| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From the Stem Cell Laboratory, National Blood Service,
Nuffield Department of Clinical and Laboratory Sciences, and the MRC
Molecular Haematology Unit, Institute of Molecular Medicine, Oxford,
United Kingdom; Faculdade de Ciencias do Desporto e Educacao Fisica da
Universidade de Coimbra, Coimbra, Portugal; GENOVAC AG, Freiburg,
Germany; Gastroenterology Division, Brigham and Women's Hospital,
Harvard Medical School, Boston, MA; First Department of Biochemistry,
School of Medicine, Fukuoka University, Fukuoka, Japan;
Hematology, Oncology and Transplantation, University of
Minnesota Medical School, Minneapolis, MN; Biomolecular Modelling
Laboratory, Imperial Cancer Research Fund, London, United Kingdom.
CEACAM1 on leukocytic, endothelial, and epithelial cells functions
in homophilic adhesion, tumor suppression, regulating cell adhesion and
proliferation, and in heterophilic adhesion as a receptor for
E-selectin and Neisseria meningiditis, Neisseria gonorrhoeae, Haemophilus influenzae, and murine coronaviruses. The 8 transmembrane isoforms of human CEACAM1 possess an extracellular N-terminal IgV domain, followed by variable numbers of IgC2 domains. To
establish which key amino acids contribute specifically to CEACAM1
homophilic adhesion, exposed amino acids in the N-terminal domain of a
soluble form of CEACAM1 were subjected to mutagenesis. Analyses of
mutant proteins with conformationally dependent antibodies indicated
that most mutations did not substantially affect the structural
integrity of CEACAM1. Nevertheless, decreased adhesion was observed for
the single mutants V39A or D40A (single-letter amino acid codes) in the
CC' loop and for the triple mutants located in the GFCC'C" face of the
N-terminal domain. Interestingly, whereas single mutations in R64 or
D82 that are predicted to form a salt bridge between the base of the D
and F The human carcinoembryonic antigen (CEA) family is
composed of 29 genes tandemly arranged on chromosome 19q13.2. Based on nucleotide homologies, these genes are classified into 2 major subfamilies, the CEACAM and the pregnancy-specific glycoprotein (PSG)
subgroups. The CEACAM-encoded proteins include CEA, the biliary
glycoproteins (CEACAM1), nonspecific cross-reacting antigen (CEACAM6),
and the CEA gene members, CEACAM3 (CGM1), CEACAM4 (CGM7), CEACAM7 (CGM2), and CEACAM8 (CGM6).1,2 Protein structural analyses indicate that CEACAM subgroup members belong to the
immunoglobulin (Ig) superfamily of adhesion molecules. The complexity
of the CEACAM subgroup is increased by differential splicing and
posttranslational modifications of some of its members. This is
exemplified by the human CEACAM1 isoforms, where at least 8 transmembrane variants are generated by differential splicing of a
single gene.1,2 These 8 isoforms possess an
extracellular N-terminal IgV-set domain, followed by no (CEACAM1-1L and
-1S), 2 (A1, B for CEACAM-3L and -3S), or 3 (A1, B, A2 for
CEACAM-4L and -4S) IgC2-set domains, or with the A2 domain replaced by
a serine-threonine-rich non-Ig sequence (Y, Z for CEACAM1-3AL and
-3AS). Alternative splicing of the cytoplasmic exons generates CEACAM1
variants with either long (L) or short (S) cytoplasmic tails.
The CEACAM1 molecules are recognized by CD66a monoclonal antibodies
(Mabs)3 and are expressed widely, occurring on monocytes, granulocytes and their precursors, activated T cells,4 and CD16 Because the N-terminal IgV set domain of CEACAM1 has been implicated in
mediating homophilic adhesion,7,19-23 we have determined the key amino acid residues (single-letter amino acid codes used throughout) involved in such interactions using site-directed mutagenesis. The basic structure of the IgV N-terminal domain of
CEACAM1 is a predicted tertiary fold of a stacked pair of Mabs
Stable transfectants
Flow cytometric analysis and quantification For quantitating the levels of CEACAM molecules on transfectants, flow cytometry was performed on a FACScan or FACSCalibur flow cytometer (Becton Dickinson, Sunnyvale, CA) using the LysisII or Cellquest software for data processing. Cells (1-2 × 105) were labeled with CD66/CEACAM-specific MAbs or irrelevant negative control MAbs of the same isotype (50 µg/mL), phycoerythrin-linked goat (Southern Biotechnology Associates, Birmingham, AL), or fluorescein isothiocyanate-conjugated rabbit F(ab)2 (Dakopatts) antimouse IgG (1:50) and then propidium iodide (5 µg/mL).5 Absolute quantification of the number of expressed CEACAM molecules was carried out using Quantum simply cellular microbeads (Sigma Chemical, St Louis, MO), using the MAbs COL1, 9A6, 80H3, T84.66, and D14HD11 to quantify CEACAM3, CEACAM6, CEA, and CEACAM1, respectively, and revealed CEA on HeLa 20 000 sites/cell, CEACAM1-4L on CHO 211 000 sites/cell, CEACAM1-4S on CHO 39 000 sites/cell, CEACAM1-1S on CHO 441 000 sites/cell, CEACAM8 on HeLa 18 000 sites/cell, CEACAM6 on HeLa 106 000 sites/cell, and CEACAM3 on HeLa 34 000 sites/cell.Soluble recombinant chimeric proteins The construction, production, and purification of the CEACAM1-Fc soluble proteins containing the N (CEACAM1-1-Fc), NA1B (CEACAM1-3-Fc), and NA1BA2 (CEACAM1-4-Fc) extracellular domains, Muc18(D1-5)-Fc, CD31(D1-3)-Fc, CD14-Fc, and NCAM(D1-7)-Fc have been described.7,34Epitope mapping of CD66/CEACAM MAbs The reactivity of the MAbs with the soluble domain deletion constructs of CEACAM1 or with negative control constructs, NCAM(D1-7)-Fc or MUC18(D1-5)-Fc, was determined in triplicate and repeated at least twice using alkaline phosphatase-based enzyme-linked immunosorbent assays (ELISAs).7Identification of the conformational-dependent and -independent CD66/CEACAM MAbs Because conformational-dependent MAbs provide useful and sensitive probes for analyzing structural alterations in mutant proteins, the capacities of CD66/CEACAM MAbs to recognize native as opposed to denatured forms of soluble recombinant CEACAM1 constructs were determined. Proteins were denatured by boiling for 5 minutes. in 0.1% (wt/vol) sodium dodecyl sulfate (SDS), and 0.2% (vol/vol) -mercaptoethanol. Samples of either untreated (native) or denatured CEACAM1-4-Fc and NCAM(D1-7)-Fc recombinant proteins (100 and 10 ng/100
µL) were analyzed for CD66 MAb antibody binding after slot blot
transfer to immobilon-polyvinylidene difluoride (PVDF)
membranes (Millipore, Bedford, MA), and incubation with CD66/CEACAM or
isotype-matched negative MAbs and sheep F(ab)2 antimouse
IgG-horseradish peroxidase. The membranes were developed using the
chemiluminescence kit (ECL; Amersham International, Little Chalfont,
Bucks, United Kingdom).
