| |
|
|
|
|
|
|
|||
|
PLENARY PAPER
From the Blood and Marrow Transplant Program, Markey
Cancer Center, Division of Hematology/Oncology, University of Kentucky
Medical Center, Lexington; Division of Oncology and Bone Marrow
Transplantation, Duke University Medical Center, Durham, NC; and
Hematology-Oncology Division, University of Pennsylvania Medical
Center, Philadelphia.
Human acute myelogenous leukemia (AML) is thought to arise from a
rare population of malignant stem cells. Cells of this nature, herein
referred to as leukemic stem cells (LSCs), have been documented for
nearly all AML subtypes and appear to fulfill the criteria for stem
cells in that they are self-renewing and give rise to the cells found
in many leukemic populations. Because these cells are likely to be
critical for the genesis and perpetuation of leukemic disease, the
present studies sought to characterize unique molecular properties of
the LSC population, with particular emphasis on the transcription
factor, nuclear factor- Recent years have witnessed significant advances in
the field of stem cell biology. Numerous studies have appeared
describing the biologic relevance of stem cells, as well as their
specific cellular and molecular properties.1-6
Interestingly, while the focus of recent studies has been predominantly
on normal cell types, important progress has also been made in the
characterization of malignant stem cells. For example, several recent
studies have identified and characterized a leukemic stem cell (LSC)
population in patients with acute myelogenous leukemia (AML). LSCs are
sufficient to perpetuate human leukemic cell growth in long-term
culture assays and in the murine nonobese diabetic/severe combined
immunodeficiency model system.7-9 As a consequence of
these data, it has been proposed that LSCs are central to the
pathogenesis of human myeloid leukemia. However, despite the clear
importance of this population, little is currently known about the
molecular properties that make LSCs distinct from normal hematopoietic
stem cells. In particular, it is critical to understand how malignant
stem cells regulate growth and survival. If LSCs use unique mechanisms
to control processes such as apoptosis, then it may be possible to
target such pathways as a means to specifically destroy leukemic, but not normal hematopoietic cells.
Several recent studies have shown that LSCs can be phenotypically
defined as CD34+, CD38 Cell isolation and culture
Flow cytometry
Nuclear extracts Nuclear extracts were prepared as described by Dignam and coworkers25 with some modifications. Briefly, cells were washed with cold PBS followed by 2 additional washes with extract buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride [PMSF]). Cells were then lysed in extract buffer containing 0.1% NP-40 and incubated on ice for 5 minutes. Samples were centrifuged at 1400g for 15 minutes and resuspended in 20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, and 20% glycerol. Next, samples were vortexed gently and incubated for 15 minutes on ice. Crude nuclear extracts were centrifuged at 14 000g to remove debris, and the supernatant was aliquoted and stored at 80°C.
Electrophoretic mobility shift assay The NF- B consensus and mutant oligonucleotide sequences were
obtained from Santa Cruz Biotechnologies (Santa Cruz, CA). The probes
were labeled with T4 polynucleotide kinase (Life Technologies, Gaithersburg, MD) and -[32P]-ATP (NEN, Boston, MA) and
purified over a Sephadex G25 (Pharmacia Biotech) column. Protein
nuclear extracts equivalent to 100 000 cells were incubated with 2 µg poly d(I-C) (Roche Molecular Biochemicals, Indianapolis, IN) and
10 14 mol 32P-labeled probe in 10 mM HEPES, 5 mM Tris, 50 mM KCl, 1.2 mM EDTA, and 10% (vol/vol) glycerol (pH 7.8)
for 15 minutes at room temperature. A 200-fold molar excess of
unlabeled oligonucleotide (NF- B consensus or mutant) was added for
competition assays. For supershift assays, 2 µg of antibodies to
NF- B p65 and p50 (Santa Cruz Biotechnologies) was added to the
reaction. Protein/DNA complexes were resolved on 6% native
polyacrylamide gels in 0.25 × TBE (25 mM Tris, 22.5 mM boric acid,
and 0.25 mM EDTA). Gels were visualized by autoradiography using
MS-BioMax film and intensifying screens (Kodak, Rochester, NY).
Reverse transcription-polymerase chain reaction The RNA samples were prepared with the use of the Miltenyi µMACS messenger RNA (mRNA) isolation kit (Miltenyi Biotech) as per the manufacturer's instructions and reverse transcribed with Superscript II (Life Technologies, Carlsbad, CA). Polymerase chain reactions (PCRs) were performed using a Perkin Elmer (Shelton, CT) 9700 thermal cycler and the following primers: -actin sense 5' ATCTGGCACCACACCTTCTACAATGAGCTGCG 3', -actin antisense 5'
CGTCATACTCCTGCTTGCTGATCCACATCTGC 3', c-IAP2 sense 5' GCTTCTGTTGTGGCCTG
3', c-IAP2 antisense 5' CACCTTGGAAACCAC 3'. For each reaction the
complementary DNA (cDNA) equivalent of 200 cells was amplified for 35 cycles using cycle parameters of 94°C for 30 seconds, 60°C for 60 seconds, and 72°C for 60 seconds. Interleukin-6 (IL-6) and IL-8 PCR
primers were obtained from Maxim Biotech (San Francisco, CA). The cDNA
equivalent of 200 cells was amplified for 35 cycles as per the
manufacturer's recommended cycle parameters.
