| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From the Department of Pediatrics, Angiogenesis and
Vascular Development, Graduate School of Medical Science, and the
Department of Laboratory Sciences and Department of Nursing, School of
Health Sciences, Faculty of Medicine, Kanazawa University, Ishikawa,
Japan; Department of Pediatrics, Toyama Prefectural Central Hospital,
Toyama, Japan; Department of Pediatrics, Fukui Saiseikai Hospital,
Fukui, Japan; Department of Pediatrics, Fukui Prefectural Hospital,
Fukui, Japan; and Department of Human Gene Therapy, Graduate School of
Medicine, Hokkaido University, Sapporo, Japan.
Unusual Epstein-Barr virus (EBV) infection into T or natural killer
cells plays a pivotal role in the pathogenesis of acute EBV-associated
hemophagocytic lymphohistiocytosis (EBV-HLH) and chronic active EBV
infection (CAEBV). The precise frequency and localization of EBV genome
in lymphocyte subpopulations especially within T-cell subpopulations
are unclear in these EBV-related disorders. This study analyzed the
frequency of EBV-infected cells in circulating lymphocyte
subpopulations from 4 patients with acute EBV-HLH and 4 with CAEBV.
EBV- encoded small RNA-1 in situ hybridization examination of
peripheral blood lymphocytes showed a significantly higher frequency of
EBV-infected cells of 1.0% to 13.4% in EBV-HLH and 1.6% to 25.6% in
CAEBV, respectively. The patterns of EBV infection in lymphocyte
subpopulations were quite different between acute EBV-HLH and CAEBV.
EBV infection was predominant in CD8+ T cells in all
EBV-HLH patients, whereas the dominant EBV-infected cell populations
were non-CD8+ lymphocyte subpopulations in CAEBV patients.
Phenotypical analysis revealed that EBV-infected cell populations from
both EBV-HLH and CAEBV were activated. There was no predominance of any
EBV substrain of latent membrane protein-1, EBV-associated nuclear antigen (EBNA)-1, and EBNA-2 genes between the 2 abnormal
EBV-associated disorders, and self-limited acute infectious
mononucleosis. These results showing differential virus-cell
interactions between acute EBV-HLH and CAEBV indicated different
pathogenic mechanisms against EBV infection between the 2 EBV-associated diseases, which accounts for the difference in clinical
manifestations between the 2 diseases.
(Blood. 2001;98:1882-1888) The primary infection of Epstein-Barr virus
(EBV) is usually asymptomatic, and EBV has been shown to be latent in B
cells for life in the normal host after primary
infection.1 Symptomatic acute EBV infection is clinically
recognized as infectious mononucleosis (IM) characterized by fever,
hepatosplenomegaly, lymphoadenopathy, and increase of activated
CD8+ T lymphocytes in peripheral blood.1,2
These manifestations seen in IM are the consequence of the major
histocompatibility class-restricted cytotoxic T lymphocyte (CTL)
response against polyclonal proliferation of EBV-infected B
cells.3 Although IM usually follows a self-limited course
without severe complications, uncommon acute EBV infection with
fulminant manifestations such as persistent fever, severe
hepatosplenomegaly, severe cytopenia, coagulopathy, central nervous
system (CNS) abnormality, and vascular dysfunction has been
demonstrated, and histiocytic erythrophagocytosis has been found in
bone marrow and secondary lymphoid organs from most of these
patients.4-6 These cases are clinically recognized as
EBV-associated hemophagocytic lymphohistiocytosis (EBV-HLH) or
EBV-associated hemophagocytic syndrome, and the systemic release of
several cytokines and mediators produced by activated T cells and
macrophages due to imbalanced immunoregulation by CTLs has been