Site-directed mutagenesis of soluble recombinant CEACAM1-3-Fc complementary DNAs The initial site-directed mutagenesis of the N-terminal domain of CEACAM1-3-Fc complementary DNA (cDNA) used a set of sense and antisense primers containing the appropriate single, double, or triple mutations (Table 1) as detailed35 and illustrated in Figure 1. With CEACAM1-3-Fc as template, the first polymerase chain reaction (PCR) used either a sense primer (primer 1: 5' GAGAACCCACTGCTTAACTGG 3') specific to the H3M vector
plus an antisense primer that contained the appropriate mismatched
base(s) (Table 1) or a sense primer containing appropriate mismatched base(s) (Table 1) plus an antisense primer (primer 2: 5'
CTGATCCGGAGAATTCCTTACCTGT AGTGACTATGATCGTCTT GATGT 3') to the end of
the B domain, to create 2 PCR products that overlapped within the
region spanned by the mutagenized sense and antisense primers. The
reaction was carried out at 94°C for 10 minutes, followed by 25 cycles of 94°C for 1 minute, 47°C for 1 minute, 72°C for 2 minutes, with a final extension period of 72°C for 10 minutes.
Aliquots (5 µL) of each PCR product were annealed at 94°C for 1 minute and cooled to 37°C at 1°C for 1 minute before the addition
of 40 µL PCR mix containing primers 1 and 2 only. PCR was carried out
at 72°C for 2 minutes, followed by 30 cycles of 94°C for 1 minute,
50°C for 1 minute, and 72°C for 1 minute with a 5-minute extension
step at 72°C. The PCR products were digested with HindIII
and EcoR1 and cloned into the pIg vector.7
Using the Quickchange Mutagenesis Kit (Stratagene Europe, Amsterdam,
The Netherlands), site-directed mutagenesis was carried out to generate
CEACAM1-3-Fc mutants R64A, D82A, R38A, D40A, R64D, and D82R (Figure 1
and Table 1). After confirming mutated clones by automatic sequencing,
each cDNA mutant was transfected into Cos-1 cells and the soluble
proteins isolated on protein A-Sepharose as above.7
Analysis of the conformational integrity of mutated CEACAM1-3-Fc proteins To determine if any decreases in CHO-CEACAM1-4L adhesion to the mutant CEACAM1-3-Fc proteins were due to a modification in the region of contact between the 2 molecules or to a more drastic change in their tertiary structure, conformational analysis was performed for all the mutated proteins, using conformational-dependent and -independent CD66/CEACAM MAbs as detailed in the epitope mapping section.7In vitro adhesion assays Stable CHO CEACAM1-4L, CEACAM1-4S, CEACAM1-1S, or CHO-Neo transfectants were labeled with 1 µg/mL 2',7'-bis-(2-carboxyethyl)-5-(and -6)-carboxy fluoresceinacetoxymethylester (BCECF-AM; Molecular Probes, Eugene, OR) for 30 minutes at 37°C, prior to washing in phosphate-buffered saline (PBS)-0.2% (wt/vol) bovine serum albumin (BSA) or Puck saline (Gibco BRL, Paisley, Scotland)-0.2% (wt/vol) BSA and 5 to 10 × 104 added to Immulon 3 microtiter plates (Dynex Technologies, Chantilly, VA) precoated with 1 µg/well purified goat antihuman Fc antibody (Sigma Chemical) and 1 µg/well of the appropriate soluble recombinant protein for 60 minutes at 37°C. BCECF-AM fluorescence in each well was read on the Cytofluor II plate reader (Perseptive Biosystems, Hertford, United Kingdom) at an excitation wavelength of 485/20 nm, a gain of 70 and an emission wavelength of 530/30 nm. The plates were washed in PBS-0.2% (wt/vol) BSA and the percentage of cells adhering to the constructs estimated from the subsequent fluorescence determinations. Adhesion assays were carried out with 4 to 6 replicates on 2 to 7 independent occasions.Molecular modeling of the human CEACAM1 N-terminal domain The sequence from the N-terminal domain of CEACAM1 was run against a database of sequences from x-ray and NMR structures, using the program BLASTP.36 This identified the best templates for model building. Five Ig variable domains, human CD4,37 Bence-Jones VL dimer REI,38 rat CD2,39 human CD2,40 and human CD58,40 were then superimposed and used as a sequence and structural template. The superimposition was entirely automatic and not biased to any particular region. It was performed using Multisup (Dr P.A. Bates, ICRF, London, United Kingdom), a program based on a pairwise superposition alogorithm.41 The CEACAM1 sequence, plus other members of the family, were then automatically aligned to the structural template using a local program Mseq (Dr P.A. Bates, ICRF, London, United Kingdom). Due to the low identity between the CEACAM family and the templates, average 10%, sections of the alignment were manually adjusted to conserve buried hydrophobics and known features of the variable Ig fold. Secondary structure selection, loop building, and side chain replacements were done automatically using 3D-jigsaw,42 (Dr P.A. Bates, ICRF, London, United Kingdom) a program that optimizes fragment and side chain conformations.
The human CEACAM-4L and CEACAM-4S isoforms both mediate homophilic adhesion The CEACAM1-4L and CEACAM1-4S isoforms share identical extracellular domains and transmembrane sequences, but their cytoplasmic tails are composed of 73 or 9 amino acids, respectively. Previous studies indicate that rat CEACAM1 and human CEACAM1-4L, CEACAM1-3L, CEACAM1-4S, and CEACAM1-1L transfectants adhere homophilically.5,6,22,23,30,43-45 We have examined the ability of human CEACAM1-4L, CEACAM1-4S, and CEACAM1-1S transfectants to adhere directly to immobilized recombinant proteins carrying the entire extracellular domain CEACAM1-4L/S. Our results show that, despite the higher level of CEACAM1-1S expression on CHO-CEACAM1-1S transfectants, only the CEACAM1-4L and CEACAM1-4S transfectants were able to bind significantly (30%-62% of the input cells added) to immobilized CEACAM1-4-Fc molecules (Figure 2). Low to negligible levels of adhesion were observed when CHO-CEACAM1-1S cells, possessing the N-terminal, transmembrane, and short cytoplasmic domains only, were examined for their ability to adhere to this same CEACAM1-4-Fc protein (Figure 2). This suggested that the N terminal domain in such transfectants was not as readily accessible for binding to recombinant soluble CEACAM1-4-Fc proteins or that, without the IgC2 domains or long cytoplasmic tail, the avidity of adhesion was decreased and could not be maintained in this type of receptor/ligand binding assay.
