|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
PHAGOCYTES
From the Department of Cell Differentiation, Institute
of Molecular Embryology and Genetics, and Department of Orthopedic
Surgery, Kumamoto University School of Medicine, Honjo, Japan;
Department of Developmental Genetics, Chiba University Graduate School
of Medicine, Japan; and Department of Molecular Biology, Immunex
Corporation, Seattle, WA.
Osteoclasts and dendritic cells are derived from
monocyte/macrophage precursor cells; however, how their lineage
commitment is regulated is unknown. This study investigated
the differentiation pathways of osteoclasts and dendritic cells from
common precursor cells at the single-cell level. Osteoclastogenesis
induced by macrophage colony-stimulating factor (M-CSF) and receptor
activator of nuclear factor- Osteoclasts and dendritic cells are the
monocyte/macrophage lineage cells derived from hematopoietic stem
cells.1-5 However, how commitment to a given lineage is
established among macrophages, osteoclasts, and dendritic cells is
unclear. Macrophage colony-stimulating factor (M-CSF),
granulocyte-macrophage colony-stimulating factor (GM-CSF), and
interleukin-3 (IL-3) are macrophage-inducing cytokines with different
specificities of action. GM-CSF and IL-3 can induce lineages of
hematopoietic cells other than macrophages. The effect of M-CSF is
restricted to induction of macrophages, although it is also important
for osteoclastogenesis.6-8 We have established an in vitro
osteoclast differentiation system using isolated precursor cells and a
stromal cell-free culture media containing M-CSF and a soluble form of
receptor activator of nuclear factor- Several transcription factors are known to be essential for osteoclast
formation. They include PU.1,21 c-Fos,22,23
nuclear factor In this study, we characterized a lineage bifurcation of
monocyte/macrophage precursor cells using an in vitro differentiation system. Osteoclast differentiation was inhibited and dendritic cell
differentiation was reciprocally stimulated by GM-CSF through suppression of c-Fos. On the other hand, dendritic cell development was
inhibited by expression of c-Fos, indicating that early c-Fos expression is involved in the lineage determination of osteoclasts and
dendritic cells.
Fluorescence-activated cell-sorter analysis and cell
sorting
The c-Kit+c-Fms+RANK Osteoclast differentiation in vitro
Analysis of c-Fms, RANK, and GM-CSF receptor expression Osteoclast precursor cells (c-Fms+RANK
cells) were cultured in the presence of M-CSF, GM-CSF, or both for 24 or 72 hours on fibronectin-coated plates that were preincubated with
2% bovine serum albumin/phosphate-buffered saline for 30 minutes at
37°C. Cells were then harvested using a cell scraper (Becton
Dickinson) and either analyzed by FACS or used to prepare total RNA for
reverse transcriptase-polymerase chain reaction (RT-PCR). For FACS
analysis, cells were incubated with CD16/CD32 antibody (2.4G2) Fc block (1:100) on ice for 20 minutes and stained with biotinylated anti-c-Fms or RANK monoclonal antibody for 30 minutes on ice and washed twice. Subsequently, cells were incubated with allophycocyanin-conjugated streptavidin for 30 minutes on ice. For isotype-matched controls, biotinylated rat immunoglobulin G2a (IgG2a) was used. After the final
wash, the expression of c-Fms and RANK was analyzed by FACS Calibur.
For analysis of GM-CSF receptor expression, RT-PCR analysis was
performed as described below.
Colony assay A colony assay was performed as described previously.10 After 6 days of cultivation, the numbers of colonies were scored under a microscope, and single colonies were aliquotted and placed on culture plates or fibronectin-coated dishes. Cells in the culture plates were cultured with M-CSF and sRANKL or with GM-CSF and sRANKL for 6 days and then stained with TRAP and DEC205 (NLDC-145) (Serotec, Oxford, England). Immunohistochemical staining of DEC205 was performed as described elsewhere.40 Cells on fibronectin-coated plates were cultured in the presence of GM-CSF and sRANKL for 6 days, and the expression of Mac-1 and CD11c was analyzed as described below.Dendritic cell differentiation in vitro The c-Kit+c-Fms+RANK cells
were cultured in liquid culture containing M-CSF alone; GM-CSF alone;
GM-CSF and sRANKL; M-CSF, sRANKL, and GM-CSF; or in methylcellulose
culture containing M-CSF and sRANKL. After 6 days of
cultivation, cells were collected and incubated with Fc block (1:100)
on ice for 20 minutes. Subsequently, cells were aliquotted for staining
with Mac-1 and CD11c or DEC205. For Mac-1 and CD11c staining, cells
were stained with biotinylated anti-Mac-1 (Pharmingen) for 30 minutes
on ice and washed twice. Cells were then incubated with PE-conjugated
anti-CD11c antibody (Pharmingen) and allophycocyanin-conjugated
streptavidin (Caltag) for 30 minutes on ice and washed twice. For
DEC205 staining, cells were incubated with DEC205 (1:50) for 30 minutes
on ice and washed twice and were then stained with
B-PE-conjugated anti-rat IgG antibody (Jackson ImmunoResearch
Laboratories, West Grove, PA) for 30 minutes on ice. For
isotype-matched controls, biotinylated (Pharmingen) and PE-conjugated
rat IgG2a (Pharmingen) were used. After the final wash, cells were
suspended in washing buffer (5% fetal bovine serum/phosphate-buffered
saline), and the expression of Mac-1 and CD11c or DEC205 was analyzed
by FACS Calibur.
RT-PCR analysis Total RNA was isolated from freshly isolated osteoclast precursor cells (c-Fms+RANK cells) or
cultured cells (Rneasy mini kit, Qiagen, Hilden, Germany). Single-strand complementary DNAs (cDNAs) were synthesized with reverse
transcription (first-strand cDNA synthesis kit, Clontech Laboratories,
Palo Alto, CA). The cDNAs were amplified using the Advantage2 PCR
System (PerkinElmer, Norwalk, CT) in a GeneAmp PCR system model 9700 (PerkinElmer) for 30 cycles. Each cycle consisted of 30 seconds of
denaturation at 94°C and 4 minutes of annealing/extension at 70°C.
