SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Samorapoompichit, P. Articles by Valent, P. Search for Related Content PubMed PubMed Citation Articles by Samorapoompichit, P. Articles by Valent, P. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 15 October 2001, Vol. 98, No. 8, pp. 2580-2583 BRIEF REPORT Detection of tryptase in cytoplasmic granules of basophils in patients with chronic myeloid leukemia and other myeloid neoplasms Puchit Samorapoompichit, Hans P. Kiener, Gerit-Holger Schernthaner, John-Hendrik Jordan, Hermine Agis, Friedrich Wimazal, Mehrdad Baghestanian, Abdolreza Rezaie-Majd, Wolfgang R. Sperr, Klaus Lechner, and Peter Valent From the Institute of Histology and Embryology, Department of Internal Medicine I, Division of Hematology and Hemostaseology, Department of Internal Medicine III, Division of Rheumatology, and Department of Internal Medicine II, Division of Angiology, University of Vienna, Vienna, Austria.     Abstract Top Abstract Introduction Study design Results and discussion References Tryptases are serine proteases primarily expressed in mast cells. Normal blood basophils express only trace amounts of the enzyme. However, recent immunohistochemical studies have raised the possibility that neoplastic basophils express significant amounts of tryptase. In this study, tryptase expression was analyzed in normal and neoplastic basophils by immunoelectron microscopy using antitryptase monoclonal antibody G3. Basophils were obtained from patients with chronic myeloid leukemia (CML), idiopathic myelofibrosis (IMF), and myelodysplastic syndrome (MDS), and from healthy donors. Tryptase-immunoreactive material was detected in cytoplasmic granules of basophils in CML, IMF, and MDS. By contrast, normal basophils did not contain significant amounts of tryptase by immunoelectron microscopy. As assessed by reverse transcription-polymerase chain reaction, neoplastic basophils contained messenger RNA (mRNA) for -tryptase, but no -tryptase mRNA. In summary, these data provide evidence that neoplastic basophils in CML, IMF, and MDS can express detectable amounts of tryptase. Therefore, tryptase should not be regarded as specific for mast cells when neoplastic myeloid cells are analyzed. (Blood. 2001;98:2580-2583) © 2001 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References Basophils and mast cells (MCs) are effector cells of allergic reactions.1-3 They express high-affinity IgE-binding sites and various granular mediators.2,4,5 Both cells derive from CD34+ hemopoietic progenitor cells.1,2,6 However, basophils differ from MCs in their ultrastructure, expression of surface antigens, and response to growth factors.7-10 Likewise, interleukin-3 (IL-3) is a potent differentiation factor for human basophils but not for human MCs.9,10 MCs, in turn, grow from CD34+ cells in response to stem cell factor (SCF).11,12 Tryptases are serine proteases specifically expressed in MCs.13,14 Two major subtypes, - and -tryptases, have been identified and cloned.15,16 MCs contain both types of the enzyme. Other hemopoietic cells do not express significant amounts of tryptases; in fact, only trace amounts are detectable in normal blood basophils, and other myeloid cells appear to be tryptase-negative.14 Recently, however, significant amounts of tryptases were detected in immature basophillike cell lines.17,18 Moreover, it was found that in patients with chronic myeloid leukemia (CML), immature granulated cells with characteristics of basophils react with antibodies against tryptase.19 However, it could not be clarified whether these cells are indeed basophils, belong to the MC lineage, or would represent an "intermediate cell."     