|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
PLENARY PAPER
From the Peter MacCallum Cancer Institute, East
Melbourne, Victoria, Australia.
Mobilized progenitor cells currently represent the most commonly
used source of hematopoietic progenitor cells (HPCs) to effect hematopoietic reconstitution following myeloablative chemotherapies. Despite their widespread use, the molecular mechanisms responsible for
the enforced egress of HPCs from the bone marrow (BM) into the
circulation in response to mobilizing agents such as cytokines remain
to be determined. Results of this study indicate that expression of
vascular cell adhesion molecule-1 (VCAM-1) is strongly reduced in vivo
in the BM during HPC mobilization by granulocyte colony-stimulating factor (G-CSF) and stem cell factor. Two serine proteases, namely, neutrophil elastase and cathepsin G, were identified, which cleave VCAM-1 and are released by neutrophils accumulating in the BM during
the course of immobilization induced by G-CSF. The proposal is made
that an essential step contributing to the mobilization of HPCs is the
proteolytic cleavage of VCAM-1 expressed by BM stromal cells, an event
triggered by the degranulation of neutrophils accumulating in the BM in
response to the administration of G-CSF.
(Blood. 2001;98:1289-1297) Mobilization is the redistribution of
hematopoietic precursor/progenitor cells (HPCs) from the bone marrow
(BM) into the peripheral blood (PB). The number of autologous
transplants performed with mobilized HPCs currently exceeds those
performed with BM.1 Earlier studies used PB progenitor
cells (PBPCs) collected during the recovery phase following
myelosuppressive chemotherapy.2 More recently, it has
become evident that a variety of hematopoietic growth factors (HGFs)
such as granulocyte colony-stimulating factor (G-CSF), interleukin-3
(IL-3), granulocyte-macrophage colony-stimulating factor (GM-CSF), stem
cell factor (SCF), Flt-3 ligand, c-MPL ligand, IL-1, or
chemokines such as IL-8 administered to rodents or humans can further
enhance the recovery of PBPCs.1 By far, the most commonly
used agent to elicit mobilization of HPCs in patients and normal donors
is G-CSF with about 30 000 transplantations a year performed with
G-CSF-mobilized PB cells. Mobilization induced by G-CSF is time- and
dose-dependent in rodents and in humans, the prominent features being a
rapid neutrophilia followed by a delayed increase of HPC numbers in the
blood peaking at levels 10- to 100-fold above baseline between 4 and 7 days after initiation of G-CSF administration. Despite the now almost
universal use of PBPCs, the mechanisms responsible for the enforced
egress of HPCs from the BM into PB in response to cytokines remain, to
a large extent, unknown.
Recent findings suggest an important role for neutrophils in HPC
mobilization induced by G-CSF, cytotoxic agents, and chemokines. Mice
carrying a targeted homozygous deletion of the G-CSF receptor gene
(G-CSFR In common with many groups, we have hypothesized that the retention of
HPCs in hematopoietic organs is controlled by adhesive interactions.7-11 Experiments in gene-deleted mice have
demonstrated the major role of the interaction between the
Although providing an important "proof of principle" that the
perturbation of this single cell adhesive interaction can result in
mobilization of primitive HPCs, these data do not provide clear insights into the physiologic mechanisms responsible for mobilization resulting from the administration of cytokines. We now report that
VCAM-1 expression is reduced in the BM stroma of mice mobilized either
with G-CSF alone, SCF alone, and G-CSF in combination with SCF.
Moreover, we identify 2 serine proteases, neutrophil elastase (NE) and
cathepsin G (CG), that both cleave VCAM-1 and are released by
neutrophils accumulating in the BM during the course of G-CSF-induced mobilization.
