of GM-CSF ARE in
vivo by generating transgenic mice bearing mouse GM-CSF gene
constructs, either containing or lacking the ARE. Because other
regulatory sequences located within the mRNA could influence ARE
activity, we kept in the constructs the ARE in its natural context.15,16 Moreover, to analyze when and where the
ARE controls the level of GM-CSF mRNA expression, the constructs were
placed under the transcriptional control of the cytomegalovirus
(CMV) early immediate promoter, which has been shown to be active early in development and in most tissues.17,18 Because both
constructs led to major lethality before birth, we analyzed transgene
expression during late embryonic development. Our results reveal the
fundamental role of the ARE in the control of GM-CSF mRNA accumulation
in vivo and point to the consequences of inappropriate GM-CSF
expression on the differentiation of myeloid cells.
Cell cultures and transfection
The biologic activity of the GM-CSFTag protein was assessed in a
proliferation assay using the GM-CSF-dependent cell line NFS-60.19 Briefly, these cells were cultured during 3 days
in RPMI medium containing 10% WEHI 3 conditioned culture
medium (containing interleukin-3 [IL-3]) to induce IL-3 receptor
decrease. Supernatant to be tested (100 µL) was added in triplicate
in the first lane of wells of a 96-well plate containing 100 µL
RPMI medium in each well. Then, serial 2 × dilutions were performed
and 100 µL RPMI medium containing 20 000 NFS-60 cells was added to
each well. After 24 hours of incubation, [3H]-thymidine
(0.37 MBq) was added and cells were further incubated for 12 hours. Cells were harvested and [3H]-thymidine
incorporation was measured. In parallel, the GM-CSFTag-mediated biologic activity was verified by performing the proliferation assay in
the presence of decreasing concentrations of anti-GM-CSF antibody.
Western blot analysis
RNA extraction and reverse transcription-polymerase chain reaction Total RNA was extracted as reported in Chomczynski and colleagues.20 Reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed using 7 µg total RNA, GM3 primer (5'AATTTATTATTCTGGTAAGACATTC3'; Figure 1A) and 200 U Superscript RTII (Life Technologies) for 1 hour 30 minutes at 37°C. PCR was performed with a quarter of the RT using either GM2 (5' AAGCTAACATGTGTGCAGACCCGC3') and GM3 primers or GM1 (5'CTCAGAGAGAAAGGCTAAGG3') and GM4 (5'AAAGTTTTAATAATTTATTATTCTGG3') primers. The PCR products were cloned into pSP64 plasmids, which were then appropriately linearized for in vitro transcription.
In vitro transcription and translation In vitro transcription was performed with the SP6 mMESSAGE mMACHINE kit (Ambion, Austin, TX). Five hundred nanograms of each RNA were translated for 30 minutes in the rabbit reticulocyte lysate system (Promega Benelux, Leiden, The Netherlands) supplied with 0.555 MBq/20 µL reaction L-[35S]-methionine (Amersham, Pharmacia Biotech).Transgenic DNA constructs The CMV-GMTag AU+ and CMV-GMTag AU
constructs were generated using the mouse GM-CSF genomic clone
PLGM-CSF12 (a generous gift from Dr P. Vandenabeele). Briefly,
c-Myc Tag was inserted at the C-terminal end of GM-CSF
coding sequence by PCR amplification of GM-CSF genomic clone using (1)
a 86-bp long primer A (forward) starting at the EcoRV site
at the end of the GM-CSF coding sequence and containing the
c-Myc Tag encoding sequence before the TGA stop codon
and (2) the reverse primer B (5'AAGCTTTGACAGCATTGACTCTCATCAATAC3'), which hybridized to the sequence located 91 nucleotides
downstream from the poly(A) signal. The AU
construct was obtained after separated amplification of the 2 sequences
adjacent to the ARE (defined as the sequence located between
nucleotides 1-203 and 283-418 downstream from the stop codon using
primers A and C (5'GGATCCGTCCCTATCAGTAGAAAATATCTC3') and primer D
(5'GGATCCAATGTCTTACCAGAATAATAAATT3') and B, respectively. The 2 PCR
products were then ligated and inserted into the PLGM-CSF12 plasmid
(details are available on request). The modified GMTag AU+
and AU fragments were inserted into the pBK-CMV plasmid
(Stratagene, La Jolla, CA) in which the lac promoter
was deleted. The resulting pBK-CMV-GMTag AU+ and
AU constructs were verified by sequencing.