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH) was used as an
internal control. Primers used for RT-PCR were as follows: CTR
(calcitonin receptor)-5', 5'-TGGTTGAGGTTGTGCCCAATGGAGA-3'; CTR-3',
5'-CTCGTGGGTTTGCCTCATCTTGGTC-3'; c-Src-5', 5'-TGATGTTATGAAGA ACTGCTCGCACCTG-3'; c-Src-3', 5'-TGCCCATTTGCTGGGTACTTTCTTTCTC-3'; c-Fms-5', 5'-CTGTGAATGGCTCTGATGTCCTGTTCTG-3'; c-Fms-3', 5'-CTCCCACTT CTCATTGTAGGGCAACTGA-3'; c-Fos-5', 5'-ATGATGTTCTCGGGTTTCAACG-3'; c-Fos-3', 5'-CAGTCTGCTGCATAGAAGGAACCG-3'; RANK5',
5'-CTTCGACTGGTT CACTGCTCCTAAT-3'; RANK3',
5'-TTACTGTTTCCAGTCACGTTCCCAGAGG-3'; PU.1-5',
5'-CTGAGAACCACTTCACAGAGCTGCAGAG-3'; PU.1-3', 5'-GCGCCATC
TTCTGGTAGGTCATCTTCTT-3'; Fra-1-5', 5'-GTGCAAGTGGTTCAGCCCAAGAAC TTTT-3'; Fra-1-3', 5'-GGGTCCTTCTTGTCTCCTTCTGGGATTT-3'; GM-CSF R-3',
5'-CACGATGACGTCTATCAGCATCGCTTC-3'; G3PDH-5', 5'-TGAAGGTCGGTGTGA ACGGATTTGGC-3'; G3PDH-3', 5'-CATGTAGGCCATGAGGTCCACCAC-3'.
Preparation of retroviral vectors expressing full-length or truncated forms of c-Fos and Fra-1 Full-length and truncated ( 262) forms of c-Fos and
Fra-1 (full-length and 185) expression retroviral vectors were
generated by ligating the RT-PCR products into the pMY-IRES-GFP
vector provided by Dr T. Kitamura (University of Tokyo, Institute of
Medical Science). The primer sets for RT-PCR are as follows:
c-Fos-5', 5'-GGAATTCATGATGTTCTCGGGTTTCAACG-3'; c-Fos-full-3',
5'-ACGCGTCGACTCACAGGGCCAGCAGCGTGGGTGA-3'; c-Fos- 262-3',
5'-ACGCGTCGACTCACACGTTGCTGATGCTCTCTTGACTGGCT-3';
Fra-1-5', 5'GGAATT CATGTACCGAGACTACGGGGAAC-3';
Fra-1- full-3', ACGCGTCGACTCACAAAGCC AGGAGTGTAGGAGAG-3';
Fra-1- 185-3', 5'-ACGCGTCGACTCAAGAACCACCTGGGTCCTTCTTGT-3'. Single-stranded cDNA was generated from total RNA isolated from cultured osteoclast precursor cells in the presence of M-CSF and sRANKL
for 6 days.
Retroviral vectors were transfected into Phoenix-ecotropic cells by
Lipofectamine Plus (Gibco) in Dulbecco modified essential medium (Gibco) containing 10% fetal bovine serum. The medium was collected after 24 and 48 hours of incubation as a virus solution and
stored at
GM-CSF inhibits osteoclast differentiation We previously showed that osteoclasts differentiate from isolated osteoclast precursor cells (c-Fms+RANK cells)
in the presence of M-CSF and sRANKL in a stromal cell-free culture
system.10 Such osteoclastogenesis is inhibited by GM-CSF in a dose-dependent manner (Figure 1A).
This inhibitory effect can be seen at concentrations of GM-CSF as low
as 0.01 ng/mL. A small number of mononuclear TRAP-positive cells are
observed at 0.01 ng/mL GM-CSF, and the inhibitory effect is completely abolished by addition of a neutralizing antibody against GM-CSF. At 0.1 ng/mL GM-CSF, TRAP-positive cells were not detected and cell clusters
were observed (Figure 1B). Because GM-CSF and RANKL are known to induce
dendritic cell differentiation and clustering,13 these
clusters were interpreted to be dendritic cells (see below). Interestingly, the inhibitory effect of GM-CSF was observed only when
GM-CSF was added on day 0, and inhibition decreased as GM-CSF addition
was delayed (Figure 1C). These results suggest that after the
differentiation signal by M-CSF and RANKL is transduced, cells are no
longer competent to respond to GM-CSF.
The GM-CSF receptor shares a common
Because it was reported that TNF-
RANK and c-Fms are expressed in the presence of GM-CSF We previously reported that RANK expression is induced by M-CSF and subsequent stimulation by RANKL induces osteoclastogenesis.9 Gliniak and Rohrschneider have shown that expression of c-Fms is reduced in the presence of GM-CSF or IL-3.44 Thus, it is likely that GM-CSF suppresses expression of c-Fms or RANK and that subsequently, the effect of M-CSF or RANKL is inhibited. Because inhibition of osteoclastogenesis occurs at early stages of differentiation, we examined expression of c-Fms and RANK by FACS after 24 and 72 hours of cultivation. Expression of c-Fms, however, was observed in cultures with M-CSF and/or GM-CSF (Figure 4A). Because the monoclonal antibody against c-Fms recognizes the ligand binding site, c-Fms expression may be relatively low in the presence of M-CSF due to the occupation of the antibody binding site by M-CSF. Similarly, RANK expression was induced even in the presence of GM-CSF, and the expression was detected in cultures at 24 and 72 hours (Figure 4B). These results were confirmed by RT-PCR analysis (Figure 4C). Our findings indicate that the inhibitory effect of GM-CSF on osteoclastogenesis is not mediated by a blockade in receptor expression. RT-PCR analysis revealed that GM-CSF receptor chain was expressed in freshly isolated osteoclast
precursor cells and was up-regulated in the presence of GM-CSF and/or
M-CSF (Figure 4C). Overall, our results indicate that osteoclast
precursor cells express both c-Fms and GM-CSF receptor chain and
that RANK is induced by both M-CSF and GM-CSF. The expression of c-Fms
and RANK was also observed in the culture with IL-3 (data not
shown).