The N-terminal domain alone does not mediate strong homophilic interactions To investigate whether CHO-CEACAM1-4L transfectants were able to adhere to different extracellular domains of CEACAM1-4L/S in the absence of a cellular background, we constructed soluble recombinant domain deletion variants of CEACAM1-4L/S containing the N-terminal domain (CEACAM1-1-Fc) or the N-terminal domain linked to the A1B (CEACAM1-3-Fc) or A1BA2 (CEACAM1-4-Fc) domains, which mimicked the extracellular domains of the CEACAM1-1L/S, CEACAM1-3L/S, and CEACAM1-4L/S isoforms, respectively. Figure 2 shows the mean ± SD of 7 independent experiments in which immobilized CEACAM1-1-Fc bound weakly to CHO-CEACAM1-4L transfectants, in contrast to the much stronger adhesion to immobilized CEACAM1-3-Fc and CEACAM1-4-Fc proteins. An average of 26% ± 9% of the CHO-CEACAM1-4L cells adhered to the CEACAM1-1-Fc construct compared to 52% ± 7% and 56% ± 5% to the CEACAM1-3-Fc and CEACAM1-4-Fc proteins, respectively. For the CHO-CEACAM1-4S transfectants, slightly higher levels of adhesion were obtained in the presence as opposed to the absence of the A2 domain. However, binding of these cells to the CEACAM1-1-Fc protein was similar to that observed using irrelevant CD31(D1-3)-Fc and CD14-Fc controls (Figure 2). For the CHO-CEACAM1-1S transfectants, essentially no binding to the CEACAM1-1-Fc- or CEACAM1-3-Fc-immobilized proteins above background was detected, whereas adhesion to the CEACAM1-4-Fc construct was low to negligible (Figure 3). Because the CEA, CEACAM3, CEACAM6, and CEACAM8 molecules have been shown previously30,46-48 to interact heterophilically when expressed in cell lines, we examined the adhesion of HeLa-CEA, -CEACAM3L, and -CEACAM6 to immobilized recombinant forms of CEACAM1-4-Fc (Figure 2). Only weak adhesion (1.7- to 2.1-fold higher than for CD14-Fc) occurred despite the fact that these molecules share 89% to 91% amino acid identity in their N-terminal domains (Figure 1A). Taken together, our studies show that the A2 domain and long cytoplasmic tail are not essential for this homophilic interaction, although they appear to stabilize or increase avidity of binding.
Definition of key amino acid residues on the CFG face of the CEACAM1 N-terminal domain involved in homophilic adhesion It has been demonstrated that (1) rat CEACAM1 lacking the N-terminal domain but containing the A1B1A2 domains failed to mediate adhesion,20,21 and (2) mutagenesis of a single amino acid within the GPAYSGRET N-domain sequence of rat CEACAM1 and corresponding to R64 in human CEACAM1 prevented aggregation of Sf9 transfectants.19 This mutation would be predicted to destabilize the tertiary structure of the N-terminal domain of rat CEACAM1 by preventing intrastrand salt bridge formation between the base of strands D and F at residues R64 and D82.49 To
determine the importance of these and other amino acid residues from
the N-terminal domain of human CEACAM1 in homophilic adhesion and
because high levels of homophilic adhesion had been achieved between
the CEACAM1-3-Fc construct and the CHO-CEACAM1-4L transfectants, we
subjected specific amino acid residues within the N-terminal domain of
CEACAM1-3-Fc to site-directed mutagenesis. The primary amino acid
sequences of this N-terminal domain of CEACAM1 were aligned with those
of other human CEACAM family members (Figure 1A) and with human and rat CD2 and human CD58 (Figure 1B). This alignment was based on x-ray crystallographic coordinates for CD2 and CD58.25 From the
molecular model for the N-domain of CEACAM1 (Figure 3), we also
predicted which amino acid residues in the N-terminal domain of CEACAM1 contributed to the different strands of the Ig structure. Figure 3
shows the predicted arrangement of 9 strands arranged on 2 faces,
GFCC'C" and ABED. Initially, 9 specific mutations in residues predicted
to be solvent accessible and exposed at the surface of CEACAM1 were
targeted onto the GFCC'C" face and 4 on the opposite ABED face. Two
mutations at residues R38 and D40 adjacent to V39 on the GFCC'C" face
were also made. The amino acid residues selected were all substituted
with alanine (A) residues. The single salt bridge across the GFCC'C"
interface is predicted to involve residues R43 and E98. To disrupt
this, the E98A mutation was made. In addition, residues R64 and D82 are
predicted to form an intrafold salt bridge between the GFCC'C" and ABED
faces, but this does not occur on the GFCC'C" face. These were mutated
individually to alanine residues (R64A, D82A) or to R64D (aspartic
acid), or D82R (arginine) to disrupt this salt bridge. To regain
function, the salt bridge within the R64D mutant was restored but in
the opposite amino acid orientation by introducing a second mutation at
D82R (Figure 1B).
Identification of CEACAM1 N-domain reactive Mabs To determine which CD66/CEACAM MAbs recognize the CEACAM family members, we analyzed a set of MAbs on CEACAM1-4L, CEACAM1-4S, CEACAM1-1S, CEA, CEACAM3L, CEACAM6, and CEACAM8 CHO or HeLa transfectants and on different CEACAM1 soluble isoforms. Two of these MAbs, 26H7 and 5F4, appeared to be specific for CEACAM1. The other MAbs reacted variably with different CEACAM molecules (Table 2). The 26H7, 5F4, 12-140-4, 4/3/17, COL-4, YG-C28F2, D14HD11, 34B1, B18.7.7, D11-AD11, HEA 81, CLB-gran-10, F34-187, T84.1, B6.2, and B1.1 MAbs recognize the N-terminal domain of CEACAM1. The F36-54, YG-C94G7, 12-140-5 and TET-2 MAbs react with both the CEACAM1-3-Fc and CEACAM1-4-Fc constructs, but not the CEACAM1-1-Fc protein (Table 2).
Identification of conformationally dependent CD66/CEACAM MAbs Our results classify the CD66/CEACAM MAbs analyzed into 3 groups. Only one MAb, F34-187, reacted equally well with the native and denatured forms of the CEACAM1-4-Fc protein. Eight MAbs, CLB-gran-10, T84.1, B18.7.7, D14HD11, HEA 81, B1.1, 34B1, and 4/3/17, reacted with the native form and, to a lesser extent, with the denatured protein. Nine MAbs, YG-C94G7, TET-2, 12-140-5, COL-4, 26H7, 5F4, B6.2, YG-C28F2, and 12-140-4, of which the latter 6 are N-terminal domain reactive, reacted preferentially with the native protein and were conformationally dependent (Figure 4).
Analysis of the conformational integrity of mutated CEACAM1-3-Fc soluble proteins and identification of sites for CD66/CEACAM1 MAb reactivity Conformational analysis was carried out on the mutated CEACAM1-3-Fc constructs using these MAbs to establish whether any alterations in their adhesion to CHO-CEACAM1-4L transfectants might result from a major change in their tertiary structure, rather than in the region of contact between the 2 opposing molecules. The majority of MAbs tested reacted with the mutated and native CEACAM1 constucts in a manner similar to that observed for the conformational independent MAb, F34-187 (Figure 5A), suggesting that most single amino acid substitutions did not drastically affect the general tertiary CEACAM1-3-Fc structure. Three of the conformationally dependent MAbs showed major reductions in binding. These were (1) COL-4, which did not react with the I91A or T87AQ89AI91A mutants; (2) 12-140-4, which failed to bind to the Y34A or S32AY34AV39A mutants; and (3) 5F4, which did not bind the Y34A, S32AY34AV39A, or T87AQ89AI91A mutants and showed reduced adhesion to constructs carrying single mutations, T87A, Q89A, and I91A, in the F strand and FG loop. Most
N-domain-specific MAbs showed reduced binding to single R64 and D82
mutants (Figure 5B). This was restored in all cases after introduction
of the second D82R mutation into the R64D mutant (R64D D82R; Figure 5B)
and reformation of the salt bridge, suggesting that this salt bridge
was required for the conformational integrity of CEACAM1.