considered to account for the severe systemic tissue damage mainly to
the vascular system in these patients.4-6 Two distinct pathways, Fas (CD95)/Fas ligand and perforin/granzyme, have been shown
to mediate mainly the cytotoxicity of CTLs and natural killer (NK)
cells in the regulation of viral infections.7,8 The gene
knockout mice model has demonstrated the functional significance of
perforin in experimental animals.9 Perforin has been shown to be a candidate for familial hemophagocytic lymphohistiocytosis in
humans.10 Furthermore, X-linked lymphoproliferation, a
fatal disease developing in response to acute EBV infection, has been linked to mutations in the SAP/SH2D1A gene.11
These findings indicate that negative regulation of immune effector
cells by the induction of apoptosis and activation of CTLs play
significant roles in the immune regulation against infections with
viruses, in particular EBV. Although the precise pathogenesis of acute fulminant EBV infection with hemophagocytosis is not fully clarified, several reports have suggested that activated T cells are the main
cellular target of EBV infection in acute
EBV-HLH.12-14
A direct contribution of EBV infection has been demonstrated in the
pathogenesis of chronic and severe manifestations that persist for
months to years, which have been recognized as chronic active EBV
infection (CAEBV).15-17 Although latent EBV infection is
demonstrated exclusively in B cells and nasopharyngeal epithelial cells
from self-limited IM and EBV seropositive normal
individuals,1 an ectopic EBV infection in T- or NK-cell
populations has been shown in patients with CAEBV.18-24
Both acute EBV-HLH and CAEBV are directly related to EBV infection and
possess pathologic similarities, but they also show marked clinical
differences. The acute type of EBV-HLH shows more fulminant and severe
manifestations, including systemic organ failure with vascular damage,
than CAEBV and is sometimes fatal,4-6 unless adequate
immunosuppressive therapy is used. On the other hand, acute death is
rarely seen in CAEBV. However, CAEBV that is occasionally
associated with acute episodes of hemophagocytic syndrome has
been found during the course as an early manifestation of EBV-related
lymphoid malignancy.24 Recent advances in the control of
acute EBV-HLH have shown that the majority of patients with EBV-HLH are
successfully cured by immunochemotherapy without
relapse,25 whereas it is difficult to control CAEBV
following malignant transformation except for treatment with stem cell
transplantation.26 The precise mechanisms of EBV infection
into T or NK cells in both acute EBV-HLH and CAEBV are still unknown.
The clonal proliferation of EBV-infected T or NK cells or
pauciclonality of isolated EBV suggests that an ectopic EBV infection
in the non-B-cell population plays a pivotal role in both abnormal
EBV-associated diseases.12-14,18-24 In the present study,
we analyzed the cellular targets of EBV infection to clarify the
different pathogeneses of these 2 EBV-associated diseases.
Patients
Four other patients were diagnosed with CAEBV based on clinical
findings such as hepatomegaly, splenomegaly, lymphoadenopathy, persistent hepatic dysfunction, and unusually high antibody titer to
EBV antigens (Table 2) including patients
CAEBV1 and CAEBV2 who were reported previously.20,22 One
patient (CAEBV4) showed hypersensitivity to mosquito bites and an
intermittent exacerbation of skin ulcer and fever by mosquito bites for