Generation of transgenic mice The 3-kb CMV-GMTag AU+ and AU
fragments without plasmid sequences were isolated and injected into one
of the pronuclei of (C57Bl/6XCBA) fertilized eggs.21
Transgenic embryos or adult mice were identified by PCR with placenta
or tail DNA using primers CMV1 (TCTGACGGTTCACTAAACCA) and CMV2
(ATCAATTACGGGGTCATTAG) (Figure 1A). Southern blot analysis was
performed with a 600-pb probe corresponding to the CMV promoter to
confirm the presence of the transgene.
Fourteen and 18-day-old embryos (E14 and E18) and their placentas were
collected and directly frozen on dry ice, and stored at The transgene copy number was evaluated by semiquantitative PCR
amplification of a transgene-specific fragment (AU+, 364 bp; AU In situ hybridization [ -35S] uridine triphosphate (UTP) (Amersham
Pharmacia Biotech) labeled riboprobes were synthesized by in
vitro transcription. In situ hybridization and emulsion were performed
as previously described22 using antisense and sense
riboprobes as negative controls.
Immunohistochemistry Slides were air-dried for 10 minutes, fixed in acetone for 10 minutes at room temperature, and hydrated by 100%, 95%, and 75% ethanol and H2O baths (1 minute/bath). For peroxidase detection, slides were treated 35 minutes in methanol, 0.3% H202 at room temperature to inhibit endogenous peroxidases, rinsed in PBS pH 7.4 (1 minute), and blocked with 100 µL PBS containing 1% blocking reagent (Roche Diagnostics, Brussels, Belgium) pH 7.4 (1 hour) at room temperature. Three rinsing steps in PBS, pH 7.4, were performed before covering the slides with 100 µL biotinylated antibody (10 µg/mL) in PBS, 1% blocking reagent, pH 7.4, and incubation overnight at room temperature in a humidified chamber. For detection, vectastain ABC-peroxidase and ABC-alkaline phosphatase kits (Vector Laboratories, Burlingame, CA) were used as described, with DAB (Sigma) and vector blue substrate kit for substrate, respectively.Peroxidase detection Peroxidase activity was assayed by treating the slides as for immunohistochemistry (without endogenous peroxidase-inhibiting treatment) until blocking step. After blocking, slides were directly incubated with 100 µL peroxidase DAB substrate (Sigma).
Comparative analysis of GM-CSF AU+ and
AU ,
respectively. The 2 constructs were both under the control of the CMV
promoter, which has been previously shown to promote the strong
expression of reporter genes in tissue-cultured cells and the
quasi-ubiquitous (although at variable levels) expression of trangenes
in transgenic mice.17 Moreover, they both contained a
sequence encoding a human c-Myc epitope before the stop codon to allow the distinction between the transgenes and the endogenous gene
as well as their respective products (Figure 1A, and "Materials and
methods"). Before generating transgenic animals with these constructs, their capacity to generate correct transcripts as well as
biologically active GM-CSF was tested. Therefore, L-929 or HeLa cells
were stably transfected with both constructs and RT-PCR was performed
to detect transgenic GM-CSF AU+ and AU mRNAs
(see "Materials and methods"). Although RT-PCR products derived
from the pBK-CMV-GMTag AU transfected cells could easily
be detected, those corresponding to the pBK-CMV-GMTag AU+
transcripts could only be observed once the cells were treated with cycloheximide, which is known to stabilize ARE-containing mRNAs7,8 (Figure 1B). Likewise, the GMTag protein could
only be detected in the culture medium of pBK-CMV-GMTag AU-transfected Hela cells by ELISA (data not shown) or by Western blot (Figure 1C),
confirming thus the lack of GM-CSF AU+ transcripts in
pBK-CMV-GMTag AU+ transfected cells. The ability of each
construct to yield tagged GM-CSF mRNA and protein was tested using HeLa
cells transfected with pBK-CMV-GMTag AU and
cycloheximide-treated HeLa cells transfected with pBK-CMV-GMTag AU+. After RT-PCR, the complementary DNAs (cDNAs) were in
vitro transcribed and translated in reticulocyte lysate (see
"Materials and methods"). As illustrated in Figure 1D, both cDNAs
led to the synthesis of tagged GM-CSF, which was immunoprecipitated
both with anti-GM-CSF and anti-Myc Tag antibodies.