Proteases and HGFs
Cell adhesion assays
Generation of FDCP-1 cells stably expressing rhuVCAM-1 A 2.3-kb fragment containing the full coding sequence of huVCAM-1 was generated by high-fidelity polymerase chain reaction (PCR) from a full-length VCAM-1 cDNA inserted in the pCDM8 vector (provided by Dr R. R. Lobb, Biogen, Cambridge, MA) with the primers 5' GTGTGTGTGTGCGGCCGCAGCAACTTAAAATGCCTGGG 3' and 5' GTGTGTGTGTGTTAACGGAAGTCTGCCTCTCAGCTC 3' that introduce NotI and HpaI sites at the 5' and 3' ends of the VCAM-1 fragment, respectively. The purified product was cut with HpaI and NotI and ligated into the pRUFNeo(NotI) retroviral expression plasmid.22 Following amplification in JM109, 2 µg purified pRUFNeo-VCAM-1 plasmid was transfected into the ecotropic packaging cell line 2.23
Infection of the GM-CSF-dependent myeloid murine cell line FDCP-1 and
selection of transduced cells is described elsewhere.23 A
clone expressing high levels of huVCAM-1 was selected by
immunofluorescence staining with the mouse anti-huVCAM-1 mAb
6G10.24
Mobilization of mice Eight-week-old female balb/c mice were mobilized by twice daily subcutaneous injections for 6 days of either huG-CSF at 250 µg/kg body weight, rat SCF alone at 100 µg/kg, or huG-CSF in combination with rat SCF. Unless specified, mice were killed for PB, spleen, and BM collection on the day following the last injection. The number of PBPCs was estimated by performing clonogenic assays with PB. Approximately 300 µL PB was aspirated into 100 µL of 10% (wt/vol) EDTA pH 7.0. Red blood cells were lysed in 0.84% NH4Cl at room temperature for 10 minutes. The white blood cells were then washed twice in PBS-5% heat-inactivated FCS, counted, and plated in a double-layer nutrient agar culture system using a combination of 4 HGFs comprising human IL-1 , mouse IL-3, mouse CSF-1, and rat
SCF.19,25
Immunohistochemical staining of mouse BM Femurs were immediately taken from killed mice and the BM was directly flushed with a syringe and a needle onto glass slides. The BM plug was then covered by a coverslip and gently spread by gentle tapping of the coverslip to prepare a monolayer. Each slide together with its coverslip was then plunged into liquid N2 for 1 minute, coverslips were removed by flicking, and the BM monolayers left on the slides were immediately fixed by immersion in 100% acetone for 10 minutes. Slides were rehydrated in PBS for 2 hours and then blocked for 2 hours in PBS containing 0.05% Tween 20 and 5% goat serum (PBSTGS). Slides were then incubated overnight at 4°C with either neat M/K2-7 hybridoma supernatant (American Type Culture Collection, Manassas, VA) or with nonimmune rat IgG1 (Pharmingen, San Diego, CA) diluted at 2 µg/mL in hybridoma growth medium. Slides were washed 5 times with Tris-buffered saline 0.05% Tween-20 (TBST) between each step. Slides were incubated for 1 hour with biotinylated goat anti-rat IgG diluted 1:250 in PBSTGS and then for 1 hour with alkaline phosphatase-conjugated streptavidin diluted 1:400 in TBST. Leukocyte alkaline phosphatase was blocked by a 10-minute incubation in TBST with 10 mmol/L levamisole. Staining was revealed by a 20-minute incubation in 0.1 mol/L Tris-HCl pH 9.0, 5 mmol/L MgCl2, 10 mmol/L levamisole, 0.25 mg/mL fast red TR, and 0.01% naphthol AS-MX phosphate. Slides were finally rinsed with water before counterstaining with hematoxylin.Preparation of mobilized mouse BM extracellular extracts Balb/c mice were injected for 6 days with G-CSF or saline as described above. At specified times, femurs were immediately taken from killed mice and the BM was directly flushed with a syringe and a 21-gauge needle into 1 mL ice-cold PBS without serum to prevent immediate protease inhibition by serum protease inhibitors. Following dispersion of BM cells by repetitive flushing through the needle, cells were pelleted at 400g, 4°C for 5 minutes. Supernatants containing BM extracellular fluids were taken, aliquoted, and stored at 80°C until further analysis.