Down-regulation of c-Fos by GM-CSF is a key event for the inhibition of osteoclastogenesis Osteoclastogenesis was completely inhibited by addition of GM-CSF even though cells expressed both c-Fms and RANK. We therefore asked which transcription factors could be involved in this inhibition. First we investigated the expression of the factors such as PU.1, c-Fos, NF- B1, and NF-B2 by RT-PCR. The
expression of PU.1 and NF-B1 was not altered by addition
of GM-CSF (data not shown); however, the expression of c-Fos was
strongly suppressed (Figure 5A),
suggesting that inhibition of c-Fos expression might be related to
inhibition of osteoclastogenesis.
To rescue suppression of c-Fos, we expressed c-Fos in osteoclast
precursor cells by retroviral expression. Because cell proliferation is
critical for retroviral infection,
c-Kit+c-Fms+RANK We also examined the expression of the closely related transcription
factor Fra-1, because Fra-1 was shown to rescue the osteoclast differentiation defect seen in c-Fos-deficient mice.27
Interestingly, Fra-1 expression was strongly suppressed by GM-CSF;
however, Fra-1 was induced when osteoclast precursors were infected by
c-Fos-full but not by retrovirus expressing c-Fos- To confirm the role of c-Fos in osteoclast differentiation in the
presence of GM-CSF, inducible c-Fos transgenic mice known as Mx-c-fos
mice were used to prepare osteoclast precursor cells (c-Kit+c-Fms+RANK
RT-PCR analysis showed that c-Fos was induced by addition of
IFN-
Analysis of dendritic cell differentiation In the presence of M-CSF, sRANKL, and GM-CSF, osteoclastogenesis was completely inhibited, and cell clusters, which are indicative of dendritic cell activation, were observed (Figure 1B). Because GM-CSF is known to be involved in dendritic cell differentiation,32 it is likely that the cells are committed to a dendritic cell lineage. To test this possibility, we examined the expression of CD11c, which is a marker of dendritic cells,45 and Mac-1, which is expressed on macrophages (Figure 8A). Cells cultured with M-CSF alone or with M-CSF and sRANKL (or LZ-RANKL) for 6 days expressed Mac-1 but not CD11c. However, in the presence of M-CSF, sRANKL, and GM-CSF, CD11c expression was induced together with that of Mac-1, indicating a shift from an osteoclast to a dendritic cell lineage. To confirm a bifurcated differentiation of osteoclast precursors to osteoclasts and dendritic cells, clonal analysis was performed by methylcellulose culture. At first, single colonies derived from osteoclast precursors in the presence of M-CSF or GM-CSF were exposed to M-CSF and sRANKL or GM-CSF and sRANKL on day 6 of culture. After 6 more days, cells were stained with TRAP and DEC205, a marker of mature dendritic cells. Both TRAP- and DEC205-positive cells were seen in cells derived from the same colony, indicating that osteoclast precursors can differentiate into osteoclasts or dendritic cells other than macrophages (data not shown). Next, single-cell sorting of c-Kit+c-Fms+RANK cells was
performed, and sorted cells were cultured in the presence of M-CSF and
sRANKL; GM-CSF and sRANKL; and M-CSF, sRANKL, and GM-CSF. After 6 days
of culture, cells were stained with TRAP and DEC205 to determine the
frequency of osteoclast and dendritic cells. In the 2 experiments, the
frequency of TRAP-positive cells was 58.3% and 39.6%, while
DEC205-positive cells were 54.5% and 33.3%, respectively (Table
1). Judging from high plating efficiency, it was suggested that osteoclasts and dendritic cells develop from the
same precursors. This result was confirmed by the culture with M-CSF,
sRANKL, and GM-CSF. Mixed wells (8.3% and 4.2%) contained both
TRAP-positive and -negative cells, and the other wells contained only
TRAP-negative cells in 32.3% (Table 2).
No well contained only TRAP-positive cells, as observed in the culture
with M-CSF and sRANKL, indicating the differentiation into osteoclasts
was inhibited by GM-CSF. The
c-Kit+c-Fms+RANK cells have
bipotency to respond to both M-CSF and GM-CSF.
Finally, we examined the effect of c-Fos on dendritic cell
differentiation using Mx-c-fos mice. Cells expressing CD11c and Mac-1
were observed in cultures of cells with GM-CSF, and dendritic cell
activation was indicated by reduced expression of Mac-1
(CD11c+Mac-1
Bifurcated differentiation of osteoclasts and dendritic cells Here we present findings supporting a differentiation and lineage determination model between osteoclasts and dendritic cells (Figure 9). We have used a stromal cell-free culture system that allows us to manipulate osteoclast differentiation. M-CSF and sRANKL induce osteoclastogenesis, while GM-CSF and sRANKL induce dendritic cell differentiation from single common precursors (c-Kit+c-Fms+RANK cells). Bone
resorptive multinuclear osteoclasts differentiate from
monocyte/macrophage progenitor cells in the presence of M-CSF and
sRANKL47,48 and are identified as TRAP-positive cells. Because the inhibition of osteoclastogenesis induced by GM-CSF is
observed in all wells, which receive single cells, it is likely that
the differentiation pathway of common precursor cells is influenced by
extrinsic factors. Reduction of c-Fos is critical for inhibition of
osteoclastogenesis by GM-CSF, while expression of c-Fos inhibits
dendritic cell maturation. Therefore, c-Fos is a critical regulator of
both osteoclast and dendritic cell differentiation.