8 years. Rearrangement of T-cell receptor Flow cytometric analysis and separation of lymphocyte subpopulation Peripheral blood samples were drawn from patients after informed consent of the patients or their parents. Peripheral blood mononuclear cells (PBMNCs) were separated from heparinized blood by the Ficoll-Hypaque method. PBMNCs were also obtained in the acute phase of typical IM diagnosed by clinical manifestations and EBV serologic analysis. Lymphocytes were stained with phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies (MoAbs) against CD3, CD4, CD8, CD16, CD20, CD45RO, or HLA-DR (Pharmingen, San Diego, CA). The expression of HLA-DR or CD45RO in CD4+ or CD8+ T cells was evaluated by 2-color fluorescence flow cytometry using Cytoron Absolute (Ortho Diagnostic, Tokyo, Japan). Lymphocytes were also immunostained with a combination of 2 MoAbs against PE- or FITC-conjugated CD4, CD8, CD16, or CD20 and sorted into CD4+ T cells, CD8+ T cells, CD16+ NK cells, or CD20+ B cells using EPICS ELITE (Coulter Electronics, Hialeah, FL). The efficiency of separation was above 98% determined by flow cytometry.Detection of EBV genome The presence of EBV was estimated by EBV-encoded small RNA1 (EBER-1) messenger RNA (mRNA) by in situ hybridization (ISH) as described.20 The cells (5 × 104 to 1 × 105) were cytocentrifuged onto silanized slides (Dako, Kyoto, Japan), and the presence of EBER-1 mRNA was determined by ISH using the alkaline phosphatase-conjugated antisense probe (AGCAGAGTCTGGGAAGACAACCACAGACACCGTCCTCACC) or sense probe to EBER-1. Three independent persons enumerated the frequency of EBER-1+ cells under a microscope by counting 50 000 to 100 000 cells.Analysis of EBV-related gene DNA was extracted from peripheral blood lymphocytes or sorted lymphocyte subpopulations from patients with acute IM, EBV-HLH, and CAEBV. PCR was amplified with specific primer sets for carboxyl-terminal (C-terminal) of latent membrane protein (LMP)-1, U2 region of EBV-related nuclear antigen (EBNA)-2, and C-terminal region of EBNA-1 as described.20 PCR products were run on 2% agarose gels and visualized by ethidium bromide staining. Deletion of C-terminal region of LMP-1 and type I (A) or II (B) assessed by U2 region of EBNA-1 was clearly identified by the difference in PCR product size. Mutations of EBNA-2 C-terminal region were evaluated by sequencing of PCR products with the same primers. The nucleotide sequence was determined by the dideoxy chain termination method with the DyeDeoxy Terminator Cycle Sequence Kit (PerkinElmer Applied Biosystems, Norwalk, CT) according to the manufacturer's recommendations with a DNA sequencer 371A (PerkinElmer). The sequence was confirmed 2 or 3 times by examination with forward and reverse reactions.
Frequency of EBV-infected cells in EBV-associated diseases The frequency of EBV-infected cells in peripheral blood from different EBV-associated diseases was quantitatively estimated by the EBER-1 ISH method because of the high sensitivity of detection of EBV-infected cells and reliability of this method. EBER-1+ cells were detected at a frequency of 0.0016% to 1.26% within PBMNCs from patients with acute phase IM, but not in 105 PBMNCs from the EBV-seropositive normal adults. PBMNCs from CAEBV showed higher percentages of EBV-infected cells (1.6%-25.6%) than those from IM (Figure 1). EBER-1+ cells were also found with high frequency (1.0%-13.4%) in PBMNCs from the patients with the early phase of EBV-HLH. The percentage of EBV-infected cells declined with time with immunosuppressive therapy in all cases (data not shown), but a reincrease of EBER-1+ cells was detected in the one deceased case (EBV-HLH2) with multiple organ failure and uncontrolled coagulopathy. No EBV-infected cells were detected by EBV ISH in the 3 cured patients with EBV-HLH at 6 to 18 months after immunotherapy was discontinued.