Study design Top Abstract Introduction Study design Results and discussion References Isolation and culture of cells Peripheral blood (PB) was obtained from 12 healthy volunteers, 6 patients with CML (chronic phase), 3 patients with myelodysplastic syndrome (MDS; 1 with refractory anemia with ring sideroblasts [RARS], and 2 with refractory anemia with excess blasts [RAEB]), and 8 patients with idiopathic myelofibrosis (IMF). All patients gave informed consent. Mononuclear cells (MNCs) were isolated using Ficoll. The percentage of basophils in PB-MNCs was 1% to 7% in controls, 2.7% to 30% in CML, 2% to 27% in MDS, and 0.5% to 23% in IMF samples. Cord blood (CB) was obtained from 2 full-term deliveries after informed consent was given by the mothers. CB-MNCs were enriched for CD34+ cells using monoclonal antibody QBEND/10 and magnetic beads. CD34+ cells were cultured in RPMI-1640 medium with 10% fetal calf serum (FCS), and either recombinant human stem cell factor (rhSCF; 100 ng/mL) or rhIL-3 (100 U/mL) (Promocell, Heidelberg, Germany) at 37°C for 28 days. Levels of total tryptase (-tryptase + -protryptase) were measured in cell lysates by a commercial fluoroimmunoenzyme assay23 (FIA; Pharmacia, Uppsala, Sweden). Tryptase levels per basophil were calculated from total cell numbers and percentage counts. Electron microscopy and immunoelectron microscopy Electron microscopy and immunoelectron microscopy were performed as reported20-22 using PB-MNCs (CML, n = 2; RAEB, n = 1; IMF, n = 1; controls, n = 3) and CD34+ CB-MNCs (on day 0 and after culture in IL-3 or SCF). Cells were fixed in 2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4). Then, cells were washed, resuspended in 2% agar, and centrifuged. Pellets were postfixed in 1.3% OsO4, stained en bloc with 2% uranyl acetate in sodium maleate buffer (pH 4.4), dehydrated, and embedded in EPON 812. Ultrathin sections were cut and placed on gold grids. Postembedding immunogold labeling was performed on osmium-fixed, epoxy resin-embedded sections as described previously22 using antitryptase monoclonal antibody G3 (Chemicon, Temecula, CA). After incubation with G3 (4 hours), grids were washed and incubated with goat antimouse antibody conjugated with 10 nM gold particles. Sections were contrasted in uranyl acetate and lead citrate. Reverse transcription-polymerase chain reaction Total RNA was extracted from PB-MNCs (CML, n = 2; IMF, n = 1) and reverse-transcribed into complementary DNA (cDNA) as described.24 The cDNA aliquots (6 µL) were used for polymerase chain reaction (PCR) amplification in 50 µL volume containing PCR buffer, 1.25 U Taq polymerase, 25 µM of upstream and downstream primers (MWG Biotech, Ebersberg, Germany) specific for tryptase (5' primer: 5' GAGGCCCCCAGGAGCAAGTG 3'; 3' primer: 5' ACATCGCCCCAGCCAGTGAC 3') or -actin. Primers were selected to be complementary to identical regions in - and -tryptase cDNAs and to display restriction site differences (only -tryptase-specific PCR products contained a DraIII restriction site). Samples were amplified in 32 cycles at 94°C (1 minute), annealing for 1 minute (63°C), and extension at 72°C (1 minute) after initial denaturation (95°C, 2 minutes). PCR products were subjected to restriction fragment length polymorphism using endonuclease DraIII (Boehringer Mannheim, Mannheim, Germany).     Results and discussion Top Abstract Introduction Study design Results and discussion References Detection of tryptase in neoplastic basophils Basophils from 2 patients with CML, 1 with IMF, and 1 with MDS were examined by electron microscopy. In all samples, basophils were easily identified as round cells containing cytoplasmic granules including so-called particulate granules. In immature basophils nuclei appeared to be round or bilobed. Mature basophils showed segmented nuclei. As assessed by immunoelectron microscopy, a proportion of neoplastic basophils (10%-50%) contained tryptase in their cytoplasmic granules (Figure 1). However, not all granules in a given cell appeared to be labeled. Also, the intensity of labeling in basophils varied from donor to donor. In basophils from healthy donors (n = 3) granules appeared to be tryptase negative. View larger version (109K): [in this window] [in a new window]   Figure 1. Tryptase immunoelectron microscopy. (A) Blood basophil from a patient with chronic phase CML. Tryptase-immunoreactive material is localized to a subset of granules (arrows; original magnification × 5000; inset, × 10 000). (B) Basophil of a healthy donor shows no tryptase expression by immunoelectron microscopy (original magnification × 6500; inset × 13 000). (C) Tryptase immunoelectron microscopy of a CB culture-derived basophil (IL-3, day 13); no significant amounts of tryptase could be detected (original magnification × 4000). (D) Tryptase immunoelectron microscopy of a CB culture-derived MC (SCF, day 28). In this cell tryptase-reactive material could be detected. Note surface projections and granular staining pattern (original magnification × 12 500). 