Western blot analysis For the analysis of I B shown in Figure 3, cells were
cultured in serum-free medium alone or in the presence of 1.0 µM
MG-132 for the indicated number of minutes. Specimens were then
harvested, prepared, and analyzed exactly as described in Jordan and
coworkers.12 Blots were probed with antiphospho-specific
I B from Cell Signaling Technology (Beverly, MA).
Cell-cycle analysis Cell-cycle analysis was performed as previously described with some modifications.26 Cells were harvested, washed, and resuspended in PBS plus 0.5% FBS. Cell surface staining was performed using CD34-PE-Cy5 (Coulter, Miami, FL) and CD38-PE (Becton Dickinson). Afterward, cells were fixed in PBS plus 0.5% formaldehyde and incubated on ice for 30 minutes. Next, to permeabilize the cells, an equal volume of PBS plus 0.2% Triton X-100 was added and samples were incubated for 15 minutes on ice. Then, cells were washed and resuspended in PBS plus 0.5% FBS and labeled with Ki-67-FITC (Coulter). Lastly, each sample was washed and resuspended in PBS plus 0.5% FBS plus 10 µM 4', 6-diamidino-2-phenylindole (DAPI; Molecular Probes) and incubated for 1 hour before analysis by flow cytometry using a FACSVantage instrument configured to emit 355-nm, 488-nm, and 633-nm laser lines.
NF- B might be active in primary human
AML cells. To address this question, electrophoretic mobility shift
assays (EMSAs) were used to measure binding to a
32P-labeled NF- B consensus oligonucleotide in nuclear
extracts obtained from primary AML cells, normal bone marrow, or CB
cells. Prior to the isolation of nuclear extracts, both the AML and
normal cells were preselected for expression of the cell surface
antigen CD34. For AML specimens, which were derived from peripheral
blood samples, selection of CD34+ cells ensures a virtually
pure AML population, with no contamination from normal cells (the
presence of normal CD34+ cells in peripheral circulation is
extremely rare). Expression of CD34 also selects for relatively
immature components of the AML clone. Similarly, selection of
CD34+ cells is a common means of enriching for primitive
normal hematopoietic cells.27 As shown in Figure
1A, significant NF- B binding was detected in CD34+ AML cell nuclear extracts but not in
nuclear extracts obtained from normal CD34+ hematopoietic
cells. Each AML specimen showed at least 2 specific species (indicated
by arrows). In addition to the 6 independent specimens shown in Figure
1A, this observation has been confirmed with an additional 5 samples
(specimens 7-11 in Table 1, data not shown). To further analyze the
specificity of the binding shown in Figure 1A, all specimens were
tested using competition assays and supershift analysis. Figure 1B
shows representative data for 3 specimens. In each case the NF- B
binding was effectively competed with a 200-fold molar excess of
unlabeled consensus oligonucleotide, but not with a control mutant
oligonucleotide. Further, because the NF- B active complex can
consist of homodimers of p50 or heterodimers of p50 and
p65,28 the composition of the binding complex was assessed
using supershift assays with anti-p50 or anti-p65 antibodies. Both the
p50 and p65 subunits were readily detected.
NF- B in primitive AML cells, primary
specimens were sorted to isolate CD34+, CD38 ,
and CD123+ cells (> 95% pure). Importantly, these cells
were not cultured or stimulated in any way. Therefore, they presumably
reflect the status of primitive AML cells in vivo. Figure
2A shows representative EMSA analysis for
NF- B in the sorted
CD34+/CD38 /CD123+ AML cells.
Again, as seen for AML blasts (Figure 1), binding is readily detected,
with involvement of both the p50 and p65 subunits. This observation is
important for 2 reasons. First, it indicates that NF- B is relevant
to the biology of AML stem cells, a marked departure from the
regulation of normal stem cells. Second, it suggests a role for NF- B
that is not commonly observed. In most instances, induction of NF- B
activity is associated with cellular activation, as seen in response to
inflammatory cytokines or mitogen stimulation.29 However,
we determined that
CD34+/CD38 /CD123+ AML cells are
almost entirely quiescent. The data shown in Table 1 indicate that,
with the exception of sample 5, the average proportion of cells in
G0 corresponds to 96% ± 2.3%. Although sample 5 is
atypical with only 83% of cells in G0, it should be noted
that the remainder of the cells for this specimen were almost completely G1, with only 0.5% showing evidence of active
DNA replication (ie, S or G2 phase). The cell-cycle studies
were performed using a method of analysis previously developed for
characterization of normal stem/progenitor cells.26 This
strategy, referred to as surface, intracellular, and DNA (SID)
labeling, uses a combination of cell surface markers, nuclear antigens,
and DNA dyes to permit detailed analyses of cycle status. Figure 2B
shows the cell-cycle profile for a representative specimen using the
SID method of labeling. The panel on the left indicates the
CD34+/CD38 gate used for cell analysis (CD123
gate not shown). The panel on the right shows Ki-67 versus DAPI
labeling of CD34+/CD38 cells. G0
is defined as cells that are negative for expression of nuclear antigen
Ki-67 and have a normal diploid DNA content (lower left quadrant).