Differential pattern of EBV infection in lymphocyte subpopulations between EBV-HLH and CAEBV To determine the precise localization of EBV infection in lymphocyte subpopulations, CD4+ T cells, CD8+ T cells, CD16+ NK cells, and CD20+ B cells from EBV-HLH, CAEBV, and acute IM were electronically sorted, and the presence of EBV was estimated in each lymphocyte subpopulation. Figure 2 shows a representative microscopic photograph of EBER-1 ISH of 4 sorted populations from patient EBV-HLH2 at 8 days after onset. Figure 2 shows a clear difference of EBER-1+ and EBER-1 cells. The analysis of
EBV-infected cells in each lymphocyte subpopulation showed clear
differences in the infectious pattern between 3 EBV-associated diseases
(Figure 3). The EBV-infected cell
population in acute IM was found mainly in CD20+ B cells,
but fewer EBER-1+ cells were detected in CD4+ T
cells, CD8+T cells, and CD16+ NK cells in 2 cases. In contrast to IM, the infection of EBV into lymphocytes other
than B cells was prominent in EBV-HLH and CAEBV. The dominant
population of EBV-infected cells was CD8+ T cells in all
EBV-HLH patients, although EBV-infected cells were found in NK cells
and B cells with lower frequency in patient EBV-HLH4. The absolute
frequency of EBV-infected CD8+ T cells was different in
each case, which might be related to the time elapsed after disease
onset. In contrast to EBV-HLH, the pattern of mainly EBV-infected
populations was different in each CAEBV case, CD4+ T cells
alone in case CAEBV3, mainly CD16+ NK cells in CAEBV2 and
CAEBV4, and both CD4+ and CD8+ T cells in
case CAEBV1.
EBV-infected cells exist in an activated lymphocyte population in both acute EBV-HLH and CAEBV The phenotypic analysis of lymphocytes from EBV-HLH showed a relative decrease of CD4+ T cells and relative increase of CD8+ T cells, but the absolute number of CD8+ T cells was decreased (data not shown). Expression of activation markers such as CD45RO and HLA-DR antigen on T cells was markedly up-regulated in the CD8+ T-cell population from EBV-HLH, which was the main EBV-infected population (Figure 4). Interestingly, almost half of CD16+ NK cells from patient EBV-HLH4, in which EBV infection was detected, expressed HLA-DR. In CAEBV, activation of the cell population in which EBER-1+ cells existed, CD4+ and CD8+ T cells in case CAEBV1 and case CAEBV3, and CD16+ NK cells in case CAEBV2 and case CAEBV4, was also detected.
Subtype of EBV isolated from EBV-HLH and CAEBV Mutations of EBV-encoded genes such as LMP1, EBNA1, and EBNA2 have been suggested to play pivotal roles in the pathogenesis of EBV-associated diseases.27,28 We evaluated these EBV genes in isolates from EBV-HLH and CAEBV to clarify the virus-cell interaction in these EBV-associated diseases (Table 3). Deletion of 30 base pairs (bp) in the C-terminal region of LMP1 was detected in the majority of cases with EBV-HLH and CAEBV except for CAEBV4, which showed the prototype of B95.8. All of isolated EBV from the patients with the 2 EBV-related diseases was type A (I) determined by EBNA2 gene analysis. Analysis of EBNA1 showed that valiant-valine (V-Val; 3-letter amino acid code) subtype was present in all cases except for CAEBV4 from whom prototype-alanine (P-Ala) was isolated. Interestingly, dual infection with 2 types of EBV, P-Ala and V-Val was detected, in some cell subpopulations in 3 of the 4 EBV-HLH patients, whereas only one type was detected in EBV isolated from the patients with CAEBV. Because ethnic differences in EBV subtype have been shown, we analyzed 30 EBV isolates from IM in Japanese patients. EBV subtypes with a 30-bp deletion of LMP-1, type A, and V-Val subtype of EBNA-1 showed the highest frequencies with 78%, 92%, and 81%, respectively.
