|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Department of Dermatology, University Hospital
of Zurich, Switzerland.
Interleukin-7 (IL-7) and IL-15 have been recently identified
as growth factors for cutaneous T-cell lymphoma (CTCL) cells, and they
protect these cells from cell death. Using the CTCL cell line SeAx as a
test system now shows that IL-7 and IL-15 are indeed necessary to
maintain high levels of bcl-2. The up-regulation of bcl-2 was
paralleled by increased DNA-binding activities of the transcription
factors STAT2, STAT5, STAT6, and c-Myb to bcl-2 gene promoter-enhancer elements. Because STAT5 and c-Myb positively regulate bcl-2, IL-7 and IL-15 may mediate some of their effects on
cell death survival gene expression through these 2 factors. Constitutive activities of the 3 STAT factors and c-Myb were found in
the IL-7- and IL-15-independent CTCL cell lines HUT78 and MyLa 2059. The c-Myb protein was also present in CTCL cells of the skin lesions of all investigated patients. These results indicate that
IL-7 and IL-15 may increase bcl-2 expression in CTCL cells by the
activation of c-myb and STAT factors.
(Blood. 2001;98:2778-2783) Cutaneous T-cell lymphoma (CTCL) is a group of
lymphoproliferative disorders of the skin.1 The most
frequent forms of CTCL are mycosis fungoides (MF) and its leukemic
counterpart, the Sézary syndrome (SS). MF proceeds slowly (5-20 years) but leads mostly to death, which is often caused in the late
phase of CTCL by rapidly growing and ulcerating tumors and immune
disorders. In addition to generalized erythroderma, patients with SS
have leukemic T cells in the blood, and life expectancy is generally
shorter (3 years) than it is for patients with MF.
Interleukin-7 (IL-7) and IL-15 are growth and survival factors for CTCL
cells.2,3 Because CTCL cells may remain restricted to the
skin during the longest time in the course of the disease, these 2 cytokines, which are also produced in the skin,4-6 may be
responsible for the epidermotropism of this disease. IL-15 has been
identified as a T-cell growth-stimulating cytokine produced by many
cell types and tissues.7 The IL-15 receptor (R) contains the The IL-2R A positive effect of IL-7 on bcl-2 expression has already been shown in
murine T-cell lymphoma cells.14 Bcl-2 belongs to a growing
gene family whose members either inhibit or promote cell death. Bcl-2
promotes cell survival, whereas the genes bax15 and bad promote cell death.16 The survival of a
cell depends on the ratio between cell survival-promoting and cell
death-promoting molecules.17 Bcl-2 expression has been
found in CTCL skin lesions and is supposed to increase the survival and
the resistance of CTCL cells against radiotherapy.18,19
Two transcription factors have been found to increase the
expression of the bcl-2 gene: c-Myb20-22 and
STAT5.23 The c-myb gene was initially
identified as an oncogene in acute avian leukemia retrovirus
strains.24 Its gene product binds to gene regulatory sequences, and its expression peaks during the transition from G1 to S
phase.25 Thus c-myb plays a role in cell cycle
progression and cell growth. STAT5 is a member of the signal transducer
and activator of transcription factor family, which mediates the
effects of growth hormones and cytokines, including IL-2, IL-7, and
IL-15, and which have been shown to stimulate the DNA binding of
STAT5.26-31
Here we investigated whether IL-7 and IL-15 increase the activities and
DNA binding of c-Myb and STAT5. A coregulation of these 2 factors and
bcl-2 would make it likely that IL-7 and IL-15 mediate their
effects on bcl-2 expression through c-Myb and STAT5. As a
test system, we used the IL-7-/IL-15-dependent CTCL cell line SeAx,
which can survive 4 to 6 days in the absence of both cytokines. To see
the effects of IL-7 and IL-15, SeAx cells were kept for 2 to 4 days in
the absence of both interleukins; after this time, the cells either
were stimulated with IL-7 or IL-15 or were left unstimulated. This
system allowed us to investigate the different effects of IL-7 and
IL-15 on bcl-2 and c-myb.