Purification of human neutrophils and BM CD34+ and
CD34 CD34+ and CD34 Normal human bone (NHB) cells were isolated from explants of trabecular bone and maintained as previously described.26 BM stromal cells were isolated from human BM aspirates and maintained as previously described.27 BM stromal and NHB cells were grown to confluence in T75 flasks, washed 3 times with PBS before addition of 6 mL IMDM per flask. Media were conditioned for 24 hours at 37°C. Following cell removal by centrifugation at 400g,
conditioned media were stored at Assessment by flow cytometry of CAM shedding The FCDP1-huVCAM-1 cells were washed 3 times in-MEM
supplemented with 0.2% bovine serum albumin (BSA). Cell aliquots of 50 µL were incubated at 37°C with 50 µL conditioned medium or purified proteases for 1 hour. In some experiments,
neutrophil-conditioned medium was preincubated for 20 minutes at room
temperature with protease inhibitors before addition of the cells.
Protease inhibitors were used at the following concentrations: 1 mmol/L
phenylmethylsulfonyl fluoride (PMSF), 50 µg/mL aprotinin, 50 µg/mL
pepstatin A, 50 µmol/L leupeptin, 40 µg/mL E-64, 1 mg/mL
2-macroglobulin, and 2 µmol/L BB-94 (British
Biotechnology, Oxford, United Kingdom). Proteolytic cleavage was
stopped by addition of HHN with 5% goat serum. All subsequent steps
were performed on ice. Cells were labeled with 10 µg/mL 6G10 mAb or
the mouse IgG1 isotypic control 1B5 followed by incubation with
fluorescein isothiocyante (FITC)-conjugated goat anti-mouse IgG
antibody before analysis by flow cytometry. Significant differences
were determined using Student t test on mean fluorescence
intensities (MFIs).
The proteolytic cleavage of other CAMs such as VLA-4, VLA-5, and platelet-endothelial cell adhesion molecule-1 (PECAM-1) was assessed using the human IL-3-dependent myeloid cell line MO7e. Cells were washed and incubated with neutrophil-conditioned medium or purified proteases as described above. Treated cells were stained as described but using the mouse function blocking mAbs P4C228 (anti-VLA-4), PHM229 (anti-VLA-5), and B2B130 (anti-PECAM-1) or 1B5 (IgG1 control) as primary antibodies. NE and CG enzymatic activity determination The activity of each protease was quantified using the chromogenic substrates MeOSuc-Ala-Ala-Pro-Val-pNA and Suc-Ala-Ala-Pro-Phe-pNA (Calbiochem-Novabiochem, San Diego, CA) specific for elastase and CG, respectively.31 Purified NE was diluted to 2 µg/mL in 0.1 mol/L Tris-HCl, pH 7.5, 0.5 M NaCl, 0.01% NaN3 (NE buffer), whereas CG was diluted to 5 µg/mL in 0.1 mol/L Tris-HCl, pH 8.3, 0.01% NaN3 (CG buffer). Aliquots of 50 µL were incubated for 20 minutes at room temperature in the presence or absence of protease inhibitors at concentrations specified above. An equal volume of specific substrate at 0.4 mmol/L in the same buffer was added to each aliquot. Negative controls were performed in identical conditions but without enzyme. After 30 minutes at 25°C, reactions were stopped by addition of 0.2 mmol/L PMSF and absorbance of free pNA was read at 405 nm on an enzyme-linked immunosorbent assay (ELISA) plate reader. Reciprocal cross-contamination of purified NE and CG was examined by diluting CG in NE buffer with the NE-specific substrate and conversely diluting NE in the CG buffer with the CG-specific substrate. This experiment demonstrated no cross-contamination of either purified CG by NE or the converse.The activity NE and CG in the BM extracellular fluid of mobilized mice was measured using 20 µL/well of mouse BM extracts instead of purified proteases. Plates were read after a 3-hour incubation at 37°C. Calibration was performed with wells containing serial dilutions of purified NE or CG. Proteolytic digestion of rhuVCAM-1 and fragment analysis The recombinant extracellular domain of human VCAM-1 (rhuVCAM-1) was diluted to 10 µg/mL in PBS. Aliquots of 20 µL were mixed