Although EBV infection into T or NK cells has been implicated in the pathogenesis of EBV-HLH12-14 and CAEBV,17-24 the difference in the cellular target of EBV infection between these 2 abnormal EBV-associated diseases has been unknown. In this report, we clearly showed the difference of the cellular targets of EBV infection between acute EBV-HLH and CAEBV. EBV-infected cells in the acute phase of EBV-HLH were detected mainly in the activated CD8+ T-cell population, whereas the main EBV-infected populations in CAEBV were populations other than CD8+ T cells. Several other reports of single cases with acute fulminant EBV infection and hemophagocytosis showed that EBV-infected cells were found mainly in the CD8+ T-cell population,29-31 consistent with our results. Recently, Quinatallia-Martinaz and colleagues14 could not find any clear T-cell subset predominance by double-staining analysis of EBER-1 and CD4, CD8 in specimens from 5 deceased patients with acute fulminant EBV infection. The difference in subset predominance may arise from differences in the time of analysis after onset because they used pathologic samples obtained from autopsy, whereas we used peripheral blood samples obtained in the early phase of EBV-HLH. EBV-infected subset predominance might be a dynamic phenomenon because transition from acute EBV-HLH to CAEBV has been found. Furthermore, we have experienced a case (CAEBV1) in which CD4+ T cells were infected exclusively with EBV in the early stage. However, both CD4+ and CD8+ T cells became infected with the virus as the disease progressed and malignant lymphoma developed (Y. K. et al, unpublished observation, July 1997). A recent analysis of CAEBV2 found EBV infection into CD8+ T cells, in which EBV infection has not been detected in the early stage of disease. Similar to previously reported results, at least 2 distinct types of CAEBV existed in our patient population. In one group of patients, EBV was found within T cells, in particular CD4+ T cells.17-21 In another group of patients, NK cells were the target of EBV infection,21-23 which is frequently associated with mosquito hypersensitivity in the Orient. Further analysis of the cellular target of EBV infection in CAEBV or T- or NK-lymphoproliferative disorders may help to distinguish 2 different clinical entities of chronic abnormal EBV infection. The relationship between EBV infection into CD8+ T cells
and the development of EBV-HLH, especially regarding the severity and
high mortality associated with this disorder, is still unclear. Infection of EBV into CD4+ T-cell line in vitro has been
shown to up-regulate the production of tumor necrosis factor- Several approaches to determine the relationship between individual EBV strains and EBV-related diseases such as malignant lymphoma,27 nasopharyngeal carcinoma,28 Burkitt lymphoma,29 and gastric carcinoma30 have been reported. The significance of type B in the immunocompromised host in Western countries27 and the variants of EBNA-1 C-terminal region have been suggested.36,37 Ethnic differences in EBV type have been demonstrated, and especially in Asian populations type A EBV has been found to predominate in some EBV-related diseases. The relationship between the deletion of 30 bp in C-terminal region of LMP-1 and malignant transformation of EBV+ tumors has been suggested.38 However, we could not find predominance of any EBV subtype of LMP1 and EBNA1 genes between acute IM and 2 abnormal disorders with EBV infection. From these results, we cannot confirm the pathologic significance of type A EBV or subtype with 30-bp deletion type LMP-1 in the 2 EBV-associated diseases. The intriguing finding in this EBV gene analysis was the simultaneous presence of 2 different subtypes of EBNA-1 in 3 of 4 patients in the acute phase of EBV-HLH. Dual infection with 2 types of EBV strains was not detected in CAEBV or acute IM, except for 2 cases of IM with V-Val and V-Leu from 30 analyzed IM patients (data not shown). The pathologic significance of the variant strain with V-Val in EBNA1 gene has been demonstrated from its predominance in other EBV-related malignant diseases,36 but we could not find any difference in the frequency of the V-Val type of EBNA-1 between 3 EBV-related diseases, as in a previous report.37 The significance of dual infection with 2 types of EBV strains in the pathogenesis of EBV-HLH was obscure. Dual infection of these 2 types of EBV strains into EBV-receptor-transfected CD8+ T-cell lines may clarify the cellular activation and message up-regulation of cytokine and cell activation and apoptosis. Although it has been suggested that T cells express EBV receptor CD21 on the cell surface,39 the precise mechanism of ectopic EBV infection into T cells or NK cells is still unknown. Our preliminary data showed that EBV occasionally infects non-B-cell lymphocyte populations, although at a very low frequency, during the very early stages of acute IM. Under normal immune regulation by CTLs, the early and early lytic EBV antigen expressed on B cells evokes strong immune responses.1-3 In the absence of EBV infection into B cells, the EBV-specific CTL response may be significantly delayed or defective. Absence or decrease of EBV infection in B cells seen in patients with EBV-HLH and CAEBV may be related to the persistence of EBV genome in T- or NK-cell populations. Escape from immune surveillance by diminished expression of EBV antigen has been suggested in other EBV+ malignancies.1,39 Although EBV latency in EBV-infected CD8+ T cells in EBV-HLH was not determined, several EBV+ T- or NK-cell lines and malignant lymphomas of T- or NK-cell origin have been shown to be in latency II,1 which may escape from host immunoregulation. Loss of expression of early lytic antigen of EBV in T cells may augment cellular viral load and the expansion of EBV-infected T-cell proliferation, although the latency status of EBV infection in EBV-HLH was not determined in this analysis. To clarify the mechanism of EBV infection into non-B-cell lymphocytes, molecular analysis of EBV latency might be required to better understand the pathogenesis of these EBV-related hematologic diseases.