Finally, the biologic activity of the tagged GM-CSF was analyzed by
measuring the proliferation rate of the GM-CSF-dependent NFS-60 cells
in the presence of varying dilutions of culture media from
pBK-CMV-GMTag AU transfected Hela cells. Whereas culture
medium from untransfected cells did not significantly promote cell
proliferation, culture medium from transfected cells induced cell
proliferation in a dose-dependent manner. Moreover, this proliferative
effect was due to the tagged GM-CSF because it was counteracted by
increasing doses of anti-GM-CSF antibody (Figure
2). Altogether, these results show that
both constructs encode biologically active, tagged GM-CSF but that the
ARE imposes strong posttranscriptional regulation that prevents
accumulation of GM-CSF AU+ transcripts in the in vitro
cultured cells.
Comparative analysis of GM-CSF AU+ and AU , 14 mice were recovered from 598 reimplanted eggs; none were transgenic. Statistical comparison of the
transgenic yield obtained for both constructs compared to the yield
that we currently obtained with other constructs revealed a strong
lethality associated with the 2 transgenes. To circumvent this problem,
we derived transient transgenic embryos and analyzed transgene
expression at day 14 and 18 of development by in situ hybridization
with GM-CSF antisense riboprobe (see "Materials and methods").
At E14, we obtained 2 (of 12) and 3 (of 28) transgenic embryos for
GM-CSF AU+ and AU
Because granulocytes and macrophages constitute the main cell
populations responsive to GM-CSF, their distribution and abundance in
the transgenic embryos were investigated. Immunohistochemical staining
with antibodies specific for the granulocyte marker Ly-6G (Gr1)23 showed an overall increase in this cell population
(Figure 4A). Granulocytes were
distributed in a dispersed manner within the embryos but also
concentrated within the pia mater of the central nervous system (CNS),
between vertebrae along the spinal column, and around the blood
vessels. In contrast, the GM-CSF AU+ embryos were similar
to the nontransgenic animals in which the granulocytes were much less
abundant and mainly localized in the liver (compare Figure 4A to Figure
4B-C and Figure 4D to Figure 4E-F).
The use of antibodies specific for macrophages
(F4/80)24 indicated that these cells were also found in
greater number in GM-CSF AU Altogether, the differences of expression and phenotype observed
between E14 GM-CSF AU+ and AU Because the GM-CSF AU+ construct did not lead to detectable
expression and did not result in a change of phenotype in E14 embryos but appeared to impair the viability of transgenic animals, its expression was analyzed at a later stage of development, in E18 embryos. We obtained 2 (of 10) transgenic embryos, which contained 1 to
2 copies of the transgene (Table 1). As shown in Figure 5A, GM-CSF AU+ transcripts
were now clearly detectable in the embryos, the main expressing foci
corresponding to the olfactory epithelium (Figure 5B) and the gut.
Phenotypic analysis showed widespread proliferation of neutrophils.