with an equal volume of conditioned media, mouse BM extracts, or PBS containing either 2 µg/mL human NE, 2 µg/mL P3, 5 µg/mL CG, 2 µg/mL aminophenylmercuric acid-activated rhuMMP-9, 2 µg/mL granzyme B, H, or M, or no enzyme and were incubated at 37°C. At specified times, reactions were stopped by addition of an equal volume of 125 mmol/L Tris-HCl, pH 6.8, 20% glycerol, and 4% sodium dodecyl sulfate and boiling for 5 minutes. Samples were separated by electrophoresis on 10% polyacrylamide gels, transferred onto nitrocellulose, and immunoblotted with a goat antihuman VCAM-1 serum (R & D Systems) at a 1:3000 dilution and a horseradish peroxidase (HRP)-conjugated donkey F(ab)'2 fragment anti-goat IgG (Jackson Immunoresearch Laboratories, West Grove, PA) at a 1:20 000 dilution.Mobilization of human patients Mobilization protocols using rhuG-CSF alone or rhuG-CSF in combination with rhuSCF together with patients' profiles have been described elsewhere.32 Five female and 5 male patients, median age 50 years (range, 10-64 years), with non-Hodgkin lymphoma, who had previously had a relapse after initial chemotherapy, received rhuIL-3, 5 µg/kg per day, for 5 days followed by rhuGM-CSF, 5 µg/kg per day, for an additional 5 days. Sera were collected before and during cytokine treatment and stored at80°C. Collected PBPCs were
quantitated by plating light density cells in clonogenic assays as
previously described.32
ELISAs for human soluble VCAM-1 and NE Serum samples were diluted 100-fold in PBS supplemented with 0.1% BSA and analyzed for soluble VCAM-1 (sVCAM-1) concentration by ELISA using the R & D Systems kit.Neutrophil elastase concentrations were measured using an in-house ELISA test. Briefly, 96-well polyvinyl assay plates (Costar, Cambridge, MA) were coated overnight at 4°C with affinity-purified goat anti-mouse IgG (H+L) immunoglobulins (Caltag Laboratories, San Francisco, CA) diluted to 5 µg/mL in 50 mmol/L NaHCO3, pH 9.4, buffer. Following blocking with 2% BSA in PBS, wells were incubated overnight at 4°C with mouse anti-human NE mAb AHN-10 (Pharmingen) diluted to 1 µg/mL in PBS 0.1% BSA. Elastase was captured for 2 hours from 50-µL patients' sera aliquots diluted 100-fold in PBS with 0.1% BSA. Wells were then incubated for 1 hour with 50 µL rabbit anti-human NE antibody at 1:9000 in PBST plus 3% BSA followed by a 1-hour incubation with 50 µL HRP-conjugated donkey F(ab)'2 fragments anti-rabbit IgG at 1:20 000. Reactions were revealed by addition of 50 µL/well K-Blue TMB substrate (ELISA Technologies, Lexington, KY) and stopped by addition of 25 µL/well 1M H2SO4, and optical densities (ODs) were measured on an ELISA plate reader at 450 nm. Calibration curves using aliquots of purified NE diluted in PBS 0.1% BSA gave a linear relationship within the range 0 to 100 ng/mL NE (r2 = 0.996).
BM expression of VCAM-1 is reduced during mobilization in mice We first investigated the expression of VCAM-1 in the BM of mice mobilized with either human G-CSF, rat SCF, or a combination of both. The BM samples were processed for immunohistologic staining with the function-blocking rat anti-mouse VCAM-1 mAb M/K2-7 that binds to the VLA-4 binding site located in the first Ig-like domain of VCAM-1.33 In mice treated for 6 days with G-CSF, M/K2-7 staining in the BM stroma was dramatically decreased, whereas control mice treated with saline or untreated exhibited high expression levels of M/K2-7 functional epitope at the periphery of BM cells (Figure 1). Interestingly, the expression of VCAM-1 was not reduced on blood vessels within the BM of mobilized mice (Figure 1D). Similar reduction of VCAM-1 expression was observed in the BM stroma of mice mobilized with either SCF alone or SCF in combination with G-CSF (data not shown). When PBPCs were quantitated in clonogenic assays, the decrease of M/K2-7 staining in the BM coincided with increased mobilized PBPCs.