Cell culture
Skin samples
Electrophoretic mobility shift assay and supershift experiments Electrophoretic mobility shift assays were performed according to the method of Barberis et al.32 Double-stranded -32P adenosine triphosphate-labeled oligonucleotides
(30 000 cpm) containing the binding sites for c-myb (5'
TACAGGCATAACGGTTCCGTAGTG 3') and the STAT5-binding site of the
bcl-2 promoter (5' AGGACTTCTGCGAATACCGG 3') were
incubated with 3 µg nuclear extract of the investigated cells in
binding buffer consisting of 10 mM HEPES, pH 7.9, 60 mM KCl, 4%
Ficoll, 1 mM dithiothreitol, and 1 mM EDTA, pH 8. Two micrograms poly
IC were used as competitor for unspecific DNA-binding activities. Total
volume of the reaction was 30 µL. For supershift experiments, 2 to 4 µg corresponding antibody (TransCruz gel supershift reagent; Santa
Cruz Biotechnology, Santa Cruz, CA) was added. Nuclear extracts were
prepared according to the method of Gerber et al.33 The
reaction mixture was incubated for 30 minutes at 4°C and then was
loaded on a 4% native polyacrylamide gel (0.25× TBE).
Oligonucleotides were synthesized by Microsynth (Balgach, Switzerland).
Western blot analyses For Western blotting, 15 to 30 µg protein of nuclear extracts or 30 to 60 µg protein of cytoplasmic extracts were loaded on 7.5% to 9% sodium dodecyl sulfate polyacrylamide gels and separated by polyacrylamide gel electrophoresis. The percentage of polyacrylamide depended on the molecular weight of the protein to be investigated. Proteins were transferred to a nitrocellulose filter using a Mini Trans Blot Cell (Bio-Rad, Glattbrugg, Switzerland) following the instructions of the supplier. Unspecific antibody-binding sites were blocked by incubation of the filter overnight at 4°C in Tris-buffered saline (TBS), 0.3% Tween 20, and 2% milk powder. The filter was incubated with the first antibody (1:1000 dilution; Santa Cruz Biotechnology) for 4 hours at room temperature in TBS, 0.3% Tween 20, and 1% milk powder. Incubation with the second antibody (1:5000 dilution; Roche Diagnostics, Rotkreuz, Switzerland) was conducted in TBS, 0.3% Tween 20, for 4 hours at room temperature. The signal was detected by incubation with BM purple AP substrate (Roche Diagnostics) according to the instructions of the supplier.Immunohistochemistry All specimens were snap-frozen in liquid nitrogen, embedded in Tissue-Tek (Gibco, Basel, Switzerland), and stored at 80°C until processing. Cryostat sections of 5 µm were cut onto
gelatin-coated microscope slides and air-dried. Alkaline antialkaline
phosphatase immunohistochemistry (reagents from Dako, Zug,
Switzerland) was performed as published.34
Anti-IL-15 antibodies used are commercially available (Peprotech,
London, United Kingdom). In addition, all samples were also
examined for reactivity with anti-CD3, -CD4, and -CD8 (reagents
from Dako).
IL-7 and IL-15 stimulate the expression of cell survival genes It has been found that malignant T cells of patients with SS and MF express bcl-2.18,19,35 To see whether IL-7 and IL-15 regulate bcl-2, we used the IL-7-/IL-15-dependent SeAx cell line. These cells can survive for 4 to 6 days in the absence of these 2 interleukins, and bcl-2 expression is down-regulated after 2 days (Figure 1). To determine whether IL-7 or IL-15 can re-establish high anti-cell death gene expression after interleukin withdrawal, SeAx cells were kept, in the absence of IL-7 and IL-15, for 48, 54, 60, 72, and 96 hours. Then ten units IL-7 (Figure 1A) or IL-15 (Figure 1C) was added to the cells for another 6 hours. Cells incubated for another 6 hours without IL-7 or IL-15 served as negative controls. Resultant amounts of bcl-2 were determined by Western blot analysis. The -actin gene served as a
control not influenced by interleukins (Figure 1B,D). Figure 1 shows
that IL-7 and IL-15 increased the levels of Bcl-2 protein after
different times of interleukin starvation. Values after 6 hours of IL-7 and IL-15 addition are even higher than after 48 hours of interleukin withdrawal. Because cell death was beginning, the absolute values for
interleukin addition after 72 and 96 hours were lower than those after
54 and 60 hours; however, at this point, the relative bcl-2
expression-increasing effects were highest. In contrast to
bcl-2, the -actin gene was only marginally influenced.