These Gr1+ cells were disseminated throughout the embryos,
with more dense foci around the olfactory epithelium (Figure 5C), in
the bone marrow, the lungs (compare Figure 5D to Figure 5G, control),
the spleen, and around blood vessels (not shown). Cells containing strong peroxidase activity were abundantly present in E18 GM-CSF AU+ embryos, as previously observed in E14 GM-CSF
AU
Several in vitro studies have demonstrated the crucial
role played by AREs in the posttranscriptional regulation of gene
expression.2,7-11 However, their physiologic importance
has been investigated in vivo only for tumor necrosis factor
(TNF) mRNA. Indeed, it was recently shown that deletion of the
TNF ARE affected mechanisms responsible for TNF mRNA instability and
translational repression in hematopoietic and stromal cells, resulting
in the development of chronic inflammatory arthritis and Crohn-like
inflammatory bowel disease.27 In the present report, we
attempted to evaluate the importance of GM-CSF ARE in vivo and
constructed 2 CMV/GM-CSF transgenes that differed only by the absence
or the presence of the ARE. Because transgenic adult mice carrying
either construct could not be generated, we analyzed the importance of
GM-CSF ARE during embryonic development. The posttranscriptional
control exerted by this element was revealed by comparing the level of transgene expression in E14 GM-CSF AU+ and AU Accumulation of transgenic GM-CSF transcripts led to profound
phenotypic alterations in E14 AU Due to the ubiquitous activity of the CMV promoter, high levels of
transgene expression result in abnormally high levels of GM-CSF
throughout the embryos, which, in turn, leads to generalized proliferation of GM-CSF-sensitive cells. In some cases, such as CNS
and olfactory epithelium, the location of these cells is superimposed on that of transgene expression, probably resulting from
chemoattractant activity of the GM-CSF. In other cases, GM-CSF
overproduction stimulates the proliferation of myeloid progenitors and
mature cells in their resident locations and their subsequent
migration. In addition, GM-CSF overexpression most probably induces
myeloid cell activation, leading to a systemic inflammatory state
accompanied by progressive destruction of tissues infiltrated by
granulocytes and macrophages. The hematopoietic disorders observed in
E14 AU In conclusion, this study shows for the first time that the GM-CSF ARE is a physiologic regulatory element with developmentally controlled activity. In addition, the GM-CSF transgenic embryos are a valuable model to analyze the effect of myeloid hyperplasia similar to that induced by GM-CSF overexpression during embryonic development.
The AU+ and AU
Submitted January 26, 2001; accepted April 25, 2001.
Supported by grants from the EC Biotech Program (BIO4-CT95-0045), the Fund for Medical Scientific Research (Belgium, grant 3.4586.93), the Actions de Recherches Concertées (grant 94-99/181), the Belgian Banque Nationale, and a Télévie grant of the Fonds National Belge de la Recherche Scientifique (FNRS).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Véronique Kruys, Laboratoire de Chimie Biologique, IBMM, Université Libre de Bruxelles, Rue des Profs Jeener et Brachet 12, 6041 Gosselies, Belgium; e-mail: vkruys{at}dbm.ulb.ac.be.
1.
Caput D, Beutler B, Hartog H, Thayer R, Brown Shimer S, Cerami A.
Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators.
Proc Natl Acad Sci U S A.
1986;83:1670-1674 2. Chen CY, Shyu AB. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci. 1995;20:465-470[CrossRef][Medline] [Order article via Infotrieve].
3.
Garcia-Sanz JA, Lenig D.
Translational control of interleukin 2 messenger RNA as a molecular mechanism of T cell anergy.
J Exp Med.
1996;184:159-164
4.
Han J, Brown T, Beutler B.
Endotoxin-responsive sequences control cachectin/tumor necrosis factor biosynthesis at the translational level.
J Exp Med.
1990;171:465-475
5.
Kruys V, Marinx O, Shaw G, Deschamps J, Huez G.
Translational blockade imposed by cytokine-derived UA-rich sequences.
Science.