The reduction of VCAM-1 expression occurred specifically in the BM. The pattern of VCAM-1 expression in the spleen is spatially arranged with circular lymphoid areas that do not express VCAM-1 with VCAM-1bright spaces between these areas (Figure 1E). After 6 days of G-CSF administration, an identical pattern of VCAM-1 expression was exhibited in enlarged spleens (Figure 1F) demonstrating that the reduction of VCAM-1 expression during G-CSF-induced mobilization is restricted to the BM. We next analyzed VCAM-1 expression in the BM during the course of G-CSF
injection (days 0, 2, 4, 6) and 4 days following cessation of G-CSF
administration (day 10; Figure 2). VCAM-1
expression decreased progressively from day 0 to day 4 during G-CSF
injection and this decrease was maximal between days 4 and 6. This fits exactly with the progressive mobilization of HPCs as measured by spleen
enlargement, the number of colony-forming cells, and leukocytes
circulating in the PB. Four days after cessation of G-CSF
administration, VCAM-1 expression returned to levels seen in
noninjected animals. This corresponds to the normalization of spleen
weights and leukocyte numbers in the PB although the number of
circulating PBPCs was still elevated due to the transit of HPCs back
into the BM via the circulation.
Proteases cleaving VCAM-1 are produced in the BM of G-CSF-mobilized mice Because cells were permeabilized during the immunostaining procedure, internalized VCAM-1 should have been detected by MK/2-7. Therefore, these results suggest that VCAM-1 was shed from the surface of BM stromal cells during mobilization induced by G-CSF, SCF, or CY. This was assessed by measuring the ability of extracellular BM fluids to cleave VCAM-1 in vitro. Because purified murine VCAM-1 was not available to perform these studies, we used a commercial preparation of a 98-kd recombinant protein corresponding to the entire extracellular domain of mature human VCAM-1, which is 75.2% identical to the corresponding domain of murine VCAM-1 and promotes specific adhesion of murine cells expressing mouse VLA-4 (data not shown). The BM of femurs from G-CSF-mobilized mice was flushed into PBS and then centrifuged to remove cells. The resulting supernatants containing the extracellular fluid of the BM were incubated with purified rhuVCAM-1 and then analyzed by Western blot with a polyclonal goat antiserum raised against the extracellular domain of huVCAM-1 (Figure 3). Extracts from the BM of 3 different G-CSF-mobilized mice cleaved rhuVCAM-1 in smaller fragments, whereas the extracts from 3 different saline-injected mice left rhuVCAM-1 intact. These experiments demonstrate that active proteases cleaving VCAM-1 are produced and accumulate in the BM of G-CSF-mobilized mice but remain undetectable in the BM of noninjected and saline-treated mice.
Normal human neutrophils produce proteases cleaving rhuVCAM-1 To determine which cell types secrete an activity responsible for rhuVCAM-1 cleavage and shedding, culture medium was conditioned for 24 hours either with purified normal human BM CD34 cells, BM
stromal cells, bone cells, or PB neutrophils. The activities of these
conditioned media were first evaluated by incubating a murine myeloid
cell line FDCP-1 clone stably expressing human VCAM-1
(FDCP-1-huVCAM-1) with the different conditioned media followed by
flow cytometry analyses with the function-blocking mouse antihuman
VCAM-1 mAb 6G10.24 Whereas media conditioned by either
human BM stromal cells or bone cells did not alter the expression of
VCAM-1, media conditioned by either human BM CD34 cells
(P = .003, n = 3) or PB neutrophils
(P < .001, n = 6) significantly reduced the binding of
6G10 to FDCP-1-huVCAM-1 (Figure 4A).
This activity was completely inhibited by preincubating these
conditioned media with either the pleiotropic protease inhibitor
2-macroglobulin or the serine protease and cysteine
protease inhibitor PMSF, but was not inhibited following treatment with
either the cysteine protease inhibitor E-64, the aspartate protease
inhibitor pepstatin A, or the MMP inhibitor BB-94 (data not shown),
suggesting that this activity was due to the proteolytic cleavage of
VCAM-1 by a serine protease.
Purified rhuVCAM-1 was then incubated with the different conditioned
media and analyzed by Western blot. This analysis confirmed that both
PB neutrophil- and BM CD34 PB neutrophil- and BM CD34 cells and PB neutrophils induced the
detachment of BM CD34+ HPCs previously adhered to
rhuVCAM-1 or BM stromal cells (Figure 5), whereas media conditioned by either
BM stromal cells or bone cells did not display such activity. This
effect was dose-dependent and inhibited by
2-macroglobulin, demonstrating that the in vitro release
of adherent HPCs was due to the proteolytic cleavage of VCAM-1 (Figure
5C).