The GFCC'C" face and CC' loop of N terminal domain of CEACAM1 are crucial for mediating homophilic adhesion Our results show that mutation of valine 39 to alanine (V39A) on the CC' loop abrogated the adhesion of CEACAM1-3-Fc to CHO-CEACAM1-4L transfectants (Figure 6). A slight but less significant decrease in adhesion of the transfectants to soluble proteins carrying a mutation at serine 32 (S32A) was also observed. The mutation at tyrosine 34 (Y34A) did not affect adhesion, despite the lack of reactivity of this mutant protein with the 5F4 and 12-140-4 MAbs (Figures 5 and 6). As with the V39 mutation, the triple mutation (S32A Y34A V39A) also ablated adhesion. Further mutation of single amino acids on either side of V39, in particular R38A and D40A, revealed that the latter but not the former mutation, abolished homophilic adhesion (Figure 7). These results indicate that residues V39 and D40 in the CC' loop affect adhesion more significantly than those tested in the C strand
(S32A, Y34A). Mutation of residues T87, Q89, and I91 to alanine
residues in the F strand had no major effects on adhesion when used
alone, again despite the fact that mutation of I91A abrogated 5F4 and
COL-4 MAb binding (Figures 5 and 6). However, when all 3 mutations were
present on the same molecule, adhesion was dramatically inhibited
(Figure 6), even when the concentration of this mutant was doubled
(data not shown). This may be due to a more severe change in the domain conformation with all the accessible polar residues of the F strand
substituted by neutral residues. Residues V96 and E98 are located in
the FG loop of the N-terminal domain, with E98 predicted to form a salt
bridge with R43 across the GFCC'C" interface. Substitution of V96 with
alanine either alone or as a double mutant, V96E98, inhibited adhesion
slightly, whereas the E98 mutation had no effect. Thus, the predicted
salt bridge between residues R43 and E98 is not important for
homophilic adhesion. The control ABED face mutants, L18L20 (B strand) and S72L74 (E strand) had no overall significant effect on
binding. Alignment studies predicted a second intrafold salt bridge
between residues R64 and D82 in the N-terminal domain of CEACAM1 at the
base of the D and F strands (Figures 1 and 3). Our results (Figure
7) confirm studies by Sippel and coworkers19 that mutation
of the equivalent R64 residue in rodent CEACAM1 inhibits homophilic
adhesion and they further reveal that single amino acid mutations
involving these salt bridge residues (R64A, R64D, D82A, or D82R)
abrogate homophilic adhesion of CEACAM1. When this salt bridge is
restored, albeit in the opposite amino acid orientation, the
gain-of-function mutant is capable of binding to human CEACAM1
homophilically (Figure 7). These results strongly suggest that neither
the R43 to E98 salt bridge at the GFCC'C' interface nor the R64 to D82
intrafold salt bridge is involved directly in the binding site, but
that the R64 to D82 salt bridge is required for fold stability and thus
indirectly affects the binding site.
Using an alanine-scanning mutagenesis approach, we have identified key amino acids on the N-terminal IgV domain of human CEACAM1 that are involved in homophilic adhesion. Most notably, the V39 and D40 residues on the CC' loop play a critical role in this process. Residues closely associated with V39 and D40 and positioned in the molecular model in the lower region of the GFCC'C" face, particularly R38, Y34, Q44, and T87, as well as those at some distance away and positioned at the top of the GFCC'C" face, namely I91, V96 and E98, if mutated individually, and those on the ABED face did not abrogate adhesion. The importance of the GFCC'C" face of the CEACAM1 N-terminal domain in
regulating adhesive interactions and signaling is underscored in
several other experimental systems. First, CEACAM1 peptides that
activate neutrophils by up-regulating their expression of CD11/CD18 and
down-regulating their expression of L-selectin, thereby enhancing
adhesion of neutrophils to endothelium, span the first 48 amino acids
of the N-terminal domain, an area that encompasses the CC' loop
sequence.50 Heterophilic interactions of the CEACAM1
N-terminal domain with murine corona viruses, H influenzae
and Opa proteins of N meningiditis and N
gonorrheae also occur on the GFCC'C" face of
CEACAM1.18,50-57 Amino acids between 34 to 52 in the CC'
loop region of the murine CEACAM1 N-terminal domain are crucial for
murine corona virus interaction.51 Similarly, amino acids
between residues 27 to 42 (particularly the triplet Q27L28F29) and S32,
Y34, V39, Q44, Q89, and I91 on the GFCC'C" face of human CEACAM1 form
differential adhesiotopes for the surrogate pathogen coreceptors
described above.18,53,54 These adhesiotopes are predicted
to either reside in a groove formed by homophilic interactions of
CEACAM1 in cis that involve the V39 and D40 CC' loop
residues or are exposed after disruption of CEACAM1 cis
dimerization by cytokine (eg, tumor necrosis factor- One might envisage that the molecular mechanisms designed to control CEACAM1 homophilic and heterophilic adhesion resemble, but are distinct from, the interactions observed for other adhesion receptor-ligand pairs, such as of CD2 with CD58, of ICAM-1 with ICAM-1, LFA-1, rhinoviruses or Plasmodium falciparum-infected erythrocytes, and of cadherins with cadherins. Such studies when taken together support the proposal that the GFCC'C" faces of the Ig family members may have evolved as a sticky patch to recognize a variety of protein-protein interactions.59 Superimposing 2 domains of CEACAM1 in a similar orientation to the packing geometry found for CD2-CD2 and CD2-CD58 indicates that the interface of CEACAM1 is much less hydrophilic than that found in CD2 interactions with either CD2 or CD58,60,61 with the CD2-CD58 interface being particularly dominated by charged residues. No less than 10 salt bridges and 5 hydrogen bonds have been identified at this interface.25 Thus, a significant number of charged residues are engaged in a complex salt bridge network ensuring high specificity with interacting coreceptors. For CEACAM-1, assuming a similar packing arrangement, only one potential salt bridge involving residues R43 and E98 at the base of the C' strand and the top of the G strand can be identified at the adhesive interface. Mutation of one of the contributing residues to this predicted salt bridge, E98, had no effect on and was not essential for homophilic adhesion. A conserved intrastrand salt bridge is also predicted, but this does
not lie on the GFCC'C" interface in our proposed molecular model. One
of the contributing amino acids to this salt bridge is R64 at the base
of the D Discriminating between cis and trans interactions
is important for both heterophilic and homophilic adhesion molecules
when expressed on the same and opposing cells, with cis
interactions being able to either block or enhance interactions in
trans. Insight into the molecular mechanisms for CEACAM1
interactions may come from studies on molecules such as ICAM-1 or
N-cadherin. The crystal structure of the 2 N-terminal domains of ICAM-1
has revealed that both domains function in integrin (LFA-1) binding,