1989;245:852-855 6. Prichett W, Hand A, Sheilds J, Dunnington D. Mechanism of action of bicyclic imidazoles defines a translational regulatory pathway for tumor necrosis factor alpha. J Inflamm. 1995;45:97-105[Medline] [Order article via Infotrieve]. 7. Shaw G, Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell. 1986;46:659-667[CrossRef][Medline] [Order article via Infotrieve].
8.
Akashi M, Shaw G, Gross M, Saito M, Koeffler HP.
Role of AUUU sequences in stabilization of granulocyte-macrophage colony-stimulating factor RNA in stimulated cells.
Blood.
1991;78:2005-2012 9. Akashi M, Hachiya M, Koeffler HP, Suzuki G. Irradiation increases levels of GM-CSF through RNA stabilization which requires an AU-rich region in cancer cells. Biochem Biophys Res Commun. 1992;189:986-993[CrossRef][Medline] [Order article via Infotrieve].
10.
Lindstein T, June CH, Ledbetter JA, Thompson CB.
Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway.
Science.
1989;244:339-343 11. Schuler GD, Cole MD. GM-CSF and oncogene mRNA stabilities are independently regulated in trans in a mouse monocytic tumor. Cell. 1988;55:1115-1122[CrossRef][Medline] [Order article via Infotrieve].
12.
Gasson J.
Molecular physiology of granulocyte-macrophage colony-stimulating factor.
Blood.
1991;77:1131-1145 13. Baldwin GC. The biology of granulocyte-macrophage colony-stimulating factor: effects on hematopoietic and nonhematopoietic cells. Dev Biol. 1992;151:352-367[CrossRef][Medline] [Order article via Infotrieve]. 14. Esnault S, Jarzembowski JA, Malter JS. Stabilization of granulocyte-macrophage colony-stimulating factor RNA in a human eosinophil-like cell line requires the AUUUA motifs. Proc Assoc Am Physicians. 1998;110:575-584[Medline] [Order article via Infotrieve].
15.
Iwai Y, Bickel M, Pluznick D, Cohen R.
Identification of sequences within the murine granulocyte-macrophage colony-stimulating factor mRNA 3'-untranslated region that mediate mRNA stabilization induced by mitogen treatment of EL-4 thymoma cells.
J Biol Chem.
1991;266:17959-17965
16.
Jarzembowski JA, Rajagopalan LE, Shin HC, Malter JS.
The 5'-untranslated region of GM-CSF mRNA suppresses translational repression mediated by the 3' adenosine-uridine-rich element and the poly(A) tail.
Nucl Acid Res.
1999;27:3660-3666
17.
Furth PA, Hennighausen L, Baker C, Beatty B, Woychick R.
The variability in activity of the universally expressed human cytomegalovirus immediate early gene 1 enhancer/promoter in transgenic mice.
Nucl Acids Res.
1991;19:6205-6208 18. Koedood M, Fichtel A, Meier P, Mitchell PJ. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection. J Virol. 1995;69:2194-2207[Abstract]. 19. Olivares Fontt EO, Heirman C, Thielemans K, Vray B. Granulocyte-macrophage colony-stimulating factor: involvement in control of Trypanosoma cruzi infection in mice. Infect Immun. 1996;64:3429-3434[Abstract]. 20. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159[Medline] [Order article via Infotrieve].
21.
Brinster RL, Chen HY, Trumbauer ME, Yagle MK, Palmiter RD.
Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.
Proc Natl Acad Sci U S A.
1985;82:4438-4442 22. Yang A, Walker N, Bronson R, et al. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature. 2000;404:99-103[CrossRef][Medline] [Order article via Infotrieve]. 23. Fleming TJ, Fleming ML, Malek TR. Selective expression of Ly-6G on myeloid lineage cells in mouse bone marrow: RB6-8C5 mAb to granulocyte-differentiation antigen (Gr-1) detects members of the Ly-6 family. J Immunol. 1993;151:2399-2408[Abstract]. 24. Morris L, Graham CF, Gordon S. Macrophages in haemopoietic and other tissues of the developing mouse detected by the monoclonal antibody F4/80. Development. 1991;112:517-526[Abstract].