1 bar = 1 µm. Evaluation of tryptase expression in cultured cells As assessed by immunoelectron microscopy, isolated CD34+ CB-MNCs (blasts, day 0) were tryptase negative. At all times investigated (days 13, 21, 28), SCF-cultured MCs expressed tryptase in their granules, whereas cultured basophils (day 13) did not contain significant amounts of tryptase (Figure 1). Measurement of cellular tryptase As assessed by FIA, the levels of total tryptase (-tryptase + -protryptase) in basophils (pg/cell) were significantly higher in CML (median: 0.09 pg/cell; mean ± SD = 0.11 ± 0.09) compared with healthy controls (median: 0.03; mean ± SD = 0.03 ± 0.02; P < .05). A higher median tryptase level in basophils was also recorded in MDS, but not in IMF (Table 1).                                View this table: [in this window] [in a new window]   Table 1. Patient characteristics and results Tryptase messenger RNA expression A PCR product of 383 base pairs was generated from cDNA obtained from PB-MNCs of patients with CML (n = 2) and IMF (n = 1). Restriction enzyme digestion (DraIII) resulted in partial degradation of PCR products in a mast cell line (HMC-1) indicating expression of both - and -tryptase messenger RNA (mRNA). By contrast, no digestion occurred with the patients' PCR products, suggesting that basophils contained only -tryptase mRNA, but not -tryptase mRNA. Interpretation of data Recent observations have raised the possibility that in contrast to normal basophils, immature neoplastic basophils can express significant amounts of tryptase.17-19 Notably, in patients with CML, immature "basophillike" cells were found to react with antitryptase monoclonal antibody.19 However, it could not be clarified whether the labeled cells were indeed basophils or MC-lineage cells. Our immunoelectron microscopy experiments clearly show that tryptase is expressed in the granule compartment of basophils in patients with CML, MDS, and IMF. By contrast, no significant amounts of tryptase were detected in normal basophils. Interestingly, the so-called particulate granules contained tryptase-immunoreactive material. This granule type is a typical ultrastructural feature of basophils.2,3,7 However, there was a significant variability in expression of granular tryptase when basophils from different donors were compared. These observations suggest that tryptase production, release, or degradation in basophils varies among donors. Two types of tryptases,  and  types, have been identified and cloned.15,16 In the present study, the  type of tryptase was found to be the predominant type expressed in neoplastic basophils at the mRNA level. The abnormal expression of -tryptase gene products in basophils in myeloid malignancies may have several explanations. One could be that the transformation of myeloid progenitors is associated with increased enzyme production. The possibility that tryptase is selectively expressed at a certain (immature) stage of basophil maturation seems unlikely; in fact, cultured immature basophils did not express substantial amounts of tryptase. So far, tryptase has been widely used as a specific marker to identify MCs in patients with mastocytosis and other hematologic disorders.25 The results of our study suggest that in various myeloid neoplasms, tryptase may also be detectable in basophils. Therefore, tryptase should not be regarded as MC specific in such patients. Whether basophil tryptase can be used as a marker to monitor patients with CML or other myeloid neoplasms is currently under investigation.     Footnotes Submitted January, 2001; accepted June 25, 2001. Supported by Fonds zur Förderung der Wissenschaftlichen Forschung in Österreich-FWF, grant P-12517 and grant P-14031. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Peter Valent, Department of Internal Medicine I, Division of Hematology and Hemostaseology, Währinger Gürtel 18-20, A-1090 Vienna, Austria; e-mail: peter.valent{at}akh-wien.ac.at.     References Top Abstract Introduction Study design Results and discussion References 1. Galli SJ. Biology of disease: new insights into "the riddle of the mast cells": microenvironmental regulation of mast cell development and phenotypic heterogeneity. Lab Invest. 1990;62:5-33[Medline] [Order article via Infotrieve]. 2. Dvorak AM. Cell biology of the basophil. Int Rev Cytol. 1998;180:87-236[Medline] [Order article via Infotrieve]. 3. Dvorak AM, Galli SJ, Schulman ES, Lichtenstein LM, Dvorak HF. Basophil and mast cell degranulation: ultrastructural analysis of mechanisms of mediator release. Fed Proc. 1983;42:2510-2515[Medline] [Order article via Infotrieve]. 4. Ishizaka T, Ishizaka K. Activation of mast cells for mediator release through IgE receptors. Prog Allergy. 1984;34:188-235[Medline] [Order article via Infotrieve]. 5. Schwartz LB. The mast cell. In: Kaplan AP, ed. Allergy. Vol 1. Edinburgh, UK: Churchill Livingston; 1985:53-92. 6. Kirshenbaum AS, Kessler SW, Goff JP, Metcalfe DD. Demonstration of the origin of human mast cells from CD34+ bone marrow progenitor cells. J Immunol. 1991;146:1410-1415[Abstract]. 7. Dvorak AM, Dvorak HF, Galli SJ. Ultrastructural criteria for identification of mast cells and basophils in humans, guinea pigs, and mice. Am J Respir Dis Suppl. 1983a;128:49-53. 8. Valent P, Bettelheim P. Cell surface structures on human basophils and mast cells: biochemical and functional characterization. Adv Immunol. 1992;52:333-423[Medline] [Order article via Infotrieve]. 9. Saito H, Hatake K, Dvorak AM, et al. Selective differentiation and proliferation of hematopoietic cells induced by recombinant human interleukins. Proc Natl Acad Sci U S A. 1988;85:2288-2292[Abstract/Free Full Text]. 10. Valent P, Schmidt G, Besemer J, et al. Interleukin-3 is a differentiation factor for human basophils. Blood. 1989;73:1763-1769[Abstract/Free Full Text]. 11. Valent P, Spanblöchl E, Sperr WR, et al. Induction of differentiation of human mast cells from bone marrow and peripheral blood mononuclear cells by recombinant human stem cell factor (SCF)/kit ligand (KL) in long term culture. Blood. 1992;80:2237-2245[Abstract/Free Full Text]. 12. Dvorak AM, Mitsui H, Ishizaka T. Human and murine recombinant c-kit ligands support the development of human mast cells from umbilical cord blood cells: ultrastructural identification. Int Arch Allergy Immunol. 1993;101:247-253[Medline] [Order article via Infotrieve]. 13. Irani AA, Schechter NM, Craig SS, Deblois G, Schwartz LB. Two types of human mast cells that have distinct neutral protease compositions. Proc Natl Acad Sci U S A. 1986;83:4064-4068. 14. Castells MC, Irani AM, Schwartz LB. Evaluation of human peripheral blood leukocytes for mast cell tryptase. J Immunol. 1986;138:2184-2189[Abstract]. 15. Miller JS, Westin EH, Schwartz LB. Cloning and characterization of complementary DNA for human tryptase. J Clin Invest. 1989;84:1188-1195. 16. Miller JS, Moxley G, Schwartz LB. Cloning and characterization of a second complementary DNA for human tryptase. J Clin Invest. 1990;86:864-870. 17. Blom T, Hellman L. Characterization of a tryptase mRNA expressed in the human basophils cell line KU812. Scand J Immunol. 1993;37:203-208[CrossRef][Medline] [Order article via Infotrieve]. 18. Blom T, Nilsson G, Sundström C, Nilsson K, Hellman L. Characterization of a human basophil-like cell line (LAMA-84). Scand J Immunol. 1996;44:54-61[CrossRef][Medline] [Order article via Infotrieve]. 19. Fukuda T, Kamishima T, Tsuura Y, et al. Expression of the c-kit gene product in normal and neoplastic mast cells but not in neoplastic basophil/mast cell precursors from chronic myelogenous leukaemia. J Pathol. 