NE and CG cleave VCAM-1 and release CD34+ HPCs attached to immobilized VCAM-1 or BM stromal cell monolayers The major proteases released by neutrophils are MMP-9, CG, NE, and P3.34 rhuVCAM-1 was incubated with each of these enzymes and analyzed by Western blot. Both NE and CG cleaved rhuVCAM-1, whereas MMP-9 and P3 did not (Figure 3B). As a further control, VCAM-1 was also incubated in the presence of recombinant human serine proteases produced by cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells such as granzymes B, H, and M. None of these enzymes cleaved rhuVCAM-1 in vitro. When the pattern of VCAM-1 fragments generated by NE and CG was examined in more detail by performing a time-course, media conditioned by PB neutrophils or BM CD34 cells, purified NE and CG generated the same pattern
of fragments (Figure 6). To further
document the role of NE and CG, we performed enzymatic colorimetric
assays with chromogenic substrates specific for each enzyme. In accord
with experiments performed with neutrophil-conditioned medium,
pretreatment of CG or NE with PMSF inhibited the cleavage of each of
the specific substrates, whereas leupeptin, E-64, pepstatin A, or BB-94
did not (data not shown).
Cell adhesion assays on immobilized rhuVCAM-1 and BM stromal cell monolayers were performed as described above but using purified human NE, CG, MMP-9, and P3. As anticipated, both NE and CG induced the release of BM CD34+ HPCs previously attached to immobilized rhuVCAM-1 or BM stromal cells, whereas MMP-9 or P-3 had no effect (Figure 5A,B). NE and CG do not cleave
Increase of proteolytically active NE and CG in the BM of G-CSF-mobilized mice Having identified 2 proteases cleaving VCAM-1 in humans, we measured the amount of catalytically active NE and CG present in mobilized mouse BM extracellular fluids. Proteolytic activities were measured in a colorimetric assay using chromogenic substrates specific for each enzyme. The assays were calibrated using dilutions of purified human NE and CG. Whereas active NE was below detection levels (< 0.01 µg/femur) in the BM of saline-treated mice, it increased up to 0.96 ± 0.36 µg/femur following 6 days of G-CSF administration before returning to basal levels 4 days following the last injection of G-CSF (Table 2). Following the same pattern, active CG increased 15-fold in the BM of G-CSF-treated mice before returning to basal levels 4 days following the last injection of G-CSF. Considering that the BM volume in the femur of an 8-week-old mouse is approximately 10 µL and that less than 10% of this volume is made of extracellular fluid, these amounts correspond to estimated concentrations of 1 mg/mL NE and 4 mg/mL CG in the BM extracellular fluid of G-CSF-mobilized mice. These concentrations are 500 times higher than those used in the in vitro rhuVCAM-1 digestions.
Increase of sVCAM-1 and NE in serum is correlated with the number of mobilized HPCs in humans To determine whether VCAM-1 is also cleaved during mobilization in humans, we measured the concentration of sVCAM-1 in the serum of 3 cohorts of patients. Patients were mobilized with either G-CSF alone, G-CSF in combination with SCF, or IL-3 in combination with GM-CSF. The concentrations of sVCAM-1 were measured just before the start of mobilizing treatment and on the last day of treatment before collection of PBPCs. Serum concentrations of sVCAM-1 significantly increased in patients undergoing the 3 mobilization protocols (Figure 7A). Moreover, when the relative increase of sVCAM-1 serum concentration was plotted versus the number of collected granulocyte-macrophage colony-forming units (CFU-GMs), we found a significant correlation between these 2 parameters irrespective of the means used to elicit mobilization (Figure 7B). This observation is therefore consistent with the possibility that VCAM-1 is also cleaved or shed in response to an agent produced during mobilization in humans. Similarly, serum concentrations of NE on collection day were significantly increased compared to basal levels and correlated significantly to the number of mobilized CFU-GMs (Figure 7C,D). Interestingly, the serum concentrations of NE were also significantly correlated to sVCAM-1 concentrations on collection day (Figure 7E).