25.
Le Cabec V, Calafat J, Borregaard N.
Sorting of the specific granule protein, NGAL, during granulocytic maturation of HL-60 cells.
Blood.
1997;89:2113-2121
26.
Scott EW, Simon MC, Anastasi J, Singh H.
Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science.
1994;265:1573-1577 27. Kontoyiannis D, Pasparakis M, Pizzaro TT, Cominelli F, Kollias G. Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated immunopathologies. Immunity. 1999;10:387-398[CrossRef][Medline] [Order article via Infotrieve]. 28. Wilson GM, Brewer G. Identification and characterization of proteins binding A + U-rich elements. Methods. 1999;17:74-83[CrossRef][Medline] [Order article via Infotrieve].
29.
Zhang W, Wagner BJ, Ehrenman K, et al.
Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.
Mol Cell Biol.
1993;13:7652-7665
30.
Buzby JS, Brewer G, Nugen DJ.
Developmental regulation of RNA transcript destabilization by A + U-rich elements is AUF1-dependent.
J Biol Chem.
1999;274:33973-33978 31. Gouble A, Morello D. Synchronous and regulated expression of two AU-binding proteins, AUF1 and HuR, throughout murine development. Oncogene. 2000;19:5377-5384[CrossRef][Medline] [Order article via Infotrieve]. 32. Lang RA, Metcalf D, Cuthbertson RA, et al. Transgenic mice expressing a hemopoietic factor gene (GM-CSF) develop accumulations of macrophages, blindness, and a fatal syndrome of tissue damage. Cell. 1987;51:675-686[CrossRef][Medline] [Order article via Infotrieve]. 33. Metcalf D, Begley CG, Williamson DJ, et al. Hemopoietic responses in mice injected with purified recombinant murine GM-CSF. Exp Hematol. 1987;15:1-9[Medline] [Order article via Infotrieve]. 34. Johnson GR, Gonda TJ, Metcalf D, Hariharan IK, Cory S. A lethal myeloproliferative syndrome in mice transplanted with bone marrow cells infected with a retrovirus expressing granulocyte-macrophage colony stimulating factor. EMBO J. 1989;8:441-448[Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
D. J. Stumpo, N. A. Byrd, R. S. Phillips, S. Ghosh, R. R. Maronpot, T. Castranio, E. N. Meyers, Y. Mishina, and P. J. Blackshear Chorioallantoic Fusion Defects and Embryonic Lethality Resulting from Disruption of Zfp36L1, a Gene Encoding a CCCH Tandem Zinc Finger Protein of the Tristetraprolin Family Mol. Cell. Biol., July 15, 2004; 24(14): 6445 - 6455. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Grosset, R. Boniface, P. Duchez, A. Solanilla, B. Cosson, and J. Ripoche In Vivo Studies of Translational Repression Mediated by the Granulocyte-Macrophage Colony-stimulating Factor AU-rich Element J. Biol. Chem., April 2, 2004; 279(14): 13354 - 13362. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. T. Jubinsky, M. K. Short, G. Mutema, and D. P. Witte Developmental Expression of Magmas in Murine Tissues and Its Co-expression with the GM-CSF Receptor J. Histochem. Cytochem., May 1, 2003; 51(5): 585 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Dumont, S. Dremier, I. Pirson, and C. Maenhaut Cross signaling, cell specificity, and physiology Am J Physiol Cell Physiol, July 1, 2002; 283(1): C2 - C28. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gouble, S. Grazide, F. Meggetto, P. Mercier, G. Delsol, and D. Morello A New Player in Oncogenesis: AUF1/hnRNPD Overexpression Leads to Tumorigenesis in Transgenic Mice Cancer Res., March 1, 2002; 62(5): 1489 - 1495. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||