the first interacting with residues on LFA-1 and the second involved in
orienting the recognition surface of the first domain so that the
counterreceptors can achieve optimal contact in trans, while
preventing recognition of cis counterreceptors on the same
cell.61 Interestingly, the ICAM-1 binding sites for its
cognate coreceptor LFA-1 and its surrogate pathogenic counterreceptors
are almost all different.61 The position of amino acids on
the GFCC'C" face of CEACAM1 used for homophilic, Neisserial
Opa protein and H influenzae adhesion is reminiscent
of but differs significantly from the critical amino acids on ICAM-1
that are required for interactions of its N-terminal domain in
cis and trans. In the case of N-cadherin, the
functional N-terminal domain contains 7 Previous studies have shown that the N-terminal domain is crucial for homophilic interactions of rat CEACAM1.21 Although single deletions of the IgC2 domains, A1, B, and A2, did not affect adhesion, deletions of the N-domain alone or of the A1, B, and A2 domains together abrogated adhesion and deletions of both the B and A2 domains reduced adhesion substantially.21 The IgC2 domains as well as the N domain of CEACAM1 have been implicated in corona virus receptor activity,51 and H influenzae binding.18 We have observed significantly reduced binding of CHO-CEACAM1-4L and -4S transfectants to immobilized human CEACAM1 N-domain constructs. The avidity of adhesion was also reduced if the A2 domain was removed from the CEACAM1-4 soluble molecule. Whereas previous studies have shown that cells expressing CEACAM1-4L and -4S are able to mediate homophilic adhesion,6,64-67 our studies show that CEACAM1-4S in contrast to CEACAM1-4L transfectants bind less avidly to immobilized CEACAM1 molecules and suggest that the IgC2 and cytoplasmic domains of CEACAM1 may regulate the specificity and avidity of homophilic and heterophilic interactions or signaling functions. Several observations support this view. First, no transmembrane isoform of CEACAM1 containing N and A1 ectodomains only has been identified,2 suggesting that such an isoform does not have functional significance. Second, multiple splice variants of CEACAM1 lacking IgC2 domains and possessing long or short cytoplasmic tails exist,2 yet each CEACAM1 isoform will preferentially form homodimers in cis,68,69 a process regulated by its interaction with calmodulin68,69 and by the relative levels of expression of the different isoforms on a single cell type.1 Third, cross-linking studies suggest that the ectodomains of specific CEACAM1 isoforms are closely associated,1 with the formation of homodimers appearing to require interactive sequences in the extracellular domain, cytoplasmic tail, and transmembrane region.1,44,70 It might be speculated that the expression levels, the conformation, and association of the different CEACAM1 isoforms in the cell membrane regulate the interaction of their N-terminal domains in cis or trans and thereby their ability to mediate homophilic or heterophilic functions. Homophilic interactions or dimerization of CEACAM1 molecules in cis may maintain the receptor in an inactive conformation for interacting with opposing cells, or place the N terminal GFCC'C" face in the correct orientation to increase the avidity of binding to homophilic or heterophilic counterreceptors on the same or opposing cells as has been described for ICAM-1 and the cadherins and predicted for CEA.49 Engagement of CEACAM1 homophilically on the same epithelial cell may prevent its interaction in trans and may deliver a negative signal inhibiting epithelial cell proliferation, a regulatory mechanism that is lost when CEACAM1 levels are decreased during epithelial tumor formation.1,2 Alternatively, the activation of CEACAM1 molecules on the surface of neutrophils during inflammation may control the presentation of sLex residues to E-selectin ligands on endothelial cells and regulate CD11/CD18 and L-selectin levels.11,49,71 On endothelial and epithelial cells, CEACAM1 activation, perhaps by inducing or inhibiting homophilic interactions or dimerization, may also regulate isoform concentrations on the cell surface, orient the molecules, or increase the avidity of adjacent residues on the GFCC'C" face of CEACAM1 for Neisserial Opa proteins or H influenzae.14-17,52-56 A high degree of sequence similarity exists between the N-domains of CEACAM-1 and CEA. A model of CEA49 has suggested that the Ig domains of CEA dimerize and subsequently align in parallel on the surface of the cell, making residues in the N-terminal domain of CEA accessible for homophilic adhesion in trans. However, subsequent biochemical studies23 have suggested that high affinity homophilic binding involves domains 1 and 6 of CEA. Nevertheless, this does not preclude a first phase of lower affinity binding between just the N-terminal domains of CEA as the 2 cell surface membranes approach each other. The subtle sequence variations on the GFCC'C" faces of CEA and CEACAM-1 are thus a key feature for further study and for x-ray crystallographic analyses.
Submitted November 15, 1999; accepted April 17, 2001.
Supported by the National Blood Service, Medical Research Council and Leukaemia Research Fund, United Kingdom, and by European Union Biotech and INTAS/RFBR grants (to S.M.W., A.M.T., G.-Q.Z., R.D., and Y.Z.); by a postdoctoral grant of the Fundacao para a Ciencia e Tecnologia, Portugal (to A.M.T.); by the Deutsche Krebshilfe Project number 70-2028 (to F.G.); and by National Institutes of Health grant DK51362 (to R.S.B.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Suzanne M. Watt, Stem Cell Laboratory, National Blood Service, The John Radcliffe Hospital, Headington, Oxford, OX3 9DS, United Kingdom; e-mail: swatt{at}molbiol.ox.ac.uk.
1. Obrink B. CEA adhesion molecules: multifunctional proteins with signal-regulatory properties. Curr Opin Cell Biol. 1997;9:616-626[CrossRef][Medline] [Order article via Infotrieve]. 2. Beauchemin N, Draber P, Dveksler G, et al. Redefined nomenclature for members of the carcinoembryonic antigen family. Exp Cell Res. 1999;252:243-249[CrossRef][Medline] [Order article via Infotrieve].
3.
Watt SM, Sala-Newby G, Hoang T, et al.
CD66 identifies a neutrophil-specific epitope within the hematopoietic system that is expressed by members of the carcinoembryonic antigen family of adhesion molecules.
Blood.
1991;78:63-74
4.
Morales V, Crist A, Watt SM, et al.
Regulation of human intestinal intraepithelial lymphocyte cytolytic function by biliary glycoprotein (CD66a).
J Immunol.
1999;163:1363-1370
5.
Watt SM, Fawcett J, Murdoch SJ, et al.
CD66 identifies the biliary glycoprotein (BGP) adhesion molecule: cloning, expression and adhesion functions of the BGPc splice variant.
Blood.
1994;84:200-210 6. Rojas M, Fuks A, Stanners CP. Biliary glycoprotein, a member of the immunoglobulin supergene family, functions in vitro as a Ca++ dependent intercellular adhesion molecule. Cell Growth Differ. 1990;1:527-533[Abstract].
7.
Teixeira AM, Fawcett J, Simmons DL, Watt SM.
The N-domain of the biliary glycoprotein (BGP) adhesion molecule mediates homotypic binding: domain interactions and epitope analysis of BGPc.
Blood.