Previous attempts to identify the molecular mechanisms of cytokine-induced mobilization focused on possible alterations in HPC adhesive properties. We now report that mobilization induced by cytokines results in a dramatic change in the hematopoietic microenvironment in the BM. Specifically, the expression of VCAM-1 is dramatically reduced in vivo in the BM of mice mobilized either by G-CSF alone, SCF alone, or SCF in combination with G-CSF. This decrease in VCAM-1 expression followed the same kinetics as those of HPC mobilization and was restricted to the extravascular compartment of the BM. VCAM-1 expression in the spleen, an alternative hematopoietic organ in mice in which hematopoiesis relocates following HPC mobilization from the BM, was not altered. A number of investigators have demonstrated that the inhibition of the adhesive interaction between VCAM-1 and its receptor VLA-4 by infusion of either function-blocking anti-VCAM-1 or anti-VLA-4 mAbs is sufficient to promote mobilization in vivo in rodents and primates.8,16-18 Therefore, a strong reduction of VCAM-1 expression in the BM should, by the same token, be sufficient to promote HPC mobilization. We then investigated the molecular mechanisms responsible for the
reduction of VCAM-1 expression in the BM. In mice, administration of
G-CSF induced the production and accumulation in the BM of proteases
with the ability to directly cleave VCAM-1. In human patients, sVCAM-1
concentrations increased in the plasma during mobilization and this
increase correlated with the number of mobilized CFU-GMs suggesting
that VCAM-1 is shed by proteolytic cleavage during mobilization in both
mice and humans. We next identified 2 serine proteases, NE and CG, that
in common with media conditioned by either human PB neutrophils or BM
CD34 We therefore propose that an important step of HPC mobilization by G-CSF is the disruption of the adhesive interaction between VCAM-1 and VLA-4 as a consequence of VCAM-1 cleavage by neutrophil proteases such as NE and CG, released by neutrophils accumulating in the extravascular compartment of the BM following cytokine administration. This is consistent with the view that neutrophils play a key role in mobilization and with previous data showing neutrophil degranulation37-39 and a burst of IL-8 in the plasma,40 a chemokine inducing neutrophil degranulation, during the course of G-CSF administration in humans in vivo. Finally, our proposition is consistent with the observation that HPCs relocate to the spleen of mobilized mice because after G-CSF administration, high levels of VCAM-1 expression are maintained in this organ. Therefore, PBPCs may be sequestered in the spleen due to persistent VCAM-1 expression. The restriction of VCAM-1 cleavage to the extravascular compartment of
the BM may be due to the presence of large amounts of
Finally, our model does not exclude a role for other players in mobilization. We have identified NE and CG as the major proteases in normal mice and humans, with the ability to cleave VCAM-1. This does not, however, exclude the possibility that other cell surface or secreted proteases may cleave VCAM-1 and other CAMs relevant to HPC homing and mobilization. Moreover, the administration of HGFs may alter the function of the BM stroma and the production by this tissue of proteases and chemokines such as SDF-141,42 whose role in the retention and mobilization of HPCs has been demonstrated. Similarly, other CAMs such as PECAM-1/CD31, which is not cleaved by neutrophil proteases, are likely to play an active role in the transendothelial migration of CD34+ HPCs.43 Previous studies, however, have unambiguously demonstrated that the inhibition of the VLA-4/VCAM-1 interaction with antibodies results in mobilization.8,16-18 Therefore, the disruption of VCAM-1/VLA-4 interaction by proteolysis of VCAM-1 may be one of the essential steps contributing to the mobilization of HPCs following G-CSF administration. In conclusion, in addition to this new role for bactericidal proteases in the regulation of hematopoietic precursor trafficking, this mechanism may be essential to the down-regulation of inflammation by dampening neutrophil recruitment and extravasation through VCAM-1-expressing inflamed vasculature. Mobilization could therefore be a supraphysiologic manifestation of this negative feedback following systemic administration of agents promoting the expansion of neutrophils residing in the BM.
We thank Dr Ivan Bertoncello, Dr Ingrid G. Winkler, and Ms Brenda Williams for their grateful help.