1995;177:139-146[CrossRef][Medline] [Order article via Infotrieve]. 20. Dvorak M. Monographprocedural guide to specimen handling for the ultra-structural pathology service laboratory. J Electron Microsc Technics. 1987;6:255-301. 21. Schedle A, Samorapoompichit P, Rausch-Fan XH, et al. Response of L-929 fibroblasts, human gingival fibroblasts and human tissue mast cells to various metal cations. J Dent Res. 1995;74:1513-1520[Abstract/Free Full Text]. 22. Morris RE, Ciraolo GM. A universal post-embedding protocol for immunogold labelling of osmium-fixed, epoxy resin-embedded tissue. J Electron Microsc. 1997;46:315-319[Abstract/Free Full Text]. 23. Schwartz LB, Bradford TR, Rouse C, et al. Development of a new, more sensitive immunoassay for human tryptase: use in systemic anaphylaxis. J Clin Immunol. 1994;14:190-204[CrossRef][Medline] [Order article via Infotrieve]. 24. Willheim M, Agis H, Sperr WR, et al. Purification of human basophils and mast cells by multistep separation technique and mAb to CDw17 and CD117/c-kit. J Immunol Methods. 1995;182:115-129[CrossRef][Medline] [Order article via Infotrieve]. 25. Horny H-P, Sillaber C, Menke D, et al. Diagnostic value of immunostaining for tryptase in patients with mastocytosis. Am J Surg Pathol. 1998;22:1132-1140[CrossRef][Medline] [Order article via Infotrieve]. © 2001 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: M. Mayerhofer, K. V. Gleixner, J. Mayerhofer, G. Hoermann, E. Jaeger, K. J. Aichberger, R. G. Ott, K. Greish, H. Nakamura, S. Derdak, et al. Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib Blood, February 15, 2008; 111(4): 2200 - 2210. [Abstract] [Full Text] [PDF] K. V. Gleixner, M. Mayerhofer, K. Sonneck, A. Gruze, P. Samorapoompichit, C. Baumgartner, F. Y. Lee, K. J. Aichberger, P. W. Manley, D. Fabbro, et al. Synergistic growth-inhibitory effects of two tyrosine kinase inhibitors, dasatinib and PKC412, on neoplastic mast cells expressing the D816V-mutated oncogenic variant of KIT Haematologica, November 1, 2007; 92(11): 1451 - 1459. [Abstract] [Full Text] [PDF] R. Kondo, K. V. Gleixner, M. Mayerhofer, A. Vales, A. Gruze, P. Samorapoompichit, K. Greish, M.-T. Krauth, K. J. Aichberger, W. F. Pickl, et al. Identification of heat shock protein 32 (Hsp32) as a novel survival factor and therapeutic target in neoplastic mast cells Blood, July 15, 2007; 110(2): 661 - 669. [Abstract] [Full Text] [PDF] H-P Horny, K Sotlar, F Stellmacher, M Krokowski, H Agis, L B Schwartz, and P Valent The tryptase positive compact round cell infiltrate of the bone marrow (TROCI-BM): a novel histopathological finding requiring the application of lineage specific markers. J. Clin. Pathol., March 1, 2006; 59(3): 298 - 302. [Abstract] [Full Text] [PDF] K. V. Gleixner, M. Mayerhofer, K. J. Aichberger, S. Derdak, K. Sonneck, A. Bohm, A. Gruze, P. Samorapoompichit, P. W. Manley, D. Fabbro, et al. PKC412 inhibits in vitro growth of neoplastic human mast cells expressing the D816V-mutated variant of KIT: comparison with AMN107, imatinib, and cladribine (2CdA) and evaluation of cooperative drug effects Blood, January 15, 2006; 107(2): 752 - 759. [Abstract] [Full Text] [PDF] H-P Horny, K Sotlar, W R Sperr, and P Valent Systemic mastocytosis with associated clonal haematological non-mast cell lineage diseases: a histopathological challenge J. Clin. Pathol., June 1, 2004; 57(6): 604 - 608. [Abstract] [Full Text] [PDF] M. Arock, E. Schneider, M. Boissan, V. Tricottet, and M. Dy Differentiation of human basophils: an overview of recent advances and pending questions J. Leukoc. Biol., April 1, 2002; 71(4): 557 - 564. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Samorapoompichit, P. Articles by Valent, P. Search for Related Content PubMed PubMed Citation Articles by Samorapoompichit, P. Articles by Valent, P. Related Collections Neoplasia Brief Reports Social Bookmarking                   What's this?

	Copyright © 2001 by American Society of Hematology         Online ISSN: 1528-0020