1994;84:211-219 8. Skubitz KM, Campbell KD, Skubitz APN. CD66a, CD66b, CD66c and CD66d each independently stimulate neutrophils. J Leukoc Biol. 1996;60:106-117[Abstract]. 9. Ergun S, Kilik N, Ziegeler G, et al. CEA-related cell adhesion molecule 1: a potent angiogenic factor and a major effector of vascular endothelial growth factor. Mol Cell. 2000;5:311-320[CrossRef][Medline] [Order article via Infotrieve]. 10. Holmes KV, Dveksler G, Gagneten S, et al. Coronavirus receptor specificity. Adv Exp Med Biol. 1993;342:261-266[Medline] [Order article via Infotrieve]. 11. Stocks SC, Kerr MA, Haslett C, Dransfield I. CD66-dependent neutrophil activation: a possible mechanism for vascular selectin-mediated regulation of neutrophil adhesion. J Leukoc Biol. 1995;58:40-48[Abstract].
12.
Kuijpers TW, Hoogerwerf M, van der Laan LJW, et al.
CD66 non-specific cross-reacting antigens are involved in neutrophil adherence to cytokine activated endothelial cells.
J Cell. Biol.
1992;118:457-466 13. Virji M, Makepeace K, Ferguson DJP, Watt SM. Carcinoembryonic antigens (CD66) on epithelial cells and neutrophils are receptors for Opa proteins of pathogenic neisseriae. Mol Microbiol. 1996;22:941-950[CrossRef][Medline] [Order article via Infotrieve]. 14. Virji M, Watt SM, Barker S, Makepeace K, Doyonnas R. The N-domain of the human CD66a adhesion molecule is a target for Opa proteins of Neisseria meningitidis and Neisseria gonorrhoeae. Mol Microbiol. 1996;22:929-939[CrossRef][Medline] [Order article via Infotrieve]. 15. Bos MP, Grunert F, Belland RJ. Differential recognition of members of the carcinoembryonic antigen family by Opa variants of Neisseria gonorrhoeae. Infect Immun. 1997;65:2353-2361[Abstract].
16.
Chen T, Grunert F, Medina-Marino A, Gotschlich EC.
Several carcinoembryonic antigens (CD66) serve as receptors for gonococcal opacity proteins.
J Exp Med.
1997;185:1557-1564 17. Gray-Owen SD, Dehio C, Gaude A, Grunert F, Meyer TF. CD66 carcinoembryonic antigens mediate interactions between Opa-expressing Neisseria gonorrhoeae and human polymorphonuclear phagocytes. EMBO J. 1997;16:3435-3445[CrossRef][Medline] [Order article via Infotrieve]. 18. Virji M, Evans D, Griffith J, et al. Carcinoembryonic antigens are targeted by diverse strains of typable and non-typable Haemophilus influenzae. Mol Microbiol. 2000;36:784-759[CrossRef][Medline] [Order article via Infotrieve].
19.
Sippel CJ, Shen T, Perlmutter DH.
Site-directed mutagenesis within an ectroplasmic ATPase consensus sequence abrogates the cell aggregating properties of the rat liver canalicular bile acid transporter/Ecto-ATPase/cell CAM 105 and carcinoembryonic antigen.
J Biol Chem.
1996;271:33095-33104 20. Wikstrom K, Kjellstrom G, Obrink B. Homophilic intercellular adhesion mediated by C-CAM is due to a domain 1-domain 1 reciprocal binding. Exp Cell Res. 1996;227:360-366[CrossRef][Medline] [Order article via Infotrieve].
21.
Cheung PH, Luo W, Qiu Y, et al.
Structure and function of C-CAM1.
J Biol Chem.
1993;268:24303-24310 22. Rojas M, DeMarte L, Screaton RA, Stanners CP. Radical differences in functions of closely related members of the human carcinoembryonic antigen gene family. Cell Growth Differ. 1996;7:655-662[Abstract].
23.
Zhou H, Fuks A, Alcaraz G, Bolling TJ, Stanners CP.
Homophilic adhesion between Ig superfamily carcinoembryonic antigen molecules involves double reciprocal bonds.
J Cell Biol.
1993;122:951-960 24. Jones EY, Davis SJ, Williams AF, Harlos K, Stuart DI. Crystal structure at 2.8: a resolution of a soluble form of the cell adhesion molecule CD2. Nature. 1992;360:232-239[CrossRef][Medline] [Order article via Infotrieve]. 25. Wang J-H, Smolyar A, Tan K, et al. Structure of a heterophilic adhesion complex between the human CD2 and CD58 (LFA-3) counterreceptors. Cell. 1999;97:791-803[CrossRef][Medline] [Order article via Infotrieve]. 26. Sun Z-YJ, Dotsch V, Kim M, Li J, Reinherz EL, Wagner G. Functional glycan-free adhesion domain of human cell surface receptor CD58: design, production and NMR studies. EMBO J. 1999;18:2941-2949[CrossRef][Medline] [Order article via Infotrieve].
27.
Ikemizu H, Sparks LM, Van der Merwe A, et al.
Crystal structure of the CD2-binding domain of CD58 (lymphocyte function-associated antigen 3) at 1.8-A resolution.
Proc Natl Acad Sci U S A.
1999;96:4289-4294 28. Skubitz KM, Micklem K, van der Schoot E. CD66 and CD67 cluster workshop report. In: Schlossman SF,Boumsell L,Gilks W, et al., eds. Leucocyte Typing V. Oxford United Kingdom: Oxford University Press; 1995:889-899. 29. Skubitz KM, Grunert F, Jantscheff P, Kuroki M, Skubitz APN. Summary of the CD66 cluster workshop. In: Kishimoto, ed. Leukocyte Typing VI. New York: Garland Publishing; 1997:992-1000. 30. Oikawa S, Kuroki M, Matsuoka Y, Kosaki G, Nakazato H. Homotypic and heterotypic Ca++ independent cell adhesion activities of biliary glycoprotein, a member of the carcinoembryonic antigen family, expressed on CHO cell surface. Biochem Biophys Res Commun. 1992;186:881-887[CrossRef][Medline] [Order article via Infotrieve]. 31. Nagel G, Grunert F, Kuijpers TW, Watt SM, Thompson J, Zimmermann W. Genomic organisation, splice variants and expression of CGMI, a CD66-related member of the carcinoembryonic antigen gene family. Eur J Biochem. 1993;214:27-35[Medline] [Order article via Infotrieve]. 32. Daniel S, Nagel G, Johnson JP, et al. Determination of the specificities of monoclonal antibodies recognizing members of the CEA family using a panel of transfectants. Int J Cancer. 1993;55:303-310[Medline] [Order article via Infotrieve].
33.
Berling BF, Kolbinger F, Grunert F, et al.
Cloning of a carinoembryonic antigen gene family member expressed by leukocytes of chronic-myeloid leukemia patients and bone marrow.
Cancer Res.
1990;50:6534-6539
34.
Watt SM, Williamson J, Genevier H, et al.
The heparin binding PECAM-1 adhesion molecule is expressed by CD34+ hematopoietic precursor cells with early myeloid and B-lymphoid cell phenotypes.
Blood.
1993;82:2649-2663
35.
Higuchi R, Krummel B, Saiki RK.
A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and cDNA.
Nucleic Acids Res.