We appreciate the excellent technical assistance of H. Matsukawa and M. Kitakata.
Submitted February 9, 2001; accepted May 21, 2001.
Supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan; a grant from the Ministry of Welfare and Health of Japan; and a grant from the Japan Rheumatic Foundation.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Yoshihito Kasahara, Department of Pediatrics, Angiogenesis and Vascular Development, Graduate School of Medical Science, Kanazawa University, 13-1, Takaramachi, Kanazawa, Ishikawa 920-8641, Japan; e-mail:ykasa{at}ped.m.kanazawa-u.ac.jp.
1.
Straus SE, Cohen JI, Tosato G, Meier J.
Epstein-Barr virus infections: biology, pathogenesis, and management.
Ann Intern Med.
1993;118:45-58 2. Callan MFC, Steven N, Krausa P, et al. Large clonal expansion of CD8+ T cells in acute infectious mononucleosis. Nat Med. 1996;2:906-911[CrossRef][Medline] [Order article via Infotrieve]. 3. Rickinson EC, Lee SP, Steven NM. Cytotoxic T lymphocyte responses to Epstein-Barr virus. Curr Opin Immunol. 1996;8:492-497[CrossRef][Medline] [Order article via Infotrieve].
4.
Kikuta H, Sakiyama Y, Matsumoto S, et al.
Fatal Epstein-Barr virus-associated hemophagocytic syndrome.
Blood.
1993;82:3259-3264 5. Su IJ, Wang CH, Cheng AL, Chen RL. Hemophagocytic syndrome in Epstein-Barr virus-associated T-lymphoproliferative disorders: disease spectrum, pathogenesis, and management. Leuk Lymphoma. 1995;19:401-406[Medline] [Order article via Infotrieve]. 6. Imashuku S, Hibi S, Todo S. Hemophagocytic lymphohistiocytosis in infancy and childhood. J Pediatr. 1997;130:352-357[CrossRef][Medline] [Order article via Infotrieve]. 7. Nagata S. Apoptosis by death factor. Cell. 1997;88:355-359[CrossRef][Medline] [Order article via Infotrieve]. 8. Trapani JA, Sutton VR, Smyth MJ. CTL granules: evolution of vesicles essential for combating virus infection. Immunol Today. 1999;20:351-356[CrossRef][Medline] [Order article via Infotrieve].
9.
Binder D, van den Broek MF, Kagi H, et al.
Aplastic anemia rescued by exhaustion of cytokine-inducing CD8+ T cells in persistent infection with lymphocytic choriomeningitis virus.
J Exp Med.
1998;187:1903-1920
10.
Stepp SE, Dufourcq-Legelouse R, Deist FL, et al.
Perforin gene defects in familial hemophagocytic lymphohistiocytosis.
Science.