Clearly, the vast majority of AML CD34+/CD38
cells fall into this category. These data suggest that NF- B is
active in quiescent and primitive AML cells.
Proteasome inhibitors down-regulate NF- B in primitive AML cells, we
sought to further characterize its activity as a transcriptional activator. To this end, one approach is to assess the consequences of
NF- B inhibition. A recently used strategy for NF- B inhibition involves the use of proteasome inhibitors, which prevent degradation of
the regulatory molecule I B .30 By maintaining high
levels of I B , NF- B remains sequestered in the cytoplasm and is
therefore not active. Consequently, primary AML cells were tested with
the peptide aldehyde MG-132, a potent proteasome
inhibitor31. As shown in Figure
3A, a 6-hour treatment with 1 µM MG-132
resulted in strong inhibition of the NF- B binding activity. This
observation was consistent for all of the specimens listed in Table 1
(data not shown). To further assess the activity of NF- B, we also
examined downstream events arising from inhibition of NF- B by
determining whether the mRNA levels of NF- B transcriptional targets
were affected. Some known genes that are stimulated by NF- B include the cellular inhibitor of apoptosis 2 (c-IAP2),22 IL-6
(IL6),32 and IL-8
(IL8).33 Figure 3B shows reverse
transcription-PCR (RT-PCR) analysis for each of these 3 genes, as well
as for an actin control. The left panel shows that all genes are
detected in primary AML CD34+ cells, as would be expected
given the activity of NF- B. The right panel shows an RT-PCR analysis
of mRNA isolated from 200 sorted
CD34+/CD38 /CD123+ AML cells, plus
or minus 6 hours treatment with 1 µM MG-132. The 3 NF- B-regulated
genes are readily detected in the untreated samples, but inhibited in
the presence of MG-132, consistent with the down-regulation of NF- B.
As expected, the actin control is unaffected by the presence of MG-132.
These data further support the concept that NF- B is active in
primitive AML cells.
Because proteasome inhibitors are thought to inhibit NF- MG-132 induces apoptosis in AML but not normal primitive cells Because NF- B is known to promote cell survival in many cases,
we next determined whether its inhibition by MG-132 could
preferentially induce cell death in primary AML cells while sparing
normal cells. Figure 4A shows an example
of annexin V staining of AML versus normal CD34+ cells in
response to a 12-hour treatment with 1 µM MG-132. Cells in the lower
left quadrant of each dot plot represent viable cells, with early to
mid stages of apoptosis detected in the lower right and upper right
quadrants, respectively. Although normal cells show almost no loss of
viability in the presence of MG-132, the AML CD34+ cells
are strongly induced to undergo apoptosis (reduction from 80% to 16%
viable). Figure 4B shows further analysis of this phenomenon. Primary
cells were cultured for 12 hours with MG-132 alone (0.5 or 1.0 µM) or
in a combination of 1.0 µM MG-132 and 5 mM sodium salicylate.
Sodium salicylate is also a known inhibitor of NF- B,34 and previous studies have shown that it can also be toxic to AML cells,
albeit with slower kinetics (M.L.G. and C.T.J., unpublished observations, 2000). The figure shows the percentage of
apoptotic cells for 3 AML versus normal CD34+ cell
specimens, as assessed by staining with annexin V. The data indicate a
strong induction of apoptosis in the AML specimens, with almost no
effect on the normal cells. Interestingly, even the lower concentration
of MG-132 (0.5 µM) was sufficient to achieve high levels of apoptosis
for AML specimens 4 and 6. In contrast, AML specimen 2 had a more
moderate response to MG-132 alone, but a strong response to the
combination of MG-132 and salicylate. Because 5 mM salicylate alone has
almost no discernible effect within a 12-hour time frame (data not
shown), this observation suggests that in some cases the actions of
MG-132 and sodium salicylate may be additive or synergistic.
Finally, we compared the effect of MG-132 to the standard
chemotherapeutic drug, Ara-C. Like most chemotherapeutic drugs, Ara-C
preferentially kills actively cycling cells. As described above, most
of the LSC population is in the G0 phase of cell cycle and,
therefore, is not expected to be effectively targeted by Ara-C. Figure
5 shows annexin V labeling of total
versus CD34+/CD38
Acute myelogenous leukemia arises from a stem cell precursor with
a phenotype that was originally described as CD34+,
CD38 For most cell types, NF- One recent study detected NF- An important question for future studies will be to determine why
NF- Regardless of the reason for NF- Although definitive proof of LSC apoptosis will await detailed analysis
of MG-132-treated cells in appropriate animal model systems, we
propose that the data in this report strongly suggest that LSCs are
preferentially sensitive to inhibition of NF-
We gratefully acknowledge the generous support of the McDowell Cancer Foundation and the Donatina Colachicco Cancer Research Fund. We also thank Drs Gary Van Zant, Charlotte Kaetzel, Hartmut Geiger, and Stephen J. Szilvassy for helpful discussions and critical evaluation of the manuscript. Further, we acknowledge the NDRI for help in procuring normal bone marrow and CB specimens.
Submitted March 26, 2001; accepted June 20, 2001.
Supported by grants to C.T.J. from the Leukemia and Lymphoma Society (translational grant 6057-99), and the American Cancer Society (RPG-99-206-01-LBC).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Craig T. Jordan, Markey Cancer Center, 800 Rose St, Rm CC407, Lexington, KY 40536-0093; e-mail: cjordan{at}uky.edu.
1. Lagasse E, Connors H, Al-Dhalimy M, et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med. 2000;6:1229-1234[CrossRef][Medline] [Order article via Infotrieve].
2.
Lemischka I.
The power of stem cells reconsidered?
Proc Natl Acad Sci U S A.
1999;96:14193-14195 3. Gussoni E, Soneoka Y, Strickland CD, et al. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature. 1999;401:390-394[CrossRef][Medline] [Order article via Infotrieve].
4.
Jackson KA, Mi T, Goodell MA.
Hematopoietic potential of stem cells isolated from murine skeletal muscle.
Proc Natl Acad Sci U S A.
1999;96:14482-14486
5.
Phillips RL, Ernst RE, Brunk B, et al.
The genetic program of hematopoietic stem cells.
Science.
2000;288:1635-1640
6.
Park IK, Klug CA, Li K, et al.
Molecular cloning and characterization of a novel regulator of G-protein signaling from mouse hematopoietic stem cells.
J Biol Chem.
2001;276:915-923
7.
Blair A, Hogge DE, Sutherland HJ.
Most acute myeloid leukemia progenitor cells with long-term proliferative ability in vitro and in vivo have the phenotype CD34(+)/CD71( 8. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med. 1997;3:730-737[CrossRef][Medline] [Order article via Infotrieve]. 9. Lapidot T, Sirard C, Vormoor J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-648[CrossRef][Medline] [Order article via Infotrieve].
10.
Blair A, Hogge DE, Ailles LE, Lansdorp PM, Sutherland HJ.
Lack of expression of Thy-1 (CD90) on acute myeloid leukemia cells with long-term proliferative ability in vitro and in vivo.
Blood.
1997;89:3104-3112 11. Blair A, Sutherland HJ. Primitive acute myeloid leukemia cells with long-term proliferative ability in vitro and in vivo lack surface expression of c-kit (CD117). Exp Hematol. 2000;28:660-671[CrossRef][Medline] [Order article via Infotrieve]. 12. Jordan CT, Upchurch D, Szilvassy SJ, et al. The interleukin-3 receptor alpha chain is a unique marker for human acute myelogenous leukemia stem cells. Leukemia. 2000;14:1777-1784[CrossRef][Medline] [Order article via Infotrieve].
13.
Guzman ML, Upchurch D, Grimes B, et al.
Expression of tumor suppressor genes interferon regulatory factor 1 and death-associated kinase in primitive acute myelogenous leukemia cells.
Blood.
2001;97:2177-2179
14.
Wang W, Abbruzzese JL, Evans DB, Larry L, Cleary KR, Chiao PJ.
The nuclear factor-kappa B RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells.
Clin Cancer Res.
1999;5:119-127 15. Bargou RC, Emmerich F, Krappmann D, et al. Constitutive nuclear factor-kappaB-RelA activation is required for proliferation and survival of Hodgkin's disease tumor cells. J Clin Invest. 1997;100:2961-2969[Medline] [Order article via Infotrieve].
16.
Sovak MA, Arsura M, Zanieski G, Kavanagh KT, Sonenshein GE.
The inhibitory effects of transforming growth factor beta1 on breast cancer cell proliferation are mediated through regulation of aberrant nuclear factor-kappaB/Rel expression.
Cell Growth Differ.
1999;10:537-544
17.
Shattuck-Brandt RL, Richmond A.
Enhanced degradation of I-kappaB alpha contributes to endogenous activation of NF-kappaB in Hs294T melanoma cells.
Cancer Res.
1997;57:3032-3039 18. Kordes U, Krappmann D, Heissmeyer V, Ludwig WD, Scheidereit C. Transcription factor NF-kappaB is constitutively activated in acute lymphoblastic leukemia cells. Leukemia. 2000;14:399-402[CrossRef][Medline] [Order article via Infotrieve]. 19. Kim JY, Lee S, Hwangbo B, et al. NF-kappaB activation is related to the resistance of lung cancer cells to TNF-alpha-induced apoptosis. Biochem Biophys Res Commun. 2000;273:140-146[CrossRef][Medline] [Order article via Infotrieve]. 20. Dokter WH, Tuyt L, Sierdsema SJ, Esselink MT, Vellenga E. The spontaneous expression of interleukin-1 beta and interleukin-6 is associated with spontaneous expression of AP-1 and NF-kappa B transcription factor in acute myeloblastic leukemia cells. Leukemia. 1995;9:425-432[Medline] [Order article via Infotrieve].
21.
Wang CY, Mayo MW, Baldwin AS.
TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB.
Science.
1996;274:784-787
22.
Wang CY, Mayo MW, Korneluk RG, Goeddel DV, Baldwin AS.
NF-kappaB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c- IAP2 to suppress caspase-8 activation.
Science.
1998;281:1680-1683 23. Epinat JC, Gilmore TD. Diverse agents act at multiple levels to inhibit the Rel/NF-kappaB signal transduction pathway. Oncogene. 1999;18:6896-6909[CrossRef][Medline] [Order article via Infotrieve].
24.
Lansdorp PM, Dragowska W.
Long-term erythropoiesis from constant numbers of CD34+ cells in serum-free cultures initiated with highly purified progenitor cells from human bone marrow.
J Exp Med.
1992;175:1501-1509
25.
Dignam JD, Lebovitz RM, Roeder RG.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
1983;11:1475-1489 26. Jordan CT, Yamasaki G, Minamoto D. High-resolution cell cycle analysis of defined phenotypic subsets within primitive human hematopoietic cell populations. Exp Hematol. 1996;24:1347-1355[Medline] [Order article via Infotrieve]. 27. Civin CI. Identification and positive selection of human progenitor/stem cells for bone marrow transplantation. Prog Clin Biol Res. 1992;377:461-472[Medline] [Order article via Infotrieve]. 28. Mayo MW, Baldwin AS. The transcription factor NF-kappaB: control of oncogenesis and cancer therapy resistance. Biochim Biophys Acta. 2000;1470:M55-M62[Medline] [Order article via Infotrieve]. 29. Ghosh S, May MJ, Kopp EB. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol. 1998;16:225-260[CrossRef][Medline] [Order article via Infotrieve]. 30. Baldwin AS. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol. 1996;14:649-683[CrossRef][Medline] [Order article via Infotrieve].
31.
Meriin AB, Gabai VL, Yaglom J, Shifrin VI, Sherman MY.
Proteasome inhibitors activate stress kinases and induce Hsp72. Diverse effects on apoptosis.
J Biol Chem.
1998;273:6373-6379
32.
Libermann TA, Baltimore D.
Activation of interleukin-6 gene expression through the NF-kappa B transcription factor.
Mol Cell Biol.
1990;10:2327-2334
33.
Kunsch C, Rosen CA.
NF-kappa B subunit-specific regulation of the interleukin-8 promoter.
Mol Cell Biol.
1993;13:6137-6146
34.
Kopp E, Ghosh S.
Inhibition of NF-kappa B by sodium salicylate and aspirin.
Science.
1994;265:956-959
35.
Terpstra W, Ploemacher RE, Prins A, et al.
Fluorouracil selectively spares acute myeloid leukemia cells with long-term growth abilities in immunodeficient mice and in culture.
Blood.
1996;88:1944-1950
36.
Holyoake T, Jiang X, Eaves C, Eaves A.
Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia.
Blood.
1999;94:2056-2064 37. Pahl HL. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 1999;18:6853-6866[CrossRef][Medline] [Order article via Infotrieve].
38.
Pyatt DW, Stillman WS, Yang Y, Gross S, Zheng JH, Irons RD.
An essential role for NF-kappaB in human CD34(+) bone marrow cell survival.
Blood.
1999;93:3302-3308 39. Towatari M, Iida H, Tanimoto M, Iwata H, Hamaguchi M, Saito H. Constitutive activation of mitogen-activated protein kinase pathway in acute leukemia cells. Leukemia. 1997;11:479-484[CrossRef][Medline] [Order article via Infotrieve].
40.
Schuringa JJ, Wierenga AT, Kruijer W, Vellenga E.
Constitutive Stat3, Tyr705, and Ser727 phosphorylation in acute myeloid leukemia cells caused by the autocrine secretion of interleukin-6.
Blood.
2000;95:3765-3770
41.
Grumont RJ, Rourke IJ, O'Reilly LA, et al.
B lymphocytes differentially use the Rel and nuclear factor kappaB1 (NF-kappaB1) transcription factors to regulate cell cycle progression and apoptosis in quiescent and mitogen-activated cells.
J Exp Med.
1998;187:663-674 42. Thomas X, Hirschauer C, Troncy J, et al. Serum interleukin-6 levels in adult acute myelogenous leukemia: relationship with disease characteristics and outcome. Leuk Lymphoma. 1997;24:291-300[Medline] [Order article via Infotrieve]. 43. Cabannes E, Khan G, Aillet F, Jarrett RF, Hay RT. Mutations in the IkBa gene in Hodgkin's disease suggest a tumour suppressor role for IkappaBalpha. Oncogene. 1999;18:3063-3070[CrossRef][Medline] [Order article via Infotrieve].
44.
Devalaraja MN, Wang DZ, Ballard DW, Richmond A.
Elevated constitutive IkappaB kinase activity and IkappaB-alpha phosphorylation in Hs294T melanoma cells lead to increased basal MGSA/GRO-alpha transcription.
Cancer Res.