1988;16:7351-7367 36. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410[CrossRef][Medline] [Order article via Infotrieve]. 37. Wang J, Yan Y, Garrett TPJ, et al. Atomic structure of human CD4 containing two immunoglobulin-like domains. Nature. 1990;348:411-418[CrossRef][Medline] [Order article via Infotrieve]. 38. Epp O, Lattman EE, Shiffer M, Huber R, Palm W. The molecular structure of a dimer composed of the variable portions of the Bence-Jones protein 1REI refined at 2.0 angstroms resolution. Biochemistry. 1975;353:4943-4952. 39. Driscoll PC, Cyster JG, Campbell ID, Williams AF. Structure of domain 1 of rat T lymphocyte CD2 antigen. Nature. 1991;353:762-765[CrossRef][Medline] [Order article via Infotrieve]. 40. Wyss DF, Choi JS, Wagner G. Composition and sequence specific resonance assignments of the heterogeneous N-linked glycan in the 13.6 kDa adhesion domain of human CD2 as determined by NMR on the intact glycoprotein. Biochemistry. 1995;34:1622-1634[CrossRef][Medline] [Order article via Infotrieve]. 41. Gerstein M, Levitt M. Using interactive dynamic programming to obtain accurate pairwise and multiple alignments of protein structure. Fourth International Conference on Intelligent Systems for Molecular Biology. Menlo Park: CA; 1996:59-67. 42. Bates PA, Sternberg MJE. Model building by comparison at CASP3: using expert knowledge and computer automation. Proteins. 1999;37 (suppl 3):47-54. 43. Lin S-H, Luo W, Earley K, Cheung P, Hixson DC. Structure and function of C-CAM1: effects of the cytoplasmic domain on cell aggregation. Biochem J. 1995;311:239-245. 44. Hunter I, Sawa H, Edlund M, Öbrink B. Evidence for regulated dimerization of cell-cell adhesion molecule (C-CAM) in epithelial cells. Biochem J. 1996;320:847-853. 45. Hunter I, Lindh M, Obrink B. Differential regulation of C-CAM isoforms in epithelial cells. J Cell Sci. 1994;107:1205-1216[Abstract]. 46. Oikawa S, Inusuka C, Kuroki M, Matsuoka Y, Kosaki G, Nakazato H. Cell adhesion of non-specific cross-reacting antigen (NCA) and carcinoembryonic antigen (CEA) expressed on CHO cell surface: homophilic and heterophilic adhesion. Biochem Biophys Res Commun. 1989;164:39-45[CrossRef][Medline] [Order article via Infotrieve].
47.
Oikawa S, Inuzuka C, Kuroki M, et al.
A specific heterotypic cell adhesion activity between members of the carcinoembryonic antigen family, W272 and NCA, is mediated by N-domains.
J Biol Chem.
1991;266:7995-8001 48. Oikawa S, Sugiyama M, Kuroki M, Kuroki M, Nakazato H. Extracellular N-domain alone can mediate specific heterophilic adhesion between members of the carcinoembryonic antigen family, CEACAM6 and CEACAM8. Biochim Biophys Res Commun. 2000;278:564-568[CrossRef][Medline] [Order article via Infotrieve]. 49. Bates PA, Luo J, Sternberg MJE. A predicted three-dimensional structure for the carcinoembryonic antigen (CEA). FEBS Lett. 1992;301:207-214[CrossRef][Medline] [Order article via Infotrieve].
50.
Skubitz KM, Campbell KD, Skubitz APN.
Synthetic peptides of CD66a stimulate neutrophil adhesion to endothelial cells.
J Immunol.
2000;164:4257-4264
51.
Wessner DR, Shick PC, Lu J-H, et al.
Mutational analysis of the virus and monoclonal antibody binding sites in MHVR, the cellular receptor of the murine coronavirus mouse hepatitis virus strain A59.
J Virol.
1998;72:1941-1948
52.
Bos MP, Hogan D, Belland RJ.
Homologue scanning mutagenesis reveals CD66 receptor residues required for neisserial opa protein binding.
J Exp Med.
1999;190:331-340 53. Virji M, Evans D, Hadfield A, Grunert F, Teixeira AM, Watt SM. Critical determinants of host receptor targeting by Neisseria meningiditis and Neisseria gonorrhoeae: identification of Opa adhesiotopes on the N-domain of CD66 molecules. Mol Microbiol. 1999;34:538-548[CrossRef][Medline] [Order article via Infotrieve]. 54. Popp A, Dehio C, Grunert F, Meyer TF, Gray-Owen SD. Molecular analysis of neisserial Opa protein interactions with the CEA family of receptors: identification of determinants contributing to the differential specificities of binding. Cell Microbiol. 1999;1:169-181[CrossRef][Medline] [Order article via Infotrieve].
55.
Bos MP, Kuroki M, Krop-Watorek A, Hogan D, Belland RJ.
CD66 receptor specificity exhibited by neisserial Opa variants is controlled by protein determinants in CD66 N-domains.
Proc Natl Acad Sci U S A.
1998;95:9584-9589
56.
Chen T, Gotschlich EC.
CGM1 antigen of neutrophils, a receptor of gonococcal opacity proteins.
Proc Natl Acad Sci U S A.
1996;93:14851-14856 57. Wang J, Gray-Owen SD, Knorre A, Meyer TF, Dehio C. Opa binding to cellular CD66 receptors mediates the transcellular traversal of Neisseria gonorrhoeae across polarized T84 epithelial cell monolayers. Mol Biol. 1998;30:657-671.
58.
Muenzer P, Dehio C, Fujiwara T, Achtman M, Meyer TF, Gray-Owen SD.
Carcinoembryonic antigen family receptor specificity of Neisseria meningiditis Opa variants influences adherence to and invasion of proinflammatory cytokine-activated endothelial cells.
Infect Immun.
2000;68:3601-3607 59. Springer TA. The sensation and regulation of interactions with the extracellular environment: the cell biology of lymphocyte adhesion receptors. Annu Rev Cell Biol. 1990;6:359-402[CrossRef]. 60. Davis SJ, Ikemizu S, Wild MK, Van der Merwe PA. CD2 and the nature of protein interactions mediating cell-cell recognition. Immunol Rev. 1998;163:217-236[CrossRef][Medline] [Order article via Infotrieve]. 61. Wang J, Springer TA. Structural specializations of immunoglobulin superfamily members for adhesion to integrins and viruses. Immunol Rev. 1998;163:197-215[CrossRef][Medline] [Order article via Infotrieve]. 62. Taheri M, Saragovi U, Fuks A, Makkerh J, Mort J, Stanners CP. Self-recognition in the Ig superfamily: identification of precise subdomains in carcinoembryonic antigen required for intercellular adhesion. J Biol Chem. 2000;35:25935-25948. 63. Shapiro L, Fannon AM, Kwong PD, et al. Structural basis of cell-cell adhesion by cadherins. Nature. 1995;374:327-337[CrossRef][Medline] [Order article via Infotrieve]. 64. Stanners CP, Fuks A. Properties of adhesion mediated by the human CEA family. In Stanners CP, ed. Cell adhesion and communication mediated by the CEA family. Amsterdam, The Netherlands: Harwood Academic Publishers; 1998:57-71.