These effects were attributed solely to the interleukins because the cells were kept under constant serum conditions (10% FCS). The rise in
Bcl-2 levels resulted from newly induced bcl-2 gene
transcription and protein synthesis increased Bcl-2 levels were
observed after 6 hours but not after 30 minutes. RNA polymerase II
inhibitor  amanitin completely abolished the effects of the addition
of IL-7 and IL-15 (data not shown).
IL-7 and IL-15 stimulate the DNA binding of c-Myb Because it has been shown that bcl-2 transcription is up-regulated by the binding of c-Myb to promoter sequences of the bcl-2 promoter, we wanted to know whether IL-7 and IL-15 can increase the binding of c-Myb to an oligonucleotide that contains a c-Myb binding site. Figure 2A shows that IL-7 and IL-15 increased the DNA binding of c-Myb. The increase of the binding of c-Myb occurred within 30 minutes, indicating that de novo protein synthesis is not necessary for c-Myb DNA-binding stimulation. High constitutive c-Myb DNA binding was found in the IL-7- and IL-15-independent CTCL cell lines HUT78 and MyLa 2059. The addition of a c-Myb antibody to the DNA-binding reaction significantly reduced the signal of the largest complex, which probably consists of a double band, indicating that c-Myb is indeed present in this DNA-protein complex (Figure 2B). The addition of a STAT5 antibody had no effect (Figure 2B, lanes 11, 12). Because the signal was not totally repressed by the antibody, it is also possible that related A-Myb and B-Myb proteins bind to this sequence.
IL-7 and IL-15 stimulate the expression of the c-myb gene It has been reported that c-myb expression is positively regulated by itself.36 If IL-7 and IL-15 should work through c-Myb, one would expect that IL-7 and IL-15 could also stimulate c-myb expression. The stimulation of c-myb expression by IL-7 and IL-15 would prolong the effect of both interleukins on bcl-2 expression. Figure 3A-B shows that IL-7 and IL-15 indeed stimulate c-myb expression and that c-myb is regulated in the same way as bcl-2. There are at least 7 different splice variants of c-myb,36 and they use several alternative exons (eg, 8A, 9A, 13A). IL-7 and IL-15 regulate practically all splice variants. With the polyclonal antibody used, we detected at least one further protein (marked by X) that may be a still unknown c-Myb splice variant given that it was also regulated by both interleukins. The triplet of the 3 splice forms 13A, pMbM-1, and complete coding sequence (CCS) is not always resolved on every gel. Bands above 95 kd were not always reproducible and might have been cross-hybridizing proteins. The strongest IL-7 and IL-15 stimulation after longer times of starvation was seen for splice variants using the alternative exons 8A, 9B, and 13A. The same pattern of splice variants seen in SeAx cells was observed in HUT78 and MyLa 2059 cells (data not shown). Western analysis of peripheral blood leukocytes (PBLs) detected only the splice firms 8A and 9B and the form initially designated as the CCS.37 Gel loading was controlled with an antibody directed against the c-myc gene (Figure 3C-D) that was not regulated by IL-7 or IL-15.38
IL-7 and IL-15 stimulate the DNA binding of STAT factors to a bcl-2 gene promoter element We recently showed that IL-7 and IL-15 stimulate the binding of the transcription factor STAT5 to the IL-4-responsive element (IL-4RE) in CTCL cell lines.39 Because it has been reported that STAT5 can bind to a promoter element of the bcl-2 gene that has a similar sequence, we tested whether IL-7 and IL-15 can also increase the binding of STAT5 to this promoter element. Using nuclear extracts of IL-7- and IL-15-starved and IL-7- and IL-15-treated SeAx cells and an oligonucleotide representing the STAT5 binding bcl-2 promoter site, we found that both interleukins increased the binding of proteins to this sequence (Figure 4A). Electrophoretic mobility shift assay experiments with antibodies against the STAT1 to STAT6 factors and nuclear extracts from CTCL cell lines (Figure 4B-D) showed that antibodies directed against STAT2 and STAT6 partially disrupted the C1 complex and formed a trimeric DNA-protein-antibody complex (supershift). This effect was barely visible with extracts from SeAx cells. The antibody against STAT5 also induced a supershift and caused a total disruption of the C1 complex, indicating that STAT5 is the main component of C1.