Dendritic cells also differentiate from macrophage precursor
cells,1 and GM-CSF plays an important role in their
differentiation.49 CD11c+/Mac-1 Expression of cytokine receptors in differentiation M-CSF, GM-CSF, and IL-3 are macrophage-inducible cytokines. The RANK and c-Fms receptors are indispensable for osteoclast differentiation, and we have previously reported that pretreatment of precursor cells with M-CSF is required for osteoclastogenesis as well as RANK induction.9 Although it is reported that expression of c-Fms is inhibited in the presence of GM-CSF or IL-3,44 expression of c-Fms, RANK, and GM-CSF receptors was detected in the presence of M-CSF, GM-CSF, or IL-3 in our culture system, suggesting that inhibition of osteoclastogenesis is not due to down-regulation of receptor expression. Common -chain signaling
shared with GM-CSF, IL-3, and IL-5 receptors could be involved in
inhibition of osteoclast differentiation, although in our experiments
osteoclast precursors did not respond to IL-5. This inhibition of
osteoclastogenesis is considered to have species variability because
human GM-CSF did not inhibit human osteoclast differentiation (data
not shown). Because cells in the colonies formed in the presence of
GM-CSF or IL-3 are able to differentiate into multinuclear osteoclasts, when they are transfered to the liquid culture with M-CSF and RANKL the
inhibitory effect of GM-CSF and IL-3 on osteoclastogenesis is
reversible. It has been reported that GM-CSF or IL-3 can rescue the
osteoclastogenesis defect in op/op mice.50 Our
findings indicate that GM-CSF may increase the number of osteoclast
precursor cells rather than directly induce the osteoclast
differentiation. Recently Niida et al reported that VEGFR-1 is
expressed in osteoclasts and VEGF can rescue the osteopetrosis in
op/op mice by substituting in part for M-CSF in
osteoclastogenesis.51
Critical function of c-Fos in the differentiation switch Osteopetrosis due to an osteoclast differentiation failure is a phenotype observed following targeted mutation of several genes, including RANK, RANKL, TRAF6, and the transcription factors PU.1, c-Fos, NF-B1, and
NF-B2.11,12,21-24,30 Among these proteins, we showed that c-Fos expression was specifically suppressed in the
presence of GM-CSF. The c-Fos is a component of the AP-1 family of
transcriptional regulators composed of c-Fos proteins (c-Fos, FosB,
Fra-1, Fra-2) and Jun proteins (c-Jun, JunB, JunD), and c-Fos
transgenic mice exhibit osteosarcoma.52,53 Although c-Fos contains a transactivation domain in its C-terminus, a truncated form
of c-Fos (c-Fos-) lacking the C-terminus effectively rescues the
osteoclastogenesis defect seen in c-Fos-deficient mice.27 However, c-Fos- did not rescue an osteoclastogenesis defect induced by GM-CSF as full length of c-Fos, suggesting that the C-terminal of
c-Fos is required to overcome the effect of GM-CSF. Fra-1 is thought to
be a target of c-Fos,25,26 and overexpression of Fra-1
rescues the osteoclast defect seen in c-Fos-deficient
mice.27 A truncated form of Fra-1 lacking the C-terminus
can also rescue osteoclastogenesis in c-Fos-deficient
mice,27 but osteoclast induction by full-length and
truncated forms of Fra-1 or c-Fos- is less effective compared with
full length of c-Fos. Interestingly, Fra-1 was induced by expression of
full-length c-Fos but not by c-Fos-. Taken together, because
expression of Fra-1 did not rescue the osteoclastogenesis as
full-length c-Fos, the C-terminal of c-Fos is likely to be important
for osteoclast differentiation as well as induction of Fra-1 in the
presence of GM-CSF. In contrast, morphologic changes, such as cell
spreading and loss of clustering, were induced by both the full-length
and truncated forms of c-Fos. Cell aggregation, which is an indicator
of dendritic cell activation,13 was inhibited by both
full-length and truncated c-Fos. Recently, Fra-1 and  FosB transgenic
mice have been shown to exhibit osteosclerosis due to increased bone
formation54,55; however, no bone abnormalities have been
observed in FosB knockout mice56 or in mice expressing c-Jun, JunB, FosB, or Fra-2.52
The effect of c-Fos on osteoclastogenesis was confirmed in experiments with cells derived from the Mx-c-fos mice, in which c-Fos expression was induced in osteoclast precursor cells. Using this system, we demonstrated that suppression of c-Fos is crucial for the inhibition of osteoclastogenesis by GM-CSF at bifurcation of osteoclasts and dendritic cells. Because Fra-1 was induced by c-Fos expression as observed in our retroviral experiments, Fra-1 may cooperate with c-Fos to overcome the GM-CSF effect. In addition to its positive effect on osteoclastogenesis, c-Fos negatively affected dendritic maturation, indicating that c-Fos has a reciprocal effect on the differentiation pathway of common precursors. Our findings indicate that the inhibition of osteoclastogenesis by addition of GM-CSF is not a selection but rather a lineage bifurcation. The expression of CD11c, which is expressed on dendritic cells, was not observed in cells cultured with M-CSF alone or with M-CSF and sRANKL; however, CD11c was induced by addition of GM-CSF in the presence of M-CSF and sRANKL. Also, cell clusters observed in dendritic cells were induced by GM-CSF. These results indicate that differentiation had shifted from an osteoclast to a dendritic lineage. By contrast, early expression of c-Fos or early addition of M-CSF inhibited the maturation of dendritic cells. Taken together, our results indicate that osteoclasts, dendritic cells, and macrophages develop from the same precursor cells and that M-CSF, GM-CSF, and IL-3 antagonize each other in the course of differentiation. Furthermore, early expression of c-Fos is crucial for the differentiation of osteoclasts and the maturation of dendritic cells.
Submitted January 9, 2001; accepted June 14, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Toshio Suda, Dept of Cell Differentiation, Institute of Molecular Embryology and Genetics (IMEG), Kumamoto University, 2-2-1 Honjo, Kumamoto 860-0811, Japan; e-mail: sudato{at}gpo.kumamoto-u.ac.jp.
1.
Akagawa KS, Takasuka N, Nozaki Y, et al.
Generation of CD1+RelB+ dendritic cells and tartrate-resistant acid phosphatase-positive osteoclast-like multinucleated giant cells from human monocytes.
Blood.
1996;88:4029-4039 2. Ash P, Loutit JF, Townsend KM. Osteoclasts derived from haematopoietic stem cells. Nature. 1980;283:669-670[CrossRef][Medline] [Order article via Infotrieve]. 3. Scheven BA, Visser JW, Nijweide PJ. In vitro osteoclast generation from different bone marrow fractions, including a highly enriched haematopoietic stem cell population. Nature. 1986;321:79-81[CrossRef][Medline] [Order article via Infotrieve]. 4. Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature. 1992;360:258-261[CrossRef][Medline] [Order article via Infotrieve]. 5. Reid CD, Stackpoole A, Meager A, Tikerpae J. Interactions of tumor necrosis factor with granulocyte-macrophage colony-stimulating factor and other cytokines in the regulation of dendritic cell growth in vitro from early bipotent CD34+ progenitors in human bone marrow. J Immunol. 1992;149:2681-2688[Abstract]. 6. Yoshida H, Hayashi S, Kunisada T, et al. The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature. 1990;345:442-444[CrossRef][Medline] [Order article via Infotrieve].
7.
Kodama H, Yamasaki A, Nose M, et al.
Congenital osteoclast deficiency in osteopetrotic (op/op) mice is cured by injections of macrophage colony-stimulating factor.
J Exp Med.
1991;173:269-272 8. Tanaka S, Takahashi N, Udagawa N, et al. Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteoclast progenitors. J Clin Invest. 1993;91:257-263.
9.
Arai F, Miyamoto T, Ohneda O, et al.
Commitment and differentiation of osteoclast precursor cells by the sequential expression of c-Fms and receptor activator of nuclear factor kappaB (RANK) receptors.
J Exp Med.
1999;190:1741-1754
10.
Miyamoto T, Arai F, Ohneda O, Takagi K, Anderson DM, Suda T.
An adherent condition is required for formation of multinuclear osteoclasts in the presence of macrophage colony-stimulating factor and receptor activator of nuclear factor kappa B ligand.
Blood.
2000;96:4335-4343 11. Kong YY, Yoshida H, Sarosi I, et al. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature. 1999;397:315-323[CrossRef][Medline] [Order article via Infotrieve].
12.
Dougall WC, Glaccum M, Charrier K, et al.
RANK is essential for osteoclast and lymph node development.
Genes Dev.
1999;13:2412-2424 13. Anderson DM, Maraskovsky E, Billingsley WL, et al. A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature. 1997;390:175-179[CrossRef][Medline] [Order article via Infotrieve].
14.
Lader CS, Flanagan AM.
Prostaglandin E2, interleukin 1alpha, and tumor necrosis factor-alpha increase human osteoclast formation and bone resorption in vitro.
Endocrinology.
1998;139:3157-3164
15.
Jimi E, Akiyama S, Tsurukai T, et al.
Osteoclast differentiation factor acts as a multifunctional regulator in murine osteoclast differentiation and function.
J Immunol.
1999;163:434-442
16.
Azuma Y, Kaji K, Katogi R, Takeshita S, Kudo A.
Tumor necrosis factor-alpha induces differentiation of and bone resorption by osteoclasts.
J Biol Chem.
2000;275:4858-4864
17.
Kobayashi K, Takahashi N, Jimi E, et al.
Tumor necrosis factor alpha stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction.
J Exp Med.
2000;191:275-286 18. Takahashi N, Mundy GR, Roodman GD. Recombinant human interferon-gamma inhibits formation of human osteoclast-like cells. J Immunol. 1986;137:3544-3549[Abstract].
19.
Udagawa N, Horwood NJ, Elliott J, et al.
Interleukin-18 (interferon-gamma-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colony-stimulating factor and not via interferon-gamma to inhibit osteoclast formation.
J Exp Med.
1997;185:1005-1012 20. Horwood NJ, Udagawa N, Elliott J, et al. Interleukin 18 inhibits osteoclast formation via T cell production of granulocyte macrophage colony-stimulating factor. J Clin Invest. 1998;101:595-603[Medline] [Order article via Infotrieve]. 21. Tondravi MM, McKercher SR, Anderson K, et al. Osteopetrosis in mice lacking haematopoietic transcription factor PU.1. Nature. 1997;386:81-84[CrossRef][Medline] [Order article via Infotrieve]. 22. Wang ZQ, Ovitt C, Grigoriadis AE, Mohle-Steinlein U, Ruther U, Wagner EF. Bone and haematopoietic defects in mice lacking c-fos. Nature. 1992;360:741-745[CrossRef][Medline] [Order article via Infotrieve].
23.
Grigoriadis AE, Wang ZQ, Cecchini MG, et al.
c-Fos: a key regulator of osteoclast-macrophage lineage determination and bone remodeling.
Science.
1994;266:443-448
24.
Iotsova V, Caamano J, Loy J, Yang Y, Lewin A, Bravo R.
Osteopetrosis in mice lacking NF- 25. Bergers G, Graninger P, Braselmann S, Wrighton C, Busslinger M. Transcriptional activation of the fra-1 gene by AP-1 is mediated by regulatory sequences in the first intron. Mol Cell Biol. 1995;15:3748-3758[Abstract]. 26. Schreiber M, Poirier C, Franchi A, et al. Structure and chromosomal assignment of the mouse fra-1 gene, and its exclusion as a candidate gene for oc (osteosclerosis). Oncogene. 1997;15:1171-1178[CrossRef][Medline] [Order article via Infotrieve]. 27. Matsuo K, Owens JM, Tonko M, Elliott C, Chambers TJ, Wagner EF. Fosl1 is a transcriptional target of c-Fos during osteoclast differentiation. Nat Genet. 2000;24:184-187[CrossRef][Medline] [Order article via Infotrieve].
28.
Darnay BG, Haridas V, Ni J, Moore PA, Aggarwal BB.
Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK): interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase.
J Biol Chem.
1998;273:20551-20555 29. Cao Z, Xiong J, Takeuchi M, Kurama T, Goeddel DV. TRAF6 is a signal transducer for interleukin-1. Nature. 1996;383:443-446[CrossRef][Medline] [Order article via Infotrieve].
30.
Lomaga MA, Yeh WC, Sarosi I, et al.
TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling.
Genes Dev.
1999;13:1015-1024
31.
Zhang Y, Mukaida N, Wang J, Harada A, Akiyama M, Matsushima K.
Induction of dendritic cell differentiation by granulocyte-macrophage colony-stimulating factor, stem cell factor, and tumor necrosis factor alpha in vitro from lineage phenotypes-negative c-kit+ murine hematopoietic progenitor cells.
Blood.
1997;90:4842-4853
32.
Witmer-Pack MD, Olivier W, Valinsky J, Schuler G, Steinman RM.
Granulocyte/macrophage colony-stimulating factor is essential for the viability and function of cultured murine epidermal Langerhans cells.
J Exp Med.
1987;166:1484-1498
33.
Maraskovsky E, Brasel K, Teepe M, et al.
Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified.
J Exp Med.
1996;184:1953-1962
34.
Sallusto F, Lanzavecchia A.
Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.
J Exp Med.
1994;179:1109-1118 35. Burkly L, Hession C, Ogata L, et al. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature. 1995;373:531-536[CrossRef][Medline] [Order article via Infotrieve].
36.
Guerriero A, Langmuir PB, Spain LM, Scott EW.
PU.1 is required for myeloid-derived but not lymphoid-derived dendritic cells.
Blood.
2000;95:879-885 37. Wu L, Nichogiannopoulou A, Shortman K, Georgopoulos K. Cell-autonomous defects in dendritic cell populations of Ikaros mutant mice point to a developmental relationship with the lymphoid lineage. Immunity. 1997;7:483-492[CrossRef][Medline] [Order article via Infotrieve].
38.
Inada K, Okada S, Phuchareon J, et al.
c-Fos induces apoptosis in germinal center B cells.
J Immunol.
1998;161:3853-3861
39.
Okada S, Fukuda T, Inada K, Tokuhisa T.
Prolonged expression of c-fos suppresses cell cycle entry of dormant hematopoietic stem cells.
Blood.
1999;93:816-825 40. Takakura N, Huang XL, Naruse T, et al. Critical role of the TIE2 endothelial cell receptor in the development of definitive hematopoiesis. Immunity. 1998;9:677-686[CrossRef][Medline] [Order article via Infotrieve]. 41. Miyajima A. Molecular structure of the IL-3, GM-CSF and IL-5 receptors. Int J Cell Cloning. 1992;10:126-134[Medline] [Order article via Infotrieve]. 42. Lam J, Takeshita S, Barker JE, Kanagawa O, Ross FP, Teitelbaum SL. TNF-alpha induces osteoclastogenesis by direct stimulation of macrophages exposed to permissive levels of RANK ligand. J Clin Invest. 2000;106:1481-1488[Medline] [Order article via Infotrieve].
43.
Zhang YH, Heulsmann A, Tondravi MM, Mukherjee A, Abu-Amer Y.
Tumor necrosis factor-alpha (TNF) stimulates RANKL-induced osteoclastogenesis via coupling of TNF type 1 receptor and RANK signaling pathways.
J Biol Chem.
2001;276:563-568 44. Gliniak BC, Rohrschneider LR. Expression of the M-CSF receptor is controlled posttranscriptionally by the dominant actions of GM-CSF or multi-CSF. Cell. 1990;63:1073-1083[CrossRef][Medline] [Order article via Infotrieve].
45.
Metlay JP, Witmer-Pack MD, Agger R, Crowley MT, Lawless D, Steinman RM.
The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies.
J Exp Med.
1990;171:1753-1771
46.
Zhang Y, Harada A, Wang JB, et al.
Bifurcated dendritic cell differentiation in vitro from murine lineage phenotype-negative c-kit+ bone marrow hematopoietic progenitor cells.
Blood.
1998;92:118-128
47.
Yasuda H, Shima N, Nakagawa N, et al.
Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL.
Proc Natl Acad Sci U S A.
1998;95:3597-3602 48. Lacey DL, Timms E, Tan HL, et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell. 1998;93:165-176[CrossRef][Medline] [Order article via Infotrieve].
49.
Inaba K, Inaba M, Romani N, et al.
Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor.
J Exp Med.
1992;176:1693-1702
50.
Myint YY, Miyakawa K, Naito M, et al.
Granulocyte/macrophage colony-stimulating factor and interleukin-3 correct osteopetrosis in mice with osteopetrosis mutation.
Am J Pathol.
1999;154:553-566
51.
Niida S, Kaku M, Amano H, et al.
Vascular endothelial growth factor can substitute for macrophage colony-stimulating factor in the support of osteoclastic bone resorption.
J Exp Med.
1999;190:293-298
52.
Grigoriadis AE, Schellander K, Wang ZQ, Wagner EF.
Osteoblasts are target cells for transformation in c-fos transgenic mice.
J Cell Biol.
1993;122:685-701
53.
Wang ZQ, Liang J, Schellander K, Wagner EF, Grigoriadis AE.
c-fos-induced osteosarcoma formation in transgenic mice: cooperativity with c-jun and the role of endogenous c-fos.
Cancer Res.
1995;55:6244-6251 54. Jochum W, David JP, Elliott C, et al. Increased bone formation and osteosclerosis in mice overexpressing the transcription factor Fra-1. Nat Med. 2000;6:980-984[CrossRef][Medline] [Order article via Infotrieve]. 55. Sabatakos G, Sims NA, Chen J, et al. Overexpression of DeltaFosB transcription factor(s) increases bone formation and inhibits adipogenesis. Nat Med. 2000;6:985-990[CrossRef][Medline] [Order article via Infotrieve]. 56. Gruda MC, van Amsterdam J, Rizzo CA, Durham SK, Lira S, Bravo R. Expression of FosB during mouse development: normal development of FosB knockout mice. Oncogene. 1996;12:2177-2185[Medline] [Order article via Infotrieve].
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. Hiasa, M. Abe, A. Nakano, A. Oda, H. Amou, S. Kido, K. Takeuchi, K. Kagawa, K. Yata, T. Hashimoto, et al. GM-CSF and IL-4 induce dendritic cell differentiation and disrupt osteoclastogenesis through M-CSF receptor shedding by up-regulation of TNF-{alpha} converting enzyme (TACE) Blood, November 12, 2009; 114(20): 4517 - 4526. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Apostolakis, G. Y.H. Lip, and E. Shantsila Monocytes in heart failure: relationship to a deteriorating immune overreaction or a desperate attempt for tissue repair? Cardiovasc Res, October 28, 2009; (2009) cvp327v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Lee, H. S. Kim, J.-T. Yeon, S.-W. Choi, C. H. Chun, H. B. Kwak, and J. Oh GM-CSF Regulates Fusion of Mononuclear Osteoclasts into Bone-Resorbing Osteoclasts by Activating the Ras/ERK Pathway J. Immunol., September 1, 2009; 183(5): 3390 - 3399. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, M. Alnaeeli, B. Singh, and Y.-T. A. Teng Involvement of SOCS3 in Regulation of CD11c+ Dendritic Cell-Derived Osteoclastogenesis and Severe Alveolar Bone Loss Infect. Immun., May 1, 2009; 77(5): 2000 - 2009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Yogesha, S. M. Khapli, R. K. Srivastava, L. S. Mangashetti, S. T. Pote, G. C. Mishra, and M. R. Wani IL-3 Inhibits TNF-{alpha}-Induced Bone Resorption and Prevents Inflammatory Arthritis J. Immunol., January 1, 2009; 182(1): 361 - 370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Wakkach, A. Mansour, R. Dacquin, E. Coste, P. Jurdic, G. F. Carle, and C. Blin-Wakkach Bone marrow microenvironment controls the in vivo differentiation of murine dendritic cells into osteoclasts Blood, December 15, 2008; 112(13): 5074 - 5083. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Miyamoto, T. Miyamoto, R. Kato, A. Yoshimura, N. Motoyama, and T. Suda FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging Blood, December 1, 2008; 112(12): 4485 - 4493. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Sawatani, T. Miyamoto, S. Nagai, M. Maruya, J. Imai, K. Miyamoto, N. Fujita, K. Ninomiya, T. Suzuki, R. Iwasaki, et al. The role of DC-STAMP in maintenance of immune tolerance through regulation of dendritic cell function Int. Immunol., October 1, 2008; 20(10): 1259 - 1268. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Lorenzo, M. Horowitz, and Y. Choi Osteoimmunology: Interactions of the Bone and Immune System Endocr. Rev., June 1, 2008; 29(4): 403 - 440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ha, J.-H. Lee, H.-N. Kim, H. B. Kwak, H.-M. Kim, S. E. Lee, J. H. Rhee, H.-H. Kim, and Z. H. Lee Stimulation by TLR5 Modulates Osteoclast Differentiation through STAT1/IFN-{beta} J. Immunol., February 1, 2008; 180(3): 1382 - 1389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Moreno, I. Mikhailenko, M. M. Tondravi, and A. D. Keegan IL-4 promotes the formation of multinucleated giant cells from macrophage precursors by a STAT6-dependent, homotypic mechanism: contribution of E-cadherin J. Leukoc. Biol., December 1, 2007; 82(6): 1542 - 1553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Niki, H. Takaishi, J. Takito, T. Miyamoto, N. Kosaki, H. Matsumoto, Y. Toyama, and N. Tada Administration of Cyclooxygenase-2 Inhibitor Reduces Joint Inflammation but Exacerbates Osteopenia in IL-1{alpha} Transgenic Mice Due to GM-CSF Overproduction J. Immunol., July 1, 2007; 179(1): 639 - 646. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Hinoi, T. Takarada, K. Uno, M. Inoue, Y. Murafuji, and Y. Yoneda Glutamate Suppresses Osteoclastogenesis through the Cystine/Glutamate Antiporter Am. J. Pathol., April 1, 2007; 170(4): 1277 - 1290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mochizuki, M. Takami, T. Kawawa, R. Suzumoto, T. Sasaki, A. Shiba, H. Tsukasaki, B. Zhao, R. Yasuhara, T. Suzawa, et al. Identification and Characterization of the Precursors Committed to Osteoclasts Induced by TNF-Related Activation-Induced Cytokine/Receptor Activator of NF-{kappa}B Ligand J. Immunol., October 1, 2006; 177(7): 4360 - 4368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Maruyama, Y. Takada, N. Ray, Y. Kishimoto, J. M. Penninger, H. Yasuda, and K. Matsuo Receptor Activator of NF-{kappa}B Ligand and Osteoprotegerin Regulate Proinflammatory Cytokine Production in Mice J. Immunol., September 15, 2006; 177(6): 3799 - 3805. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Alnaeeli, J. M. Penninger, and Y.-T. A. Teng Immune Interactions with CD4+ T Cells Promote the Development of Functional Osteoclasts from Murine CD11c+ Dendritic Cells. J. Immunol., September 1, 2006; 177(5): 3314 - 3326. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Fujimura, H. Hotokezaka, N. Ohara, M. Naito, E. Sakai, M. Yoshimura, Y. Narita, H. Kitaura, N. Yoshida, and K. Nakayama The Hemoglobin Receptor Protein of Porphyromonas gingivalis Inhibits Receptor Activator NF-{kappa}B Ligand-Induced Osteoclastogenesis from Bone Marrow Macrophages. Infect. Immun., May 1, 2006; 74(5): 2544 - 2551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Frasca, E. Van der Put, A. M. Landin, D. Gong, R. L. Riley, and B. B. Blomberg RNA Stability of the E2A-Encoded Transcription Factor E47 Is Lower in Splenic Activated B Cells from Aged Mice J. Immunol., November 15, 2005; 175(10): 6633 - 6644. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Yagi, T. Miyamoto, Y. Sawatani, K. Iwamoto, N. Hosogane, N. Fujita, K. Morita, K. Ninomiya, T. Suzuki, K. Miyamoto, et al. DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells J. Exp. Med., August 1, 2005; 202(3): 345 - 351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Morisada, Y. Oike, Y. Yamada, T. Urano, M. Akao, Y. Kubota, H. Maekawa, Y. Kimura, M. Ohmura, T. Miyamoto, et al. Angiopoietin-1 promotes LYVE-1-positive lymphatic vessel formation Blood, June 15, 2005; 105(12): 4649 - 4656. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Kim, C. J. Day, and N. A. Morrison MCP-1 Is Induced by Receptor Activator of Nuclear Factor-{kappa}B Ligand, Promotes Human Osteoclast Fusion, and Rescues Granulocyte Macrophage Colony-stimulating Factor Suppression of Osteoclast Formation J. Biol. Chem., April 22, 2005; 280(16): 16163 - 16169. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Yogesha, S. M. Khapli, and M. R. Wani Interleukin-3 and Granulocyte-Macrophage Colony-stimulating Factor Inhibits Tumor Necrosis Factor (TNF)-{alpha}-induced Osteoclast Differentiation by Down-regulation of Expression of TNF Receptors 1 and 2 J. Biol. Chem., March 25, 2005; 280(12): 11759 - 11769. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zayzafoon, K. Fulzele, and J. M. McDonald Calmodulin and Calmodulin-dependent Kinase II{alpha} Regulate Osteoblast Differentiation by Controlling c-fos Expression J. Biol. Chem., February 25, 2005; 280(8): 7049 - 7059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Rivollier, M. Mazzorana, J. Tebib, M. Piperno, T. Aitsiselmi, C. Rabourdin-Combe, P. Jurdic, and C. Servet-Delprat Immature dendritic cell transdifferentiation into osteoclasts: a novel pathway sustained by the rheumatoid arthritis microenvironment Blood, December 15, 2004; 104(13): 4029 - 4037. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Suzuki, K. Honma, T. Matsuyama, K. Suzuki, K. Toriyama, I. Akitoyo, K. Yamamoto, T. Suematsu, M. Nakamura, K. Yui, et al. From the Cover: Critical roles of interferon regulatory factor 4 in CD11bhighCD8{alpha}- dendritic cell development PNAS, June 15, 2004; 101(24): 8981 - 8986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.Y.Y. Tay, B.H. Bay, J.F Yeo, M. Harris, S. Meghji, and S.T. Dheen Identification of RANKL in Osteolytic Lesions of the Facial Skeleton Journal of Dental Research, April 1, 2004; 83(4): 349 - 353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. O'Gradaigh and J. E. Compston T-cell involvement in osteoclast biology: implications for rheumatoid bone erosion Rheumatology, February 1, 2004; 43(2): 122 - 130. [Full Text] [PDF]
|
|
|
|
|
|
M. Kuwana, Y. Okazaki, H. Kodama, K. Izumi, H. Yasuoka, Y. Ogawa, Y. Kawakami, and Y. Ikeda Human circulating CD14+ monocytes as a source of progenitors that exhibit mesenchymal cell differentiation J. Leukoc. Biol., November 1, 2003; 74(5): 833 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Moreno, M. Kaczmarek, A. D. Keegan, and M. Tondravi IL-4 suppresses osteoclast development and mature osteoclast function by a STAT6-dependent mechanism: irreversible inhibition of the differentiation program activated by RANKL Blood, August 1, 2003; 102(3): 1078 - 1086. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Khapli, L. S. Mangashetti, S. D. Yogesha, and M. R. Wani IL-3 Acts Directly on Osteoclast Precursors and Irreversibly Inhibits Receptor Activator of NF-{kappa}B Ligand-Induced Osteoclast Differentiation by Diverting the Cells to Macrophage Lineage J. Immunol., July 1, 2003; 171(1): 142 - 151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yamada, H. Yamazaki, T. Yamane, M. Yoshino, H. Okuyama, M. Tsuneto, T. Kurino, S.-I. Hayashi, and S. Sakano Regulation of osteoclast development by Notch signaling directed to osteoclast precursors and through stromal cells Blood, March 15, 2003; 101(6): 2227 - 2234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Schoppet, A. M. Sattler, J. R. Schaefer, M. Herzum, B. Maisch, and L. C. Hofbauer Increased Osteoprotegerin Serum Levels in Men with Coronary Artery Disease J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1024 - 1028. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. Hume, I. L. Ross, S. R. Himes, R. T. Sasmono, C. A. Wells, and T. Ravasi The mononuclear phagocyte system revisited J. Leukoc. Biol., October 1, 2002; 72(4): 621 - 627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Takami, N. Kim, J. Rho, and Y. Choi Stimulation by Toll-Like Receptors Inhibits Osteoclast Differentiation J. Immunol., August 1, 2002; 169(3): 1516 - 1523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hayashi, T. Kaneda, Y. Toyama, M. Kumegawa, and Y. Hakeda Regulation of Receptor Activator of NF-kappa B Ligand-induced Osteoclastogenesis by Endogenous Interferon-beta (INF-beta ) and Suppressors of Cytokine Signaling (SOCS). THE POSSIBLE COUNTERACTING ROLE OF SOCSs IN IFN-beta -INHIBITED OSTEOCLAST FORMATION J. Biol. Chem., July 26, 2002; 277(31): 27880 - 27886. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
(IFN-
80°C. For infection of osteoclast precursor cells, retronectin-coated plates (Takara, Otsu, Japan) were used. A total of
1000 sorted c-Kit+c-Fms+RANK
) or Mx-c-fos mice (
) were
cultured in the presence of 100 ng/mL M-CSF and 25 ng/mL sRANKL with
(200 or 1000 U/mL) or without IFN-