1999;59:1372-1377 45. Naujokat C, Sezer O, Zinke H, Leclere A, Hauptmann S, Possinger K. Proteasome inhibitors induced caspase-dependent apoptosis and accumulation of p21WAF1/Cip1 in human immature leukemic cells. Eur J Haematol. 2000;65:221-236[CrossRef][Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
L. Jiang, J. Li, and L. Song Bmi-1, stem cells and cancer Acta Biochim Biophys Sin, July 1, 2009; 41(7): 527 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Rosen and C. T. Jordan The Increasing Complexity of the Cancer Stem Cell Paradigm Science, June 26, 2009; 324(5935): 1670 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Schneider, E. Hoster, M. Unterhalt, S. Schneider, A. Dufour, T. Benthaus, G. Mellert, E. Zellmeier, S. K. Bohlander, M. Feuring-Buske, et al. NPM1 but not FLT3-ITD mutations predict early blast cell clearance and CR rate in patients with normal karyotype AML (NK-AML) or high-risk myelodysplastic syndrome (MDS) Blood, May 21, 2009; 113(21): 5250 - 5253. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. van der Weide, S. D.P.W.M. de Jonge-Peeters, F. Kuipers, E. G.E. de Vries, and E. Vellenga Combining Simvastatin with the Farnesyltransferase Inhibitor Tipifarnib Results in an Enhanced Cytotoxic Effect in a Subset of Primary CD34+ Acute Myeloid Leukemia Samples Clin. Cancer Res., May 1, 2009; 15(9): 3076 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Majeti, M. W. Becker, Q. Tian, T.-L. M. Lee, X. Yan, R. Liu, J.-H. Chiang, L. Hood, M. F. Clarke, and I. L. Weissman Dysregulated gene expression networks in human acute myelogenous leukemia stem cells PNAS, March 3, 2009; 106(9): 3396 - 3401. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Dick Stem cell concepts renew cancer research Blood, December 15, 2008; 112(13): 4793 - 4807. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Banerjee, M. Sieburg, E. Samuelson, and G. Feuer Human T-Cell Lymphotropic Virus Type 1 Infection of CD34+ Hematopoietic Progenitor Cells Induces Cell Cycle Arrest by Modulation of p21cip1/waf1 and Survivin Stem Cells, December 1, 2008; 26(12): 3047 - 3058. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Strair, M. Gharibo, D. Schaar, A. Rubin, J. Harrison, J. Aisner, H.-C. Lin, Y. Lin, L. Goodell, M. Anand, et al. Nuclear Factor-{kappa}B Modulation in Patients Undergoing Induction Chemotherapy for Acute Myelogenous Leukemia Clin. Cancer Res., November 15, 2008; 14(22): 7564 - 7568. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, D. Yan, X. Shi, H. Liang, Y. Pang, N. Qin, H. Chen, J. Wang, B. Yin, X. Jiang, et al. Transmembrane TNF-{alpha} mediates "forward" and "reverse" signaling, inducing cell death or survival via the NF-{kappa}B pathway in Raji Burkitt lymphoma cells J. Leukoc. Biol., September 1, 2008; 84(3): 789 - 797. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. T. Kawasaki, E. M. Hurt, T. Mistree, and W. L. Farrar Targeting Cancer Stem Cells with Phytochemicals Mol. Interv., August 1, 2008; 8(4): 174 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tang, X. Wei, Y. Guo, P. Breslin, S. Zhang, S. Zhang, W. Wei, Z. Xia, M. Diaz, S. Akira, et al. TAK1 is required for the survival of hematopoietic cells and hepatocytes in mice J. Exp. Med., July 7, 2008; 205(7): 1611 - 1619. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Hassane, M. L. Guzman, C. Corbett, X. Li, R. Abboud, F. Young, J. L. Liesveld, M. Carroll, and C. T. Jordan Discovery of agents that eradicate leukemia stem cells using an in silico screen of public gene expression data Blood, June 15, 2008; 111(12): 5654 - 5662. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Huff and W. Matsui Multiple Myeloma Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2895 - 2900. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Hart and W. S. El-Deiry Invincible, but Not Invisible: Imaging Approaches Toward In Vivo Detection of Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2901 - 2910. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Marcucci, M. D. Radmacher, K. Maharry, K. Mrozek, A. S. Ruppert, P. Paschka, T. Vukosavljevic, S. P. Whitman, C. D. Baldus, C. Langer, et al. MicroRNA Expression in Cytogenetically Normal Acute Myeloid Leukemia N. Engl. J. Med., May 1, 2008; 358(18): 1919 - 1928. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dayyani, J. Wang, J.-R. J. Yeh, E.-Y. Ahn, E. Tobey, D.-E. Zhang, I. D. Bernstein, R. T. Peterson, and D. A. Sweetser Loss of TLE1 and TLE4 from the del(9q) commonly deleted region in AML cooperates with AML1-ETO to affect myeloid cell proliferation and survival Blood, April 15, 2008; 111(8): 4338 - 4347. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chumsri, W. Matsui, and A. M Burger Therapeutic Implications of Leukemic Stem Cell Pathways Am. Assoc. Cancer Res. Educ. Book, April 12, 2008; 2008(1): 397 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Attar, D. J. DeAngelo, J. G. Supko, F. D'Amato, D. Zahrieh, A. Sirulnik, M. Wadleigh, K. K. Ballen, S. McAfee, K. B. Miller, et al. Phase I and Pharmacokinetic Study of Bortezomib in Combination with Idarubicin and Cytarabine in Patients with Acute Myelogenous Leukemia Clin. Cancer Res., March 1, 2008; 14(5): 1446 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liu, Z. Liu, Z. Xie, J. Pang, J. Yu, E. Lehmann, L. Huynh, T. Vukosavljevic, M. Takeki, R. B. Klisovic, et al. Bortezomib induces DNA hypomethylation and silenced gene transcription by interfering with Sp1/NF-{kappa}B-dependent DNA methyltransferase activity in acute myeloid leukemia Blood, February 15, 2008; 111(4): 2364 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Duncan, C. A. Goetz, S. J. Stein, K. J. Mayo, B. J. Skaggs, K. Ziegelbauer, C. L. Sawyers, and A. S. Baldwin I{kappa}B kinase {beta} inhibition induces cell death in Imatinib-resistant and T315I Dasatinib-resistant BCR-ABL+ cells Mol. Cancer Ther., February 1, 2008; 7(2): 391 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, B. Sung, and B. B. Aggarwal Nuclear Factor-{kappa}B Activation: From Bench to Bedside Experimental Biology and Medicine, January 1, 2008; 233(1): 21 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Colado, S. Alvarez-Fernandez, P. Maiso, J. Martin-Sanchez, M. B. Vidriales, M. Garayoa, E. M. Ocio, J. C. Montero, A. Pandiella, and J. F. San Miguel The effect of the proteasome inhibitor bortezomib on acute myeloid leukemia cells and drug resistance associated with the CD34+ immature phenotype Haematologica, January 1, 2008; 93(1): 57 - 66. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, X. Li, C. A. Corbett, R. M. Rossi, T. Bushnell, J. L. Liesveld, J. Hebert, F. Young, and C. T. Jordan Rapid and selective death of leukemia stem and progenitor cells induced by the compound 4-benzyl, 2-methyl, 1,2,4-thiadiazolidine, 3,5 dione (TDZD-8) Blood, December 15, 2007; 110(13): 4436 - 4444. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, R. M. Rossi, S. Neelakantan, X. Li, C. A. Corbett, D. C. Hassane, M. W. Becker, J. M. Bennett, E. Sullivan, J. L. Lachowicz, et al. An orally bioavailable parthenolide analog selectively eradicates acute myelogenous leukemia stem and progenitor cells Blood, December 15, 2007; 110(13): 4427 - 4435. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chumsri, W. Matsui, and A. M. Burger Therapeutic Implications of Leukemic Stem Cell Pathways Clin. Cancer Res., November 15, 2007; 13(22): 6549 - 6554. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Naujokat and T. Saric Concise Review: Role and Function of the Ubiquitin-Proteasome System in Mammalian Stem and Progenitor Cells Stem Cells, October 1, 2007; 25(10): 2408 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. van Rhenen, G. A. M. S. van Dongen, A. Kelder, E. J. Rombouts, N. Feller, B. Moshaver, M. S.-v. Walsum, S. Zweegman, G. J. Ossenkoppele, and G. Jan Schuurhuis The novel AML stem cell associated antigen CLL-1 aids in discrimination between normal and leukemic stem cells Blood, October 1, 2007; 110(7): 2659 - 2666. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cilloni, G. Martinelli, F. Messa, M. Baccarani, and G. Saglio Nuclear factor {kappa}B as a target for new drug development in myeloid malignancies Haematologica, September 1, 2007; 92(9): 1224 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xiao, C. E. Inal, V. I. Parekh, C.-M. Chang, and M. H. Whitnall 5-Androstenediol Promotes Survival of {gamma}-Irradiated Human Hematopoietic Progenitors through Induction of Nuclear Factor-{kappa}B Activation and Granulocyte Colony-Stimulating Factor Expression Mol. Pharmacol., August 1, 2007; 72(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rae, S. Langa, S. J. Tucker, and D. J. MacEwan Elevated NF-{kappa}B responses and FLIP levels in leukemic but not normal lymphocytes: reduction by salicylate allows TNF-induced apoptosis PNAS, July 31, 2007; 104(31): 12790 - 12795. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chakrabarti, P. Blair, and J. E. Freedman CD40-40L Signaling in Vascular Inflammation J. Biol. Chem., June 22, 2007; 282(25): 18307 - 18317. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rizo, E. Vellenga, G. de Haan, and J. J. Schuringa Signaling pathways in self-renewing hematopoietic and leukemic stem cells: do all stem cells need a niche? Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R210 - R219. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Jordan, M. L. Guzman, and M. Noble Cancer stem cells. N. Engl. J. Med., September 21, 2006; 355(12): 1253 - 1261. [Full Text] [PDF] |
||||
![]() |