65.
Turbide C, Kunath T, Daniels E, Beauchemin N.
Optimal ratios of biliary glycoprotein isoforms required for inhibition of colonic tumor growth.
Cancer Res.
1997;57:2781-2788 66. Stanners CP, DeMarte L, Rogas M, Gold P, Fuks A. Opposite functions for two classes of genes of the human carcinoembryonic antigen family. Tumor Biol. 1995;16:23-31. 67. Olsson H, Wikstrom K, Kjellstrom G, Obrink B. Cell adhesion activity of the short cytoplasmic domain isoform of C-Cam (C-CAM2) in CHO cells. FEBS Lett. 1995;1:51-56.
68.
Edlund M, Blikstad I, Obrink B.
Calmodulin binds to specific sequences in the cytoplasmic domain of C-CAM and down-regulates C-CAM self-association.
J Biol Chem.
1996;271:1393-1399 69. Edlund M, Gaardsvoll H, Bock E, Obrink B. Different isoforms and stock-specific variants of the cell adhesion molecule C-CAM (cell-CAM 105) in rat liver. Eur J Biochem. 1993;213:1109-1116[Medline] [Order article via Infotrieve]. 70. Hunter I, Sigmundsson K, Beauchemin N, Obrink B. The cell adhesion molecule C-CAM is a substrate for tissue transglutaminase. FEBS Lett. 1998;425:141-144[CrossRef][Medline] [Order article via Infotrieve]. 71. Stocks SC, Kerr MA. Neutrophil NCA-160 (CD66) is the major protein carrier of selectin binding carbohydrate groups Lewis X and sialyl Lewis X. Biochem Biophys Res Commun. 1993;195:478-483[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
Z. Chen, L. Chen, S.-W. Qiao, T. Nagaishi, and R. S. Blumberg Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 Inhibits Proximal TCR Signaling by Targeting ZAP-70 J. Immunol., May 1, 2008; 180(9): 6085 - 6093. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Chen, J. Kirshner, M. A. Sherman, W. Hu, T. Nguyen, and J. E. Shively Mutation Analysis of the Short Cytoplasmic Domain of the Cell-Cell Adhesion Molecule CEACAM1 Identifies Residues That Orchestrate Actin Binding and Lumen Formation J. Biol. Chem., February 23, 2007; 282(8): 5749 - 5760. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, R. Seidman, N. Stern, T. Cohen-Sinai, O. Izhaki, G. Katz, M. Besser, A. J. Treves, R. S. Blumberg, R. Loewenthal, et al. Inhibition of Human Tumor-Infiltrating Lymphocyte Effector Functions by the Homophilic Carcinoembryonic Cell Adhesion Molecule 1 Interactions J. Immunol., November 1, 2006; 177(9): 6062 - 6071. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Korotkova, E. Cota, Y. Lebedin, S. Monpouet, J. Guignot, A. L. Servin, S. Matthews, and S. L. Moseley A Subfamily of Dr Adhesins of Escherichia coli Bind Independently to Decay-accelerating Factor and the N-domain of Carcinoembryonic Antigen J. Biol. Chem., September 29, 2006; 281(39): 29120 - 29130. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Li, R. K.-K. Lee, Y.-L. Hsiao, and Y.-H. Chen Demonstration of a Glycoprotein Derived From the Ceacam10 Gene in Mouse Seminal Vesicle Secretions Biol Reprod, September 1, 2005; 73(3): 546 - 553. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stern, G. Markel, T. I. Arnon, R. Gruda, H. Wong, S. D. Gray-Owen, and O. Mandelboim Carcinoembryonic Antigen (CEA) Inhibits NK Killing via Interaction with CEA-Related Cell Adhesion Molecule 1 J. Immunol., June 1, 2005; 174(11): 6692 - 6701. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nakagaki, K. Nakagaki, and F. Taguchi Receptor-Independent Spread of a Highly Neurotropic Murine Coronavirus JHMV Strain from Initially Infected Microglial Cells in Mixed Neural Cultures J. Virol., May 15, 2005; 79(10): 6102 - 6110. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Servin Pathogenesis of Afa/Dr Diffusely Adhering Escherichia coli Clin. Microbiol. Rev., April 1, 2005; 18(2): 264 - 292. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, R. Gruda, H. Achdout, G. Katz, M. Nechama, R. S. Blumberg, R. Kammerer, W. Zimmermann, and O. Mandelboim The Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion Molecules-1 in the Protection from Killing by Human NK Cells J. Immunol., September 15, 2004; 173(6): 3732 - 3739. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Comegys, S.-H. Lin, D. Rand, D. Britt, D. Flanagan, H. Callanan, K. Brilliant, and D. C. Hixson Two Variable Regions in Carcinoembryonic Antigen-related Cell Adhesion Molecule1 N-terminal Domains Located in or Next to Monoclonal Antibody and Adhesion Epitopes Show Evidence of Recombination in Rat but Not in Human J. Biol. Chem., August 13, 2004; 279(33): 35063 - 35078. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Chen, H. Iijima, T. Nagaishi, A. Nakajima, S. Russell, R. Raychowdhury, V. Morales, C. E. Rudd, N. Utku, and R. S. Blumberg Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 Isoforms Alternatively Inhibit and Costimulate Human T Cell Function J. Immunol., March 15, 2004; 172(6): 3535 - 3543. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Chen and J. E. Shively The Cell-Cell Adhesion Molecule Carcinoembryonic Antigen-Related Cellular Adhesion Molecule 1 Inhibits IL-2 Production and Proliferation in Human T Cells by Association with Src Homology Protein-1 and Down-Regulates IL-2 Receptor J. Immunol., March 15, 2004; 172(6): 3544 - 3552. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, H. Mussaffi, K.-L. Ling, M. Salio, S. Gadola, G. Steuer, H. Blau, H. Achdout, M. de Miguel, T. Gonen-Gross, et al. The mechanisms controlling NK cell autoreactivity in TAP2-deficient patients Blood, March 1, 2004; 103(5): 1770 - 1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iijima, M. F. Neurath, T. Nagaishi, J. N. Glickman, E. E. Nieuwenhuis, A. Nakajima, D. Chen, I. J. Fuss, N. Utku, D. N. Lewicki, et al. Specific Regulation of T Helper Cell 1-mediated Murine Colitis by CEACAM1 J. Exp. Med., February 17, 2004; 199(4): 471 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Fournes, J. Farrah, M. Olson, N. Lamarche-Vane, and N. Beauchemin Distinct Rho GTPase Activities Regulate Epithelial Cell Localization of the Adhesion Molecule CEACAM1: Involvement of the CEACAM1 Transmembrane Domain Mol. Cell. Biol., October 15, 2003; 23(20): 7291 - 7304. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nakajima, H. Iijima, M. F. Neurath, T. Nagaishi, E. E. S. Nieuwenhuis, R. Raychowdhury, J. Glickman, D. M. Blau, S. Russell, K. V. Holmes, et al. Activation-Induced Expression of Carcinoembryonic Antigen-Cell Adhesion Molecule 1 Regulates Mouse T Lymphocyte Function J. Immunol., February 1, 2002; 168(3): 1028 - 1035. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||