Submitted December 20, 2000; accepted April 27, 2001.
Supported in part by the National Health and Medical Research Council of Australia (grants no. 080193 and 145711), Medvet Science (Adelaide, Australia), and Kirin Breweries (Y.T.) (Tokyo, Japan).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jean-Pierre Lévesque, Peter MacCallum Cancer Institute, Stem Cell Biology Laboratory, Locked Bag 1, A'Beckett St, Melbourne, VIC 8006, Australia; e-mail: jp.levesque{at}pmci.unimelb.edu.au.
1.
To LB, Haylock DN, Simmons PJ, Juttner CA.
The biology and clinical uses of blood stem cells.
Blood.
1997;89:2233-2258 2. To LB, Haylock DN, Kimber RJ, Juttner CA. High levels of circulating hemopoietic stem cells in very early remission from acute non-lymphoblastic leukaemia and their collection and cryopreservation. Br J Haematol. 1984;58:399-410[Medline] [Order article via Infotrieve].
3.
Liu F, Poursine-Laurent J, Link DC.
The granulocyte colony-stimulating factor receptor is required for the mobilization of murine hematopoietic progenitors into peripheral blood by cyclophosphamide or interleukin-8 but not Flt-3 ligand.
Blood.
1997;90:2522-2528
4.
Liu F, Poursine-Laurent J, Link DC.
Expression of the G-CSF receptor on hematopoietic progenitor cells is not required for their mobilization by G-CSF.
Blood.
2000;95:3025-3031 5. Pruijt JFM, Mantovani A, Vecchi A, et al. Neutrophils play a central role in interleukin-8 induced mobilization of hematopoietic progenitor cells (HPC) [abstract]. Blood. 1998;92:110a. 6. Pruijt JFM, Willemze R, Fibbe WE. Mechanisms underlying hematopoietic stem cell mobilization induced by the CXC chemokine interleukin-8. Curr Opin Hematol. 1999;6:152-158[CrossRef][Medline] [Order article via Infotrieve].
7.
Verfaillie CM.
Adhesion receptors as regulators of the hematopoietic process.
Blood.
1998;92:2609-2612
8.
Vermeulen M, Le Pesteur F, Gagnerault MC, Mary JY, Sainteny F, Lepault F.
Role of adhesion molecules in the homing and mobilization of murine hematopoietic stem and progenitor cells.
Blood.
1998;92:894-900
9.
Frenette PS, Subbarao S, Mazo IB, von Adrian UH, Wagner DD.
Endothelial selectins and vascular cell adhesion molecule-1 promote hematopoietic progenitor homing to the bone marrow.
Proc Natl Acad Sci U S A.
1998;95:14423-14428 10. Gumbiner BM. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell. 1996;84:345-357[CrossRef][Medline] [Order article via Infotrieve]. 11. Liesveld JL, Dipersio JF, Abboud CN. Integrins and adhesive receptors in normal and leukemic CD34+ progenitor cells: potential regulatory checkpoints for cellular traffic. Leuk Lymphoma. 1994;14:93-101 |
Top
Abstract
Introduction
1-integrin, 
) and saline- (
) treated mice and the number of
circulating CFCs and white blood cells (WBC) in the PB are shown in
panels G, H, and I. Data represent mean ± SEM (6 mice/time
point).
) before addition
to CD34+ HPC adhered to BM stromal cell monolayers. Results
are expressed as the mean of triplicates ± SD. The experiment was
repeated 3 times. CM indicates conditioned medium.
),
or rhuIL-3 in combination with rhuGM-CSF (
) taken just prior to the
commencement of HGF administration and on blood collection day. Each
pair of dots represents a different patient. (B) These results are
expressed versus the number of mobilized CFUs collected by apheresis on
collection day. (C) NE concentration in the serum of patients mobilized
with either rhuG-CSF alone, rhuG-CSF in combination with rhuSCF, or
rhuIL-3 in combination with rhuGM-CSF taken just before the start of
HGF administration and on blood collection day. NE concentrations on
collection day are plotted versus the number of CFUs collected in PB
(D) or versus the increase of sVCAM-1 plasma concentration (E).
Correlations and significances were determined with the nonparametric
Spearman correlation statistic.