|
|
 Previous Article | Table of Contents | Next Article 
Blood, 15 October 2001, Vol. 98, No. 8, pp. 2544-2554
PHAGOCYTES
Bifurcation of osteoclasts and dendritic cells from
common progenitors
Takeshi Miyamoto,
Osamu Ohneda,
Fumio Arai,
Katsuya Iwamoto,
Seiji Okada,
Katsumasa Takagi,
Dirk M. Anderson, and
Toshio Suda
From the Department of Cell Differentiation, Institute
of Molecular Embryology and Genetics, and Department of Orthopedic
Surgery, Kumamoto University School of Medicine, Honjo, Japan;
Department of Developmental Genetics, Chiba University Graduate School
of Medicine, Japan; and Department of Molecular Biology, Immunex
Corporation, Seattle, WA.
 |
Abstract |
Osteoclasts and dendritic cells are derived from
monocyte/macrophage precursor cells; however, how their lineage
commitment is regulated is unknown. This study investigated
the differentiation pathways of osteoclasts and dendritic cells from
common precursor cells at the single-cell level. Osteoclastogenesis
induced by macrophage colony-stimulating factor (M-CSF) and receptor
activator of nuclear factor- B ligand (RANKL) or tumor necrosis
factor- (TNF-) is completely inhibited by addition of
granulocyte-macrophage colony-stimulating factor (GM-CSF) or
interleukin-3 at early stages of differentiation. GM-CSF-treated cells
express both c-Fms and RANK and also low levels of CD11c and DEC205,
which are detected on dendritic cells. Addition of GM-CSF also reduces
expression of both c-Fos and Fra-1, which is an important event for
inhibition of osteoclastogenesis. Overexpression of c-Fos by
retroviral infection or induction in transgenic mice can rescue a
failure in osteoclast differentiation even in the presence of GM-CSF.
By contrast, differentiation into dendritic cells is inhibited by
M-CSF, indicating that M-CSF and GM-CSF reciprocally regulate the
differentiation of both lineages. Dendritic cell maturation is also
inhibited when c-Fos is expressed at an early stage of differentiation.
Taken together, these findings suggest that c-Fos is a key mediator of
the lineage commitment between osteoclasts and dendritic cells. The
lineage determination of osteoclast progenitors seen following GM-CSF
treatment functions through the regulation of c-Fos expression.
(Blood. 2001;98:2544-2554)
© 2001 by The American Society of Hematology.
| |
Introduction |
Osteoclasts and dendritic cells are the
monocyte/macrophage lineage cells derived from hematopoietic stem
cells.1-5 However, how commitment to a given lineage is
established among macrophages, osteoclasts, and dendritic cells is
unclear. Macrophage colony-stimulating factor (M-CSF),
granulocyte-macrophage colony-stimulating factor (GM-CSF), and
interleukin-3 (IL-3) are macrophage-inducing cytokines with different
specificities of action. GM-CSF and IL-3 can induce lineages of
hematopoietic cells other than macrophages. The effect of M-CSF is
restricted to induction of macrophages, although it is also important
for osteoclastogenesis.6-8 We have established an in vitro
osteoclast differentiation system using isolated precursor cells and a
stromal cell-free culture media containing M-CSF and a soluble form of
receptor activator of nuclear factor-B ligand (sRANKL).9,10 This system enables us to observe directly
the effect of various cytokines and transcription factors on
osteoclasts. RANK and RANKL were shown to be essential for osteoclast
development11,12 and dendritic cell
activation.13 In addition to M-CSF and RANKL, osteoclastogenesis is stimulated by IL-1 and tumor necrosis factor- (TNF-)14-17 and inhibited by interferon  (IFN-),
IL-18, and GM-CSF.18-20 However, it is not known how
osteoclastogenesis is inhibited or whether cells differentiate into
another lineage following inhibition.
Several transcription factors are known to be essential for osteoclast
formation. They include PU.1,21 c-Fos,22,23
nuclear factor B1 (NF-B1), and
NF-B2.24 PU.1-deficient mice show a
macrophage differentiation failure, and osteoclastogenesis is inhibited
at an early stage of differentiation. The c-Fos is a component of the
dimeric transcription factor AP-1, which includes not only c-Fos but
FosB, Fra-1, Fra-2, and Jun proteins such as c-Jun, JunB, and JunD.
Mice deficient in c-Fos exhibit osteopetrosis due to an osteoclast
differentiation defect, while the number of macrophages
increases,23 indicating that inhibition of differentiation occurs later than in PU.1-deficient mice. Fra-1 is thought to be a
target of c-Fos,25,26 which is supported by the
observation that Fra-1 expression can rescue the osteoclastogenesis
defect seen in c-Fos-deficient mice.27 NF-B is
downstream of RANK28 and TNF receptor-associated factor 6 (TRAF6),29 which are also essential for osteoclast
differentiation,12,30 and the phenotype of mice doubly
mutant in NF-B1 and NF-B2 includes an
osteoclast differentiation failure.24 Dendritic cells are
derived from hematopoietic stem cells4,5,31 and
monocyte/macrophage progenitor cells.1 Dendritic cell
differentiation is stimulated by GM-CSF, TNF-, Flt-3 ligand, IL-4,
or RANKL.4,13,31-34 Furthermore, RelB, PU.1, and Ikaros
are reported to be required for dendritic cell
development,35-37 as evidenced by the absence of dendritic cells in both RelB / and Ikaros/
mice35,37 and the increase of monocytes/macrophages seen
in Ikaros mutants.37
In this study, we characterized a lineage bifurcation of
monocyte/macrophage precursor cells using an in vitro differentiation system. Osteoclast differentiation was inhibited and dendritic cell
differentiation was reciprocally stimulated by GM-CSF through suppression of c-Fos. On the other hand, dendritic cell development was
inhibited by expression of c-Fos, indicating that early c-Fos expression is involved in the lineage determination of osteoclasts and
dendritic cells.
| |
Materials and methods |
Fluorescence-activated cell-sorter analysis and cell
sorting
Two-month-old C57/BL6 (female) mice were purchased from SCL
(Shizuoka, Japan). Transgenic mice in which c-Fos expression is under
control of the IFN-/ -inducible Mx promoter
(Mx-c-fos)38,39 were maintained as
heterozygotes. Mouse bone marrow cells were harvested from femurs
and tibias, and osteoclast precursor cells (c-Kit+c-Fms+RANK or
c-Fms+RANK cells) were prepared as previously
described.10 Briefly, mononuclear cells were stained with
biotinylated anti-RANK monoclonal antibody (muRANK-M395) (a gift from
Immunex, Seattle, WA) followed by allophycocyanin-conjugated streptavidin (Caltag Laboratories, San Francisco, CA), fluorescein isothiocyanate-conjugated c-Fms (AFS98) (a gift from Toray Industries, Kamakura, Japan), and R-phycoerythrin (R-PE)-conjugated c-Kit (2B8)
(Pharmingen, San Diego, CA). Cell sorting was performed using
fluorescence-activated cell-sorter (FACS) Vantage or FACS Calibur
(Becton Dickinson Immunocytometry Systems, San Jose, CA). Data were
analyzed using Lysys II software on a Consort 32 system or Cellquest
software (Becton Dickinson).
The c-Kit+c-Fms+RANK cells were
clone-sorted, and each single cell was plated in a well of 96-well
culture plates (Primaria; Falcon3872, Becton Dickinson) using
the FACS Vantage single-cell sort system and cultured in the presence
of M-CSF and sRANKL; GM-CSF and sRANKL; or M-CSF, sRANKL, and GM-CSF;
as described below. After 6 days of cultivation, cells were identified,
and the frequency of the wells containing osteoclasts or dendritic cells was determined.
Osteoclast differentiation in vitro
A total of 1000 sorted cells were plated on 96-well culture
plates (Primaria) and cultured in -minimal essential medium (Gibco, Gaithersburg, MD) containing 10% fetal bovine serum (JRH Bioscience, Lenexa, KS), 100 ng/mL M-CSF (R&D Systems, Minneapolis, MN), and 25 ng/mL sRANKL (prepared as previously described9) with or without GM-CSF, IL-3, or IL-5 (purchased from R&D Systems) in the
presence or absence of IFN-/ (Sigma Chemical, St Louis, MO) for 6 days. For the GM-CSF blocking assay, a neutralizing antibody against
GM-CSF (R&D Systems) was added to the culture medium containing 100 ng/mL M-CSF, 25 ng/mL sRANKL, and 1 ng/mL GM-CSF. In some experiments,
various concentrations of TNF- (R&D Systems) were added to the
cultures instead of sRANKL. To block sRANKL and TNF-, RANK-Fc (R&D
Systems) was added to the culture medium containing 100 ng/mL M-CSF and
25 ng/mL sRANKL or 25 ng/mL TNF-. Cultured cells were subjected to
tartrate-resistant acid phosphatase (TRAP) staining (Sigma) or TRAP
solution assays as previously described.9
Analysis of c-Fms, RANK, and GM-CSF receptor expression
Osteoclast precursor cells (c-Fms+RANK
cells) were cultured in the presence of M-CSF, GM-CSF, or both for 24 or 72 hours on fibronectin-coated plates that were preincubated with
2% bovine serum albumin/phosphate-buffered saline for 30 minutes at
37°C. Cells were then harvested using a cell scraper (Becton
Dickinson) and either analyzed by FACS or used to prepare total RNA for
reverse transcriptase-polymerase chain reaction (RT-PCR). For FACS
analysis, cells were incubated with CD16/CD32 antibody (2.4G2) Fc block (1:100) on ice for 20 minutes and stained with biotinylated anti-c-Fms or RANK monoclonal antibody for 30 minutes on ice and washed twice. Subsequently, cells were incubated with allophycocyanin-conjugated streptavidin for 30 minutes on ice. For isotype-matched controls, biotinylated rat immunoglobulin G2a (IgG2a) was used. After the final
wash, the expression of c-Fms and RANK was analyzed by FACS Calibur.
For analysis of GM-CSF receptor expression, RT-PCR analysis was
performed as described below.
Colony assay
A colony assay was performed as described
previously.10 After 6 days of cultivation, the numbers of
colonies were scored under a microscope, and single colonies were
aliquotted and placed on culture plates or fibronectin-coated dishes.
Cells in the culture plates were cultured with M-CSF and sRANKL or with
GM-CSF and sRANKL for 6 days and then stained with TRAP and DEC205
(NLDC-145) (Serotec, Oxford, England). Immunohistochemical staining of
DEC205 was performed as described elsewhere.40 Cells on
fibronectin-coated plates were cultured in the presence of GM-CSF and
sRANKL for 6 days, and the expression of Mac-1 and CD11c was analyzed
as described below.
Dendritic cell differentiation in vitro
The c-Kit+c-Fms+RANK cells
were cultured in liquid culture containing M-CSF alone; GM-CSF alone;
GM-CSF and sRANKL; M-CSF, sRANKL, and GM-CSF; or in methylcellulose
culture containing M-CSF and sRANKL. After 6 days of
cultivation, cells were collected and incubated with Fc block (1:100)
on ice for 20 minutes. Subsequently, cells were aliquotted for staining
with Mac-1 and CD11c or DEC205. For Mac-1 and CD11c staining, cells
were stained with biotinylated anti-Mac-1 (Pharmingen) for 30 minutes
on ice and washed twice. Cells were then incubated with PE-conjugated
anti-CD11c antibody (Pharmingen) and allophycocyanin-conjugated
streptavidin (Caltag) for 30 minutes on ice and washed twice. For
DEC205 staining, cells were incubated with DEC205 (1:50) for 30 minutes
on ice and washed twice and were then stained with
B-PE-conjugated anti-rat IgG antibody (Jackson ImmunoResearch
Laboratories, West Grove, PA) for 30 minutes on ice. For
isotype-matched controls, biotinylated (Pharmingen) and PE-conjugated
rat IgG2a (Pharmingen) were used. After the final wash, cells were
suspended in washing buffer (5% fetal bovine serum/phosphate-buffered
saline), and the expression of Mac-1 and CD11c or DEC205 was analyzed
by FACS Calibur.
RT-PCR analysis
Total RNA was isolated from freshly isolated osteoclast
precursor cells (c-Fms+RANK cells) or
cultured cells (Rneasy mini kit, Qiagen, Hilden, Germany). Single-strand complementary DNAs (cDNAs) were synthesized with reverse
transcription (first-strand cDNA synthesis kit, Clontech Laboratories,
Palo Alto, CA). The cDNAs were amplified using the Advantage2 PCR
System (PerkinElmer, Norwalk, CT) in a GeneAmp PCR system model 9700 (PerkinElmer) for 30 cycles. Each cycle consisted of 30 seconds of
denaturation at 94°C and 4 minutes of annealing/extension at 70°C.
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was used as an
internal control. Primers used for RT-PCR were as follows: CTR
(calcitonin receptor)-5', 5'-TGGTTGAGGTTGTGCCCAATGGAGA-3'; CTR-3',
5'-CTCGTGGGTTTGCCTCATCTTGGTC-3'; c-Src-5', 5'-TGATGTTATGAAGA ACTGCTCGCACCTG-3'; c-Src-3', 5'-TGCCCATTTGCTGGGTACTTTCTTTCTC-3'; c-Fms-5', 5'-CTGTGAATGGCTCTGATGTCCTGTTCTG-3'; c-Fms-3', 5'-CTCCCACTT CTCATTGTAGGGCAACTGA-3'; c-Fos-5', 5'-ATGATGTTCTCGGGTTTCAACG-3'; c-Fos-3', 5'-CAGTCTGCTGCATAGAAGGAACCG-3'; RANK5',
5'-CTTCGACTGGTT CACTGCTCCTAAT-3'; RANK3',
5'-TTACTGTTTCCAGTCACGTTCCCAGAGG-3'; PU.1-5',
5'-CTGAGAACCACTTCACAGAGCTGCAGAG-3'; PU.1-3', 5'-GCGCCATC
TTCTGGTAGGTCATCTTCTT-3'; Fra-1-5', 5'-GTGCAAGTGGTTCAGCCCAAGAAC TTTT-3'; Fra-1-3', 5'-GGGTCCTTCTTGTCTCCTTCTGGGATTT-3'; GM-CSF R-3',
5'-CACGATGACGTCTATCAGCATCGCTTC-3'; G3PDH-5', 5'-TGAAGGTCGGTGTGA ACGGATTTGGC-3'; G3PDH-3', 5'-CATGTAGGCCATGAGGTCCACCAC-3'.
Preparation of retroviral vectors expressing full-length or
truncated forms of c-Fos and Fra-1
Full-length and truncated ( 262) forms of c-Fos and
Fra-1 (full-length and 185) expression retroviral vectors were
generated by ligating the RT-PCR products into the pMY-IRES-GFP
vector provided by Dr T. Kitamura (University of Tokyo, Institute of
Medical Science). The primer sets for RT-PCR are as follows:
c-Fos-5', 5'-GGAATTCATGATGTTCTCGGGTTTCAACG-3'; c-Fos-full-3',
5'-ACGCGTCGACTCACAGGGCCAGCAGCGTGGGTGA-3'; c-Fos- 262-3',
5'-ACGCGTCGACTCACACGTTGCTGATGCTCTCTTGACTGGCT-3';
Fra-1-5', 5'GGAATT CATGTACCGAGACTACGGGGAAC-3';
Fra-1- full-3', ACGCGTCGACTCACAAAGCC AGGAGTGTAGGAGAG-3';
Fra-1- 185-3', 5'-ACGCGTCGACTCAAGAACCACCTGGGTCCTTCTTGT-3'. Single-stranded cDNA was generated from total RNA isolated from cultured osteoclast precursor cells in the presence of M-CSF and sRANKL
for 6 days.
Retroviral vectors were transfected into Phoenix-ecotropic cells by
Lipofectamine Plus (Gibco) in Dulbecco modified essential medium (Gibco) containing 10% fetal bovine serum. The medium was collected after 24 and 48 hours of incubation as a virus solution and
stored at  80°C. For infection of osteoclast precursor cells, retronectin-coated plates (Takara, Otsu, Japan) were used. A total of
1000 sorted c-Kit+c-Fms+RANK
cells were cultured on these plates in the presence of 100 ng/mL M-CSF,
25 ng/mL sRANKL, and 1 ng/mL GM-CSF with 10 multiplicities of infection
of various retroviral constructs. After 24 hours of infection, the
culture medium was changed to fresh medium containing M-CSF, sRANKL,
and GM-CSF. After 5 days of cultivation, cells were stained with TRAP
and the number of TRAP-positive cells were scored.
| |
Results |
GM-CSF inhibits osteoclast differentiation
We previously showed that osteoclasts differentiate from isolated
osteoclast precursor cells (c-Fms+RANK cells)
in the presence of M-CSF and sRANKL in a stromal cell-free culture
system.10 Such osteoclastogenesis is inhibited by GM-CSF in a dose-dependent manner (Figure 1A).
This inhibitory effect can be seen at concentrations of GM-CSF as low
as 0.01 ng/mL. A small number of mononuclear TRAP-positive cells are
observed at 0.01 ng/mL GM-CSF, and the inhibitory effect is completely abolished by addition of a neutralizing antibody against GM-CSF. At 0.1 ng/mL GM-CSF, TRAP-positive cells were not detected and cell clusters
were observed (Figure 1B). Because GM-CSF and RANKL are known to induce
dendritic cell differentiation and clustering,13 these
clusters were interpreted to be dendritic cells (see below). Interestingly, the inhibitory effect of GM-CSF was observed only when
GM-CSF was added on day 0, and inhibition decreased as GM-CSF addition
was delayed (Figure 1C). These results suggest that after the
differentiation signal by M-CSF and RANKL is transduced, cells are no
longer competent to respond to GM-CSF.
View larger version (47K):
[in this window]
[in a new window]
| Figure 1.
Inhibition of
osteoclastogenesis by GM-CSF.
The c-Fms+RANK cells were cultured in the
presence of M-CSF and sRANKL with or without GM-CSF. After 6 days of
cultivation, cells were subjected to a TRAP activity assay (A) and TRAP
staining (B). The inhibitory effect of GM-CSF on osteoclast
differentiation was dose dependent and abolished by addition of
neutralizing antibody against GM-CSF (A). In the absence of GM-CSF,
multinuclear TRAP-positive cells were formed (B). Only mononuclear
TRAP-positive cells and TRAP-negative cells were observed in the
presence of 0.01 ng/mL GM-CSF, and cell clusters that were
TRAP-negative were detected in the presence of 0.1 ng/mL GM-CSF (B).
Bar = 25 µm. (C) The c-Fms+RANK cells were
cultured in the presence of M-CSF and sRANKL, and 1 ng/mL GM-CSF was
added to the culture on days 0, 1, 3, and 5. Inhibition of
osteoclastogenesis was observed only when GM-CSF was added on days 0 and 1. Control = no addition of GM-CSF.
|
|
The GM-CSF receptor shares a common chain with IL-3 and IL-5
receptors.41 To assess the involvement of a potential
common -chain signal in osteoclastogenesis, we determined whether
IL-3 and IL-5 inhibit osteoclastogenesis (Figure
2A). IL-3 effectively inhibited
osteoclast differentiation, while IL-5 did not. It is possible that
osteoclast precursor cells (c-Fms+RANK cells)
cultured in this assay are not competent to respond to IL-5. To examine
this possibility, a methylcellulose colony assay was performed to
analyze whether osteoclast precursor cells respond to IL-3 and IL-5
(Figure 2B). IL-3 and GM-CSF stimulated colony formation by osteoclast
precursors, but IL-5 did not, while IL-5 at this dose induced
eosinophil colonies from whole bone marrow cells. Colony cells cultured
with GM-CSF or IL-3 differentiated into multinuclear TRAP-positive
cells when cells were transferred to liquid medium and
cultured with M-CSF and sRANKL (data not shown).
View larger version (20K):
[in this window]
[in a new window]
| Figure 2.
Inhibition of osteoclastogenesis by IL-3.
(A) The c-Fms+RANK cells were cultured in the
presence of M-CSF and sRANKL with or without IL-3 and IL-5. Osteoclast
differentiation was inhibited by addition of IL-3 but not IL-5. (B) The
c-Fms+RANK cells were cultured in 1.2%
methylcellulose medium containing 100 ng/mL M-CSF, IL-5, IL-3, or
various concentrations of GM-CSF. Colony formation was observed in the
presence of M-CSF, IL-3, and GM-CSF but not IL-5.
|
|
Because it was reported that TNF- induced
osteoclastogenesis,42,43 TNF- was added to the culture
system instead of sRANKL. As shown in Figure
3A, differentiation into TRAP-positive
cells from osteoclast precursors was observed in the presence of
TNF- and M-CSF. TRAP activity peaked at 25 ng/mL TNF-, and
multinuclear TRAP-positive cells were seen (Figure 3B). The expression
of vitronectin receptors (integrin v and
3) and a CTR was also detected by RT-PCR (Figure 3C),
suggesting that these cells were committed to an osteoclast lineage.
The TRAP activity induced by M-CSF and TNF- was not reduced by
addition of RANK-Fc, which completely inhibited
osteoclastogenesis stimulated by RANKL (Figure 3D). GM-CSF also
strongly inhibited osteoclast differentiation induced by TNF- in a
dose-dependent manner.
View larger version (27K):
[in this window]
[in a new window]
| Figure 3.
Inhibition of TNF--induced osteoclastogenesis by GM-CSF.
The c-Fms+RANK cells were cultured in the
presence of 100 ng/mL M-CSF with various concentrations of TNF- or
25 ng/mL sRANKL. After 6 days of culture, cells were subjected to a
TRAP activity assay (A) or TRAP staining (bar = 25 µm) (B).
Osteoclastogenesis reached a plateau at 25 ng/mL TNF- (A), and
multinuclear TRAP-positive cells were also formed (B). Expression of
vitronectin receptors (integrin v and 3)
or a CTR were detected by RT-PCR in cells cultured with M-CSF and
TNF- for 6 days (C). NC indicates no template control.
Osteoclast differentiation was induced by 2 cytokine combinations:
M-CSF and sRANKL and, also, M-CSF and TNF-. Differentiation induced
by the former was completely inhibited by the addition of
RANKFc in a dose-dependent manner, but differentiation
induced by the latter was not. By contrast, GM-CSF inhibited both in a
dose-dependent manner (D).
|
|
RANK and c-Fms are expressed in the presence of GM-CSF
We previously reported that RANK expression is induced by M-CSF
and subsequent stimulation by RANKL induces
osteoclastogenesis.9 Gliniak and Rohrschneider have shown
that expression of c-Fms is reduced in the presence of GM-CSF or
IL-3.44 Thus, it is likely that GM-CSF suppresses
expression of c-Fms or RANK and that subsequently, the effect of M-CSF
or RANKL is inhibited. Because inhibition of osteoclastogenesis occurs
at early stages of differentiation, we examined expression of c-Fms and
RANK by FACS after 24 and 72 hours of cultivation. Expression of c-Fms, however, was observed in cultures with M-CSF and/or GM-CSF (Figure 4A). Because the monoclonal antibody
against c-Fms recognizes the ligand binding site, c-Fms expression may
be relatively low in the presence of M-CSF due to the occupation of the
antibody binding site by M-CSF. Similarly, RANK expression was induced even in the presence of GM-CSF, and the expression was detected in
cultures at 24 and 72 hours (Figure 4B). These results were confirmed
by RT-PCR analysis (Figure 4C). Our findings indicate that the
inhibitory effect of GM-CSF on osteoclastogenesis is not mediated by a
blockade in receptor expression. RT-PCR analysis revealed that GM-CSF
receptor chain was expressed in freshly isolated osteoclast
precursor cells and was up-regulated in the presence of GM-CSF and/or
M-CSF (Figure 4C). Overall, our results indicate that osteoclast
precursor cells express both c-Fms and GM-CSF receptor chain and
that RANK is induced by both M-CSF and GM-CSF. The expression of c-Fms
and RANK was also observed in the culture with IL-3 (data not
shown).
View larger version (39K):
[in this window]
[in a new window]
| Figure 4.
RANK and c-Fms expression is induced in the presence of
GM-CSF.
The c-Fms+RANK cells were cultured in the
presence of 100 ng/mL M-CSF or 50 ng/mL GM-CSF alone or both for 24 and
72 hours, and the expression of c-Fms (A) and RANK (B) was examined by
FACS. The expression of c-Fms, RANK, and GM-CSF receptor (C) was
analyzed by RT-PCR. Expression of c-Fms and RANK was observed in the
presence of GM-CSF alone or GM-CSF and M-CSF, and the expression of
GM-CSF receptor chain (GM-CSF R) was detected in the presence of
M-CSF or M-CSF and GM-CSF. NC indicates no template
control.
|
|
Down-regulation of c-Fos by GM-CSF is a key event for the
inhibition of osteoclastogenesis
Osteoclastogenesis was completely inhibited by addition of GM-CSF
even though cells expressed both c-Fms and RANK. We therefore asked
which transcription factors could be involved in this inhibition. First
we investigated the expression of the factors such as PU.1, c-Fos,
NF-B1, and NF-B2 by RT-PCR. The
expression of PU.1 and NF-B1 was not altered by addition
of GM-CSF (data not shown); however, the expression of c-Fos was
strongly suppressed (Figure 5A),
suggesting that inhibition of c-Fos expression might be related to
inhibition of osteoclastogenesis.
View larger version (63K):
[in this window]
[in a new window]
| Figure 5.
Down-regulation of c-Fos is a
key event for the inhibition of osteoclastogenesis in the presence of
GM-CSF.
The c-Kit+c-Fms+RANK cells were
cultured in the presence of M-CSF (100 ng/mL) alone; M-CSF and sRANKL
(25 ng/mL); and M-CSF, sRANKL, and GM-CSF (1 ng/mL) for 6 days. The
effect of retroviral infection with full-length c-Fos (c-Fos-full),
truncated c-Fos (c-Fos-) or mock-infected cells was examined in
cultures containing M-CSF and sRANKL and GM-CSF. Expression of c-Fos,
Fra-1, and G3PDH was examined by RT-PCR on day 6 (A). NC indicates
no template control. Expression of Fra-1 was induced by c-Fos-full but
not by c-Fos-. Retroviral infection could be detected by GFP
expression visualized with a fluorescence microscope (B). Cell
spreading and disappearance of cell clusters were observed following
infection with c-Fos-full or c-Fos- but not in mock-infected cells
(arrow indicates cell cluster). Significant increases in
TRAP-positive cells were detected in the c-Fos-full infection
(B,C). Bar = 25 µm.
|
|
To rescue suppression of c-Fos, we expressed c-Fos in osteoclast
precursor cells by retroviral expression. Because cell proliferation is
critical for retroviral infection,
c-Kit+c-Fms+RANK cells were used
as osteoclast precursors in the following experiments. Because the
truncated form of c-Fos lacking its carboxy (C)-terminus is reported
to overcome the osteoclastogenesis defect in c-Fos-deficient mice,27 we tested both full-length (c-Fos-full) and
truncated forms lacking the C-terminal domain (c-Fos-). Retroviral
infection of osteoclast precursors was detected by expression of green
fluorescent protein (GFP) inserted downstream of an internal ribosome
entry site (IRES) sequence in the retroviral vector (Figure 5B).
Osteoclast precursors
(c-Kit+c-Fms+RANK cells) were
cultured in the presence of M-CSF and sRANKL with 1 ng/mL GM-CSF and 10 multiplicities of infection of various retroviral preparations. GFP
expression was observed from day 3 under fluorescence microscopy, and
the frequency of GFP-positive cells was 21.1% to 33.3%. Expression of
c-Fos was observed by RT-PCR in cells infected by c-Fos-expressing
retrovirus but not in mock-infected cells on day 6 (Figure 5A).
We also examined the expression of the closely related transcription
factor Fra-1, because Fra-1 was shown to rescue the osteoclast differentiation defect seen in c-Fos-deficient mice.27
Interestingly, Fra-1 expression was strongly suppressed by GM-CSF;
however, Fra-1 was induced when osteoclast precursors were infected by
c-Fos-full but not by retrovirus expressing c-Fos- (Figure 5A).
Why c-Fos- fails to induce Fra-1 is not clear, but this finding
correlates with previous reports that Fra-1 is a target of
c-Fos.25,26 After 6 days of cultivation, GFP-positive
cells infected by both full-length c-Fos and c-Fos- retrovirus
showed obvious morphologic changes, such as spreading and loss of cell
clustering (Figure 5B). In Fra-1-induced cells, cell spreading was not
observed and cell clustering was still detected (data not shown),
suggesting that the amino (N)-terminus of c-Fos might be required for
regulation of cell spreading and clustering. TRAP-positive cells were
observed when full length of c-Fos was expressed (Figure 5B,C),
although TRAP-positive cells were not seen following c-Fos-
expression. Because c-Fos- failed to induce Fra-1, it is likely
that Fra-1 alone is sufficient to induce osteoclastogenesis in the
presence of GM-CSF. However, the expression of Fra-1 did not induce
osteoclastogenesis as efficiently as did full-length c-Fos (Figure 5C).
To confirm the role of c-Fos in osteoclast differentiation in the
presence of GM-CSF, inducible c-Fos transgenic mice known as Mx-c-fos
mice were used to prepare osteoclast precursor cells (c-Kit+c-Fms+RANK cells).
The Mx-c-fos mouse was constructed to induce c-Fos expression by
addition of IFN-/; however, IFN-/ is known to inhibit
osteoclastogenesis. The frequency of osteoclast precursor cells in bone
marrow mononuclear cells was not different in Mx-c-fos mice from that
seen in wild-type littermates (data not shown). First, we examined
whether osteoclast differentiation was affected by the addition of the
inducing agent, IFN-/. Osteoclast precursor cells were cultured
in the presence of M-CSF and sRANKL with or without various
concentrations of IFN-/. Osteoclastogenesis was strongly
inhibited by 1000 U/mL IFN-/ in both Mx-c-fos and wild-type
littermates even in the absence of GM-CSF (Figure
6A). c-Fos was induced within 24 hours by
addition of 200 U/mL IFN-/ (data not shown), and such treatment had no inhibitory effect on osteoclast formation (Figure 6A) even though the c-Fos-inducible gene, 2'-5' oligoadenylate synthetase, was
induced in a dose-dependent manner (data not shown). Subsequently, we
examined the effect of c-Fos induction by IFN-/ on osteoclast formation in the presence of GM-CSF. The effect of IFN-/ on rescue of the osteoclast differentiation defect was dose-dependent and
peaked at 200 U/mL (Figure 6B). Induction of c-Fos in cells prepared
from Mx-c-fos mice resulted in formation of multinuclear TRAP-positive
cells. Such cells were not observed in similar assays of cells from
wild-type littermates in the presence of GM-CSF (Figure 6C). These
findings are consistent with the analysis using retroviral infection,
which demonstrates a rescue of osteoclast differentiation defect by
c-Fos expression in the presence of GM-CSF. The c-Fos induction rescued
osteoclastogenesis especially in multinucleation rather than TRAP
activity (Figure 6C). Induction of c-Fos at early stages of culture was
more efficient at promoting osteoclastogenesis than induction at later
stages (Figure 6D), similar to the findings in Figure 1C, showing that
cell lineage was determined at early stages of differentiation. The
expression of c-Fos increased as GM-CSF addition was delayed (data not
shown).
View larger version (50K):
[in this window]
[in a new window]
| Figure 6.
Induction of c-Fos can rescue
the osteoclastogenesis failure by GM-CSF.
(A) The c-Kit+c-Fms+RANK cells
prepared from wild-type littermates ( ) or Mx-c-fos mice ( ) were
cultured in the presence of 100 ng/mL M-CSF and 25 ng/mL sRANKL with
(200 or 1000 U/mL) or without IFN-/ for 6 days, and a TRAP
activity assay was performed. Osteoclastogenesis was strongly inhibited
by 1000 U/mL IFN-/ in both Mx-c-fos and wild-type littermates.
(B) The c-Kit+c-Fms+RANK cells
prepared from Mx-c-fos mice were cultured in the presence of 100 ng/mL
M-CSF, 25 ng/mL sRANKL, and 1 ng/mL GM-CSF with IFN-/ (2, 20, or
200 U/mL) for 6 days, and a TRAP staining was performed. The formation
of TRAP-positive cells was observed in a dose-dependent manner. (C)
Osteoclast differentiation was not affected by addition of 200 U/mL
IFN-/ in both wild-type littermates and Mx-c-fos mice, and
multinuclear TRAP-positive cells were observed in the absence of GM-CSF
(i,iii). The multinuclear TRAP-positive cells were formed when c-Fos
was induced by the addition of IFN-/ in Mx-c-fos mice in the
presence of GM-CSF (ii), while no TRAP-positive cells were detected in
wild-type littermates (iv). Bar = 100 µm. (D) The
c-Kit+c-Fms+RANK cells were
cultured in the presence of M-CSF, sRANKL, and GM-CSF. IFN-/ was
present over the culture period (days 0-6), during the first 3 days
(days 0-3), and the last 3 days (day 4-6). After 6 days of
culture, the number of TRAP-positive cells were counted. The early
expression of c-Fos is more effective than that of late expression in
the rescue of osteoclastogenesis.
|
|
RT-PCR analysis showed that c-Fos was induced by addition of
IFN-/ in cells prepared from the Mx-c-fos mice as was Fra-1, as
observed when c-Fos was induced by retroviral infection (Figure 7). The expression of CTR and c-Src,
which are osteoclast markers, was also induced, indicating that cells
were committed to an osteoclast lineage even in the presence of GM-CSF.
View larger version (86K):
[in this window]
[in a new window]
| Figure 7.
Cells are committed to an osteoclast lineage by c-Fos
induction, but Jun proteins are not involved in the rescue of
osteoclastogenesis.
The expression of c-Fos, Fra-1, c-Src, CTR, and G3PDH was examined in
c-Fms+RANK cells cultured for 6 days with
M-CSF and sRANKL (A); M-CSF, sRANKL, and GM-CSF (B); and M-CSF, sRANKL,
GM-CSF, and IFN-/ (C). NC indicates no template control.
Expression of Fra-1, c-Src, and CTR was observed following induction
of c-Fos.
|
|
Analysis of dendritic cell differentiation
In the presence of M-CSF, sRANKL, and GM-CSF, osteoclastogenesis
was completely inhibited, and cell clusters, which are indicative of
dendritic cell activation, were observed (Figure 1B). Because GM-CSF is known to be involved in dendritic cell
differentiation,32 it is likely that the cells are
committed to a dendritic cell lineage. To test this possibility, we
examined the expression of CD11c, which is a marker of dendritic
cells,45 and Mac-1, which is expressed on macrophages
(Figure 8A). Cells cultured with M-CSF
alone or with M-CSF and sRANKL (or LZ-RANKL) for 6 days expressed Mac-1
but not CD11c. However, in the presence of M-CSF, sRANKL, and GM-CSF,
CD11c expression was induced together with that of Mac-1, indicating a
shift from an osteoclast to a dendritic cell lineage. To confirm a
bifurcated differentiation of osteoclast precursors to osteoclasts and
dendritic cells, clonal analysis was performed by methylcellulose
culture. At first, single colonies derived from osteoclast precursors
in the presence of M-CSF or GM-CSF were exposed to M-CSF and sRANKL or
GM-CSF and sRANKL on day 6 of culture. After 6 more days, cells were
stained with TRAP and DEC205, a marker of mature dendritic cells. Both TRAP- and DEC205-positive cells were seen in cells derived from the
same colony, indicating that osteoclast precursors can differentiate into osteoclasts or dendritic cells other than macrophages (data not
shown). Next, single-cell sorting of
c-Kit+c-Fms+RANK cells was
performed, and sorted cells were cultured in the presence of M-CSF and
sRANKL; GM-CSF and sRANKL; and M-CSF, sRANKL, and GM-CSF. After 6 days
of culture, cells were stained with TRAP and DEC205 to determine the
frequency of osteoclast and dendritic cells. In the 2 experiments, the
frequency of TRAP-positive cells was 58.3% and 39.6%, while
DEC205-positive cells were 54.5% and 33.3%, respectively (Table
1). Judging from high plating efficiency, it was suggested that osteoclasts and dendritic cells develop from the
same precursors. This result was confirmed by the culture with M-CSF,
sRANKL, and GM-CSF. Mixed wells (8.3% and 4.2%) contained both
TRAP-positive and -negative cells, and the other wells contained only
TRAP-negative cells in 32.3% (Table 2).
No well contained only TRAP-positive cells, as observed in the culture
with M-CSF and sRANKL, indicating the differentiation into osteoclasts
was inhibited by GM-CSF. The
c-Kit+c-Fms+RANK cells have
bipotency to respond to both M-CSF and GM-CSF.
View larger version (56K):
[in this window]
[in a new window]
| Figure 8.
Induction of dendritic cell differentiation in the
presence of GM-CSF and its inhibition by c-Fos expression.
(A) The c-Kit+c-Fms+RANK cells
were cultured in liquid medium containing M-CSF alone; or M-CSF,
sRANKL, and GM-CSF; or 1.2% methylcellulose medium containing M-CSF
and sRANKL for 6 days, and the expression of CD11c and Mac-1 was
examined by FACS. Expression of CD11c was induced by addition of
GM-CSF. (B) The c-Kit+c-Fms+RANK
cells were prepared from wild-type littermates (i) and Mx-c-fos mice
(ii) and cultured in the presence of GM-CSF alone; GM-CSF and sRANKL;
and GM-CSF, sRANKL, and IFN-/. After 6 days of cultivation, cells
were harvested and stained with CD11c and Mac-1. The
CD11c+Mac-1+ cells were induced by GM-CSF, and
the CD11c+Mac-1 cells appeared in the
presence of GM-CSF and sRANKL in both wild-type littermates and
Mx-c-fos mice. However, the expression of CD11c was reduced by
induction of c-Fos in Mx-c-fos mice.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1.
Frequency of TRAP-positive cells (M-CSF and sRANKL) and
DEC205-positive cells (GM-CSF and sRANKL) developed from single common
progenitors
|
|
Finally, we examined the effect of c-Fos on dendritic cell
differentiation using Mx-c-fos mice. Cells expressing CD11c and Mac-1
were observed in cultures of cells with GM-CSF, and dendritic cell
activation was indicated by reduced expression of Mac-1
(CD11c+Mac-1)46 in cultures of
cells from Mx-c-fos mice with GM-CSF and sRANKL (Figure 8B). Induction
of DEC205 was observed in the presence of sRANKL with GM-CSF (data not
shown). However, the frequency of CD11c+Mac-1
cells was reduced following c-Fos induction (Figure 8B), and DEC205
expression was suppressed by c-Fos induction even in the presence of
GM-CSF and sRANKL (data not shown), indicating that c-Fos negatively
affects dendritic cell differentiation. Inhibition of dendritic cell
maturation was also observed following addition of M-CSF to cultures
containing GM-CSF and sRANKL (Figure 8A), suggesting that M-CSF
inhibits dendritic cell differentiation. The inhibitory effect of c-Fos
and M-CSF on dendritic cell differentiation was more effective when
they were induced or added early (data not shown). Our results suggest
that M-CSF and GM-CSF antagonize each other in the differentiation of
osteoclasts and dendritic cells. Osteoclast differentiation is
inhibited due to the lineage switching promoted by GM-CSF through
suppression of c-Fos. Therefore, c-Fos plays a pivotal role at an early
switch in differentiation of precursors into osteoclasts or dendritic cells.
| |
Discussion |
Bifurcated differentiation of osteoclasts and dendritic
cells
Here we present findings supporting a differentiation and lineage
determination model between osteoclasts and dendritic cells (Figure
9). We have used a stromal cell-free
culture system that allows us to manipulate osteoclast differentiation.
M-CSF and sRANKL induce osteoclastogenesis, while GM-CSF and sRANKL
induce dendritic cell differentiation from single common precursors
(c-Kit+c-Fms+RANK cells). Bone
resorptive multinuclear osteoclasts differentiate from
monocyte/macrophage progenitor cells in the presence of M-CSF and
sRANKL47,48 and are identified as TRAP-positive cells. Because the inhibition of osteoclastogenesis induced by GM-CSF is
observed in all wells, which receive single cells, it is likely that
the differentiation pathway of common precursor cells is influenced by
extrinsic factors. Reduction of c-Fos is critical for inhibition of
osteoclastogenesis by GM-CSF, while expression of c-Fos inhibits
dendritic cell maturation. Therefore, c-Fos is a critical regulator of
both osteoclast and dendritic cell differentiation.
View larger version (20K):
[in this window]
[in a new window]
| Figure 9.
Differentiation and lineage bifurcation model between
osteoclasts and dendritic cells from common precursor cells
(c-Kit+c-Fms+RANK cells).
The differentiation of osteoclasts is inhibited by GM-CSF through
reduction of c-Fos expression. By contrast, dendritic cell maturation
induced by GM-CSF and sRANKL is inhibited by expression of c-Fos
or M-CSF.
|
|
Dendritic cells also differentiate from macrophage precursor
cells,1 and GM-CSF plays an important role in their
differentiation.49 CD11c+/Mac-1
cells are reported to be more mature dendritic cells than are CD11c+/Mac-1+ cells,46 and this
maturation step occurs following addition of sRANKL to cultures with
GM-CSF. RANKL is an activating factor of dendritic
cells,13 and the activation was confirmed in our study by
observation of up-regulation of the maturation marker DEC205 in the
presence of both GM-CSF and sRANKL. This maturational step was
inhibited by addition of M-CSF. Taken together, our findings indicate
that differentiation into an osteoclast or a dendritic cell lineage is
reciprocally inhibited by M-CSF and GM-CSF, respectively. To understand
how lineages of osteoclasts and dendritic cells bifurcate in the
presence of GM-CSF, we examined expression and function of cytokine
receptors and transcription factors.
Expression of cytokine receptors in differentiation
M-CSF, GM-CSF, and IL-3 are macrophage-inducible cytokines. The
RANK and c-Fms receptors are indispensable for osteoclast differentiation, and we have previously reported that pretreatment of
precursor cells with M-CSF is required for osteoclastogenesis as well
as RANK induction.9 Although it is reported that
expression of c-Fms is inhibited in the presence of GM-CSF or
IL-3,44 expression of c-Fms, RANK, and GM-CSF receptors
was detected in the presence of M-CSF, GM-CSF, or IL-3 in our culture
system, suggesting that inhibition of osteoclastogenesis is not due to
down-regulation of receptor expression. Common -chain signaling
shared with GM-CSF, IL-3, and IL-5 receptors could be involved in
inhibition of osteoclast differentiation, although in our experiments
osteoclast precursors did not respond to IL-5. This inhibition of
osteoclastogenesis is considered to have species variability because
human GM-CSF did not inhibit human osteoclast differentiation (data
not shown). Because cells in the colonies formed in the presence of
GM-CSF or IL-3 are able to differentiate into multinuclear osteoclasts, when they are transfered to the liquid culture with M-CSF and RANKL the
inhibitory effect of GM-CSF and IL-3 on osteoclastogenesis is
reversible. It has been reported that GM-CSF or IL-3 can rescue the
osteoclastogenesis defect in op/op mice.50 Our
findings indicate that GM-CSF may increase the number of osteoclast
precursor cells rather than directly induce the osteoclast
differentiation. Recently Niida et al reported that VEGFR-1 is
expressed in osteoclasts and VEGF can rescue the osteopetrosis in
op/op mice by substituting in part for M-CSF in
osteoclastogenesis.51
Critical function of c-Fos in the differentiation switch
Osteopetrosis due to an osteoclast differentiation failure is a
phenotype observed following targeted mutation of several genes,
including RANK, RANKL, TRAF6, and the transcription factors PU.1,
c-Fos, NF-B1, and
NF-B2.11,12,21-24,30 Among these proteins, we showed that c-Fos expression was specifically suppressed in the
presence of GM-CSF. The c-Fos is a component of the AP-1 family of
transcriptional regulators composed of c-Fos proteins (c-Fos, FosB,
Fra-1, Fra-2) and Jun proteins (c-Jun, JunB, JunD), and c-Fos
transgenic mice exhibit osteosarcoma.52,53 Although c-Fos contains a transactivation domain in its C-terminus, a truncated form
of c-Fos (c-Fos-) lacking the C-terminus effectively rescues the
osteoclastogenesis defect seen in c-Fos-deficient mice.27 However, c-Fos- did not rescue an osteoclastogenesis defect induced by GM-CSF as full length of c-Fos, suggesting that the C-terminal of
c-Fos is required to overcome the effect of GM-CSF. Fra-1 is thought to
be a target of c-Fos,25,26 and overexpression of Fra-1
rescues the osteoclast defect seen in c-Fos-deficient
mice.27 A truncated form of Fra-1 lacking the C-terminus
can also rescue osteoclastogenesis in c-Fos-deficient
mice,27 but osteoclast induction by full-length and
truncated forms of Fra-1 or c-Fos- is less effective compared with
full length of c-Fos. Interestingly, Fra-1 was induced by expression of
full-length c-Fos but not by c-Fos-. Taken together, because
expression of Fra-1 did not rescue the osteoclastogenesis as
full-length c-Fos, the C-terminal of c-Fos is likely to be important
for osteoclast differentiation as well as induction of Fra-1 in the
presence of GM-CSF. In contrast, morphologic changes, such as cell
spreading and loss of clustering, were induced by both the full-length
and truncated forms of c-Fos. Cell aggregation, which is an indicator
of dendritic cell activation,13 was inhibited by both
full-length and truncated c-Fos. Recently, Fra-1 and  FosB transgenic
mice have been shown to exhibit osteosclerosis due to increased bone
formation54,55; however, no bone abnormalities have been
observed in FosB knockout mice56 or in mice expressing c-Jun, JunB, FosB, or Fra-2.52
The effect of c-Fos on osteoclastogenesis was confirmed in experiments
with cells derived from the Mx-c-fos mice, in which c-Fos expression
was induced in osteoclast precursor cells. Using this system, we
demonstrated that suppression of c-Fos is crucial for the inhibition of
osteoclastogenesis by GM-CSF at bifurcation of osteoclasts and
dendritic cells. Because Fra-1 was induced by c-Fos expression as
observed in our retroviral experiments, Fra-1 may cooperate with c-Fos
to overcome the GM-CSF effect. In addition to its positive e |
Top
Abstract
Introduction