1999;286:1957-1959 11. Coffey AJ, Brooksbamk RA, Brandau C, et al. Host response to EBV infection in X-linked lymphoproliferative disease results from mutations in an SH-2 domain encoding gene. Nat Genet. 1998;20:129-135[CrossRef][Medline] [Order article via Infotrieve]. 12. Kawaguchi H, Miyashita T, Herbst H, et al. Epstein-Barr virus-infected T lymphocytes in Epstein-Barr virus-associated hemophagocytic syndrome. J Clin Invest. 1993;92:1444-1450. 13. Su IJ, Chen RL, Lin DT, Lin KS, Chen CC. Epstein-Barr virus (EBV) infects T lymphocytes in childhood EBV-associated hemophagocytic syndrome in Taiwan. Am J Pathol. 1994;144:1219-1225[Abstract].
14.
Quinatallia-Martinaz L, Kumar S, Fend F, et al.
Fulminant EBV+ T-cell lymphoproliferative disorder following acute/chronic EBV infection: distinct clinicopathologic syndrome.
Blood.
2000;96:443-451 15. Rickinson AB. Chronic, symptomatic Epstein-Barr virus infection. Immunol Today. 1986;7:12-14. 16. Straus SE. The chronic mononucleosis syndrome. J Infect Dis. 1988;157:405-412[Medline] [Order article via Infotrieve]. 17. Kikuta H, Taguchi Y, Tomizawa K, et al. Epstein-Barr virus genome positive T lymphocytes in a boy with chronic active EBV infection with Kawasaki-like disease. Nature. 1988;333:455-457[CrossRef][Medline] [Order article via Infotrieve]. 18. Jones JF, Shurin S, Abramowsky C, et al. T-cell lymphomas containing Epstein-Barr viral DNA in patients with chronic Epstein-Barr virus infections. N Engl J Med. 1988;318:733-741[Abstract].
19.
Imai S, Sugiura M, Oikawa O, et al.
Epstein-Barr virus (EBV)-carrying and -expressing T cell lines established from severe chronic active EBV infection.
Blood.
1996;87:1446-1457
20.
Kanegane H, Bhata K, Gutierrez N, et al.
A syndrome of peripheral blood T cell infection with Epstein-Barr virus (EBV) followed by EBV-positive T-cell lymphoma.
Blood.
1998;91:2085-2091 21. Kawa-Ha K, Ishihara S, Ninomiya T, et al. CD3-negative lymphoproliferative disease of granular lymphocytes containing Epstein-Barr viral DNA. J Clin Invest. 1989;84:51-55. 22. Kanegane H, Wada T, Nunogami K, et al. Chronic persistent Epstein-Barr virus infection of natural killer cells and B cells associated with granular lymphocyte expansion. Br J Haematol. 1996;95:116-122[CrossRef][Medline] [Order article via Infotrieve]. 23. Ishihara S, Okada S, Wakiguchi H, Kurashige T, Hirai K, Kawa-Ha K. Clonal lymphoproliferation following chronic active Epstein-Barr virus infection and hypersensitivity to mosquito bite. Am J Hematol. 1997;54:275-281. 24. Craig MV, Clare N, Skar JL, Banks PM. T-cell lymphoma and virus-associated hemophagocytic syndrome. Am J Clin Pathol. 1992;97:189-194[Medline] [Order article via Infotrieve].
25.
Imashuku S, Hibi S, Ohara T, et al.
Effective control of Epstein-Barr virus-related hemophagocytic lymphohistiocytosis with immunochemotherapy.
Blood.
1999;93:1869-1874 26. Okamura T, Hatsukawa Y, Arai H, Inoue M, Kawa K. Blood stem transplantation for chronic active Epstein-Barr virus with lymphoproliferation. Lancet. 2000;356:223-224[CrossRef][Medline] [Order article via Infotrieve].
27.
Boyle MJ, Sewell WA, Seulley TB, et al.
Subtype of Epstein-Barr virus in human immunodeficiency virus-associated non-Hodgkin lymphoma.
Blood.
1991;78:3004-3011 28. Lung LM, Chang GC. Detection of distinct Epstein-Barr virus genotypes in NPC biopsies from Southern Chinese and Caucasians. Int J Cancer. 1992;52:34-37[Medline] [Order article via Infotrieve]. 29. Tazawa Y, Nishinomiya F, Noguchi H, et al. A case of fatal infectious mononucleosis presenting with fulminant hepatic failure associated with an extensive CD8-positive lymphocyte infiltration in the liver. Hum Pathol. 1993;24:1135-1139[CrossRef][Medline] [Order article via Infotrieve]. 30. Dolezal MV, Kamel OW, van de Rijn M, Cleary ML, Sibley RK, Warnke RA. Virus-associated hemophagocytic syndrome characterized by clonal Epstein-Barr virus genome. Am J Clin Pathol. 1995;103:189-194[Medline] [Order article via Infotrieve]. 31. Chan LC, Srivastava G, Pittaluga S, Kwong YL, Liu HW, Yuen HL. Detection of Epstein-Barr virus in malignant proliferation of peripheral blood CD3+ CD8+ T cells. Leukemia. 1992;6:952-956[Medline] [Order article via Infotrieve]. 32. Lay JG, Tsao CJ, Chen JY, Kadin ME, Su IJ. Upregulation of tumor necrosis factor-a gene by Epstein-Barr virus and activation of macrophages in Epstein-Barr virus-infected T cells in the pathogenesis of hemophagocytic syndrome. J Clin Invest. 1997;100:1969-1979[Medline] [Order article via Infotrieve]. 33. Uehara T, Miyawaki T, Ohta K, et al. Apoptotic cell death in primed CD45RO+ T lymphocytes in Epstein-Barr virus-induced infectious mononucleosis. Blood. 1992;60:453-460.
34.
Tamaru Y, Miyawaki T, Iwai K, et al.
Absence of Bcl-2 expression by activated CD45RO+ T lymphocytes in acute infectious mononucleosis supporting susceptibility to programmed cell death.
Blood.
1993;82:521-527
35.
Henderson S, Huen D, Rowe M, Dawson C, Johnson G, Rickinson A.
Epstein-Barr virus-encoded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death.
Proc Natl Acad Sci U S A.
1993;90:8479-8483 36. Bhatia K, Raj A, Gutierrez MI, et al. Variation in the sequence of Epstein Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt's lymphomas. Oncogene. 1996;13:177-181[Medline] [Order article via Infotrieve]. 37. Chen Y, Chang KL, Chen W, Shibata D, Hayashi K, Weiss LM. Epstein-Barr virus-associated nuclear antigen-1 carboxyl-terminal gene sequences in Japanese and American patients with gastric carcinoma. Lab Invest. 1998;78:877-882[Medline] [Order article via Infotrieve].
38.
Knecht H, Bachmann E, Brousset P, et al.
Deletions within the LMP1 oncogene of Epstein-Barr virus are clustered in Hodgkin's disease and identical to those observed in nasopharyngeal carcinoma.
Blood.
1883;82:2937-2942 39. Fischer E, Delibraias C, Kazatchkin MD. Expression of CR2 (the C3dg/EBV receptor, CD21) on normal human peripheral blood T lymphocytes. J Immunol. 1991;146:865-872[Abstract].
© 2001 by The American Society of Hematology.
| ||||||||||
![]() |
K. Iwatsuki, M. Satoh, T. Yamamoto, T. Oono, S. Morizane, M. Ohtsuka, Z.-G. Xu, D. Suzuki, and K. Tsuji Pathogenic link between hydroa vacciniforme and epstein-barr virus-associated hematologic disorders. Arch Dermatol, May 1, 2006; 142(5): 587 - 595. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Trempat, J. Tabiasco, P. Andre, N. Faumont, F. Meggetto, G. Delsol, R. D. Gascoyne, J.-J. Fournie, E. Vivier, and P. Brousset Evidence for Early Infection of Nonneoplastic Natural Killer Cells by Epstein-Barr Virus J. Virol., October 2, 2002; 76(21): 11139 - 11142. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||