T. Braun, G. Carvalho, A. Coquelle, M.-C. Vozenin, P. Lepelley, F. Hirsch, J.-J. Kiladjian, V. Ribrag, P. Fenaux, and G. Kroemer NF-{kappa}B constitutes a potential therapeutic target in high-risk myelodysplastic syndrome Blood, February 1, 2006; 107(3): 1156 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ravandi and Z. Estrov Eradication of Leukemia Stem Cells as a New Goal of Therapy in Leukemia Clin. Cancer Res., January 15, 2006; 12(2): 340 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Stock Controversies in Treatment of AML: Case-based Discussion Hematology, January 1, 2006; 2006(1): 185 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. B. Kerbauy, V. Lesnikov, N. Abbasi, S. Seal, B. Scott, and H. J. Deeg NF-{kappa}B and FLIP in arsenic trioxide (ATO)-induced apoptosis in myelodysplastic syndromes (MDSs) Blood, December 1, 2005; 106(12): 3917 - 3925. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Paz-Priel, D. H. Cai, D. Wang, J. Kowalski, A. Blackford, H. Liu, C. A. Heckman, A. F. Gombart, H. P. Koeffler, L. M. Boxer, et al. CCAAT/Enhancer Binding Protein {alpha} (C/EBP{alpha}) and C/EBP{alpha} Myeloid Oncoproteins Induce Bcl-2 via Interaction of Their Basic Regions with Nuclear Factor-{kappa}B p50 Mol. Cancer Res., October 1, 2005; 3(10): 585 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, R. M. Rossi, L. Karnischky, X. Li, D. R. Peterson, D. S. Howard, and C. T. Jordan The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells Blood, June 1, 2005; 105(11): 4163 - 4169. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Recher, O. Beyne-Rauzy, C. Demur, G. Chicanne, C. Dos Santos, V. M.-D. Mas, D. Benzaquen, G. Laurent, F. Huguet, and B. Payrastre Antileukemic activity of rapamycin in acute myeloid leukemia Blood, March 15, 2005; 105(6): 2527 - 2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Frelin, V. Imbert, E. Griessinger, A.-C. Peyron, N. Rochet, P. Philip, C. Dageville, A. Sirvent, M. Hummelsberger, E. Berard, et al. Targeting NF-{kappa}B activation via pharmacologic inhibition of IKK2-induced apoptosis of human acute myeloid leukemia cells Blood, January 15, 2005; 105(2): 804 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Platzer, A. Jorgl, S. Taschner, B. Hocher, and H. Strobl RelB regulates human dendritic cell subset development by promoting monocyte intermediates Blood, December 1, 2004; 104(12): 3655 - 3663. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Gilliland, C. T. Jordan, and C. A. Felix The Molecular Basis of Leukemia Hematology, January 1, 2004; 2004(1): 80 - 97. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Topisirovic, M. L. Guzman, M. J. McConnell, J. D. Licht, B. Culjkovic, S. J. Neering, C. T. Jordan, and K. L. B. Borden Aberrant Eukaryotic Translation Initiation Factor 4E-Dependent mRNA Transport Impedes Hematopoietic Differentiation and Contributes to Leukemogenesis Mol. Cell. Biol., December 15, 2003; 23(24): 8992 - 9002. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yagi, A. Morimoto, M. Eguchi, S. Hibi, M. Sako, E. Ishii, S. Mizutani, S. Imashuku, M. Ohki, and H. Ichikawa Identification of a gene expression signature associated with pediatric AML prognosis Blood, September 1, 2003; 102(5): 1849 - 1856. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Xu, S.-E. Simpson, T. J. Scialla, A. Bagg, and M. Carroll Survival of acute myeloid leukemia cells requires PI3 kinase activation Blood, August 1, 2003; 102(3): 972 - 980. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Guan, B. Gerhard, and D. E. Hogge Detection, isolation, and stimulation of quiescent primitive leukemic progenitor cells from patients with acute myeloid leukemia (AML) Blood, April 15, 2003; 101(8): 3142 - 3149. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Holloway, S. Rao, X. Chen, and M. F. Shannon Changes in Chromatin Accessibility Across the GM-CSF Promoter upon T Cell Activation Are Dependent on Nuclear Factor {kappa}B Proteins J. Exp. Med., February 17, 2003; 197(4): 413 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hasegawa, K. Suzuki, C. Sakamoto, K. Ohta, S. Nishiki, M. Hino, N. Tatsumi, and S. Kitagawa Expression of the inhibitor of apoptosis (IAP) family members in human neutrophils: up-regulation of cIAP2 by granulocyte colony-stimulating factor and overexpression of cIAP2 in chronic neutrophilic leukemia Blood, February 1, 2003; 101(3): 1164 - 1171. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Guzman, C. F. Swiderski, D. S. Howard, B. A. Grimes, R. M. Rossi, S. J. Szilvassy, and C. T. Jordan Preferential induction of apoptosis for primary human leukemic stem cells PNAS, December 10, 2002; 99(25): 16220 - 16225. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mori, Y. Yamada, S. Ikeda, Y. Yamasaki, K. Tsukasaki, Y. Tanaka, M. Tomonaga, N. Yamamoto, and M. Fujii Bay 11-7082 inhibits transcription factor NF-kappa B and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells Blood, August 13, 2002; 100(5): 1828 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mitsiades, C. S. Mitsiades, V. Poulaki, D. Chauhan, P. G. Richardson, T. Hideshima, N. Munshi, S. P. Treon, and K. C. Anderson Biologic sequelae of nuclear factor-kappa B blockade in multiple myeloma: therapeutic applications Blood, May 13, 2002; 99(11): 4079 - 4086. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||