The c-myb gene and STAT factors are expressed in skin lesions of patients with CTCL Because c-myb expression is correlated with cell proliferation and because CTCL cells proliferate in the skin but not in the blood, we wondered whether c-myb might be expressed in skin lesions of patients with CTCL. After staining cryostat sections from CTCL lesions with a c-Myb antibody, we found that c-myb was expressed in all examined skin tumor lesions. Figure 5A-D shows that the c-Myb protein is present mainly in the cytoplasm of CTCL cells but is also in the nucleus. Because c-Myb is already present in early stages (early MF; Figure 5A; early SS, Figure 5B), the activation of the c-myb oncogene must be an early event in CTCL cancer genesis. Figure 5C shows an advanced MF stage, and Figure 5D shows an advanced SS stage.
The presence of STAT2, STAT5, and STAT6 in the malignant cells of skin lesions has already been shown (Figure 5E-G).39 It has been found in general that STAT5 is the STAT factor with the strongest staining in the nucleus. An example of bcl-2 expression in CTCL skin lesions is given in Figure 5D. In total, 11 patients have been tested.
Our results show that IL-7 and IL-15 can stimulate the expression of the cell death survival gene bcl-2 in CTCL cells. DNA binding of the transcription factors c-myb and STAT5 are also stimulated by IL-7 and IL-15 and probably mediate the effects of IL-7 and IL-15 because the promoter of the bcl-2 gene has binding sites for both factors. To a lower extent, STAT2 and STAT6 also bound to the STAT5 binding site. To our knowledge, this is the first time an activation of c-myb by IL-7 and IL-15 has been reported. This result connects the findings that IL-7 and IL-15 can increase mature T-cell survival and bcl-2 expression40,41 and that c-myb stimulates bcl-2 expression in lymphocytes.20-22 The stimulation of STAT5 by IL-7 and IL-15 also occurs in normal T cells and other tissues.31 However, the stimulation of STAT2 and STAT6 is atypical. A stimulation of STAT6 has until now only been reported for mast cells, which have a cell-specific IL-15 receptor (IL-15RX) (reviewed in 42). The stimulation of c-Myb and of the 3 STAT factors occurs in less than
30 minutes, indicating that, in contrast to bcl-2, no protein synthesis
is necessary for the stimulation of both factors by IL-7 and IL-15.
Because the c-myb gene promoter also contains a c-Myb
binding site, it may also positively regulate its own expression. With
respect to bcl-2 and c-myb regulation in SeAx
cells, IL-7 and IL-15 are equally effective. Thus, both cytokines may
act through the same pathways because IL-7R and IL-15R contain the same
Because c-Myb plays a role not only in bcl-2 gene regulation but also in cell cycle progression, it may not only help CTCL cells to survive but also increase the cell division and growth rate of the tumor cells. This assumption is corroborated by the finding that IL-15 is necessary for cell division initiation.43 STAT factors mediate the effects of many growth hormones and cytokines and thus not only increase the survival but also the growth of CTCL cells. The c-Myb protein is already present in early CTCL stages. Thus, c-myb activation must be an early step in CTCL cancer genesis. Like c-Myb, STAT2, STAT5, and STAT6 were found in the 3 cell lines and in skin lesion biopsy specimens from patients with CTCL. As in the CTCL cell lines, the concentration of STAT5 was the highest of all expressed STAT factors. Regarding the presence of constitutive STAT factor activities, CTCL cells resemble leukemic cells from patients with acute myeloid leukemia, Burkitt lymphoma, and adult T-cell leukemia.22,37,44 The constitutive activity of STATs in CTCL cells may caused by deregulated activities of the tyrosine kinases Jak1 and Jak3, which regulate STAT5. However, other STAT factors regulating tyrosine kinases, such as c-Src, Bmx, and c-Yes, may be involved because these 3 tyrosine kinases, which are normally not expressed in T cells, are expressed in CTCL cells (U.D., C.-L.Z, and J.K., unpublished data, May 2000). Another reason for the constitutive activities of the STATs may be the functional loss of STAT inhibitors. Members of the suppressor of cytokine signaling (SOCS) gene family inhibit STAT signaling45-47; indeed, it has recently been found that CTCL cell lines lack functioning SOCS-3 proteins.48 In early stages, CTCL cell survival may depend on IL-7, IL-15, and other growth factors that are delivered by surrounding keratinocytes and dendritic cells. Later, the mutations in tyrosine kinases mentioned above may lead to cytokine-independent transcription factor activation, bcl-2 expression, and cell proliferation. IL-15 produced by the CTCL cells themselves3 may also help the CTCL cells to become independent from the dermal environment. Our results suggest that the higher amounts of Bcl-2 protein in malignant T cells of patients with CTCL may be a direct consequence of c-Myb and STAT5 activities. Bcl-2 overexpression is of clinical relevance because CTCL tumors with high bcl-2 expression are resistant to radiotherapy. We suppose that in early CTCL stages c-Myb alone may increase the expression of the bcl-2 gene but that it may not yet be able to increase CTCL cell proliferation because oncogenes such as c-myc,38 with which c-myb cooperates, are not yet expressed.
We thank M. Johnson and M. Bär for the preparation of the photographs.
Submitted February 15, 2001; accepted May 28, 2001.
Supported by the Swiss Cancer League (grant KFS 275-1-1996), the Swiss National Science Foundation (grant 3100-43244.95/1), the United Bank of Switzerland, the Theodor and Ida Herzog-Egli Foundation, and the Kanton of Zürich.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Udo Döbbeling, Department of Dermatology, University Hospital of Zurich, CH-8091 Zurich, Switzerland; e-mail: doebbeli{at}derm.unizh.ch.
1. Burg G, Kempf W, Häffner AC, et al. Cutaneous lymphomas. Curr Probl Dermatol. 1997;9:139-204. 2. Dalloul A, Laroche L, Bagot M, et al. Interleukin-7 is a growth factor for Sézary lymphoma cells. J Clin Invest. 1992;90:1054-1060. 3. Döbbeling U, Dummer R, Laine E, Potoczna N, Qin J-Z, Burg G. Interleukin-15 is an autocrine/paracrine viability factor for cutaneous T-cell lymphoma cells. Blood. 1998;921:252-258. 4. Matsue H, Bergstresser PR, Takashima A. Keratinocyte-derived IL-7 serves as a growth factor for dendritic epidermal T cells in mice. J Immunol. 1993;151:6012-6019[Abstract]. 5. Mohamadzadeh M, Takashima A, Dougherty I, Knop J, Bergstresser PR, Cruz PD. Ultraviolet B radiation up-regulates the expression of IL-15 in human skin. J Immunol. 1995;155:4492-4496[Abstract]. 6. Blauvelt A, Asada H, Klaus-Kovtun V, Altman DJ, Lucey DR, Katz SI. Interleukin-15 mRNA is expressed by human keratinocytes, Langerhans cells, and blood derived dendritic cells and is down-regulated by ultraviolet B radiation. J Invest Dermatol. 1996;106:1047-1052[CrossRef][Medline] [Order article via Infotrieve].
7.
Grabstein KH, Eisenman J, Shanebeck K, et al.
Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor.
Science.
1994;264:965-968 8. Giri JG, Ahdieh M, Eisenman J, et al. Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 1994;13:2822-2830[Medline] [Order article via Infotrieve]. 9. Giri JG, Kumaki S, Ahdieh M, et al. Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J. 1995;14:3654-3663[Medline] [Order article via Infotrieve]. 10. Armitage RJ, Macduff BM, Eisenman J, Paxton R, Grabstein KH. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J Immunol. 1995;154:483-490[Abstract].
11.
Nowak R.
Bubble boy paradox resolved [abstract].
Science.
1993;262:1818 12. Miyazaki T, Liu ZJ, Kawahara A, et al. Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc, and lck cooperate in hematopoietic cell proliferation. Cell. 1995;81:223-231[CrossRef][Medline] [Order article via Infotrieve].
13.
Korsmeyer SJ.
Bcl-2 initiates a new category of oncogenes: regulators of cell death.
Blood.
1992;80:879-886 14. Lee SH, Fujita N, Mashima T, Tsuruo T. Interleukin-7 inhibits apoptosis of mouse malignant T-lymphoma cells by both suppressing the CPP32-like protease activation and inducing the Bcl-2 expression. Oncogene. 1996;13:2131-2139[Medline] [Order article via Infotrieve]. 15. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell. 1993;74:609-619[CrossRef][Medline] [Order article via Infotrieve]. 16. Yang E, Zha J, Jockel J, Boise LH, Thompson CB, Korsmeyer SJ. Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell. 1995;80:285-291[CrossRef][Medline] [Order article via Infotrieve]. 17. Osborne BA. Apoptosis and the maintenance of homeostasis in the immune system. Curr Opin Immunol. 1996;8:245-254[CrossRef][Medline] [Order article via Infotrieve]. 18. Kanavaros P, Ioannidou D, Tzardi M, et al. Mycosis fungoides: expression of C-myc p62, p53, bcl-2 and PCNA proteins and absence of association with Epstein-Barr virus. Pathol Res Pract. 1994;190:767-774[Medline] [Order article via Infotrieve]. 19. Dummer R, Michie SA, Kell D, et al. Expression of bcl-2 protein and Ki-67 nuclear proliferation antigen in benign and malignant cutaneous T-cell infiltrates. J Cutan Pathol. 1995;22:11-17[CrossRef][Medline] [Order article via Infotrieve].
20.
Frampton J, Ramquist T, Graf T.
v-Myb of E26 leukemia virus up-regulates bcl-2 and suppresses apoptosis in myeloid cells.
Genes Dev.
1996;10:2720-2731
21.
Taylor D, Badiani P, Weston K.
A dominant interfering Myb mutant causes apoptosis in T cells.
Genes Dev.
1996;10:2732-2744
22.
Salomoni P, Perrotti D, Martinez R, Franceschi C, Calabretta B.
Resistance to apoptosis in CTLL-2 cells constitutively expressing c-Myb is associated with induction of Bcl-2 expression and Myb-dependent regulation of bcl-2 promoter activity.
Proc Natl Acad Sci U S A.
1997;94:3296-3301
23.
Weber-Nordt RM, Egen C, Wehinger J, et al.
Constitutive activation of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV)-related lymphoma cell lines.
Blood.
1996;88:809-816 24. Roussel M, Saule S, Lagrou C, et al. Three new types of viral oncogene of cellular origin specific for haematopoietic cell transformation. Nature. 1979;281:452-455[CrossRef][Medline] [Order article via Infotrieve]. 25. Thompson CB, Challoner PB, Neiman PE, Groudine M. Expression of the c-myb proto-oncogene during cellular proliferation. Nature. 1986;319:374-380[CrossRef][Medline] [Order article via Infotrieve]. 26. Wakao H, Gouilleux F, Groner B. Mammary gland factor (MGF) is a novel member of the cytokine regulated transcription factor gene family and confers the prolactin response. EMBO J. 1994;13:2182-2192[Medline] [Order article via Infotrieve]. 27. Wakao H, Harada N, Kitamura T, Mui ALF, Miyajima A. Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways. EMBO J. 1995;14:2527-2535[Medline] [Order article via Infotrieve].
28.
Fujii H, Nakagawa Y, Schindler U, et al.
Activation of Stat5 by interleukin 2 requires a carboxyl-terminal region of the interleukin 2 receptor beta chain but is not essential for the proliferative signal transmission.
Proc Natl Acad Sci U S A.
1995;92:5482-5486
29.
Johnston JA, Bacon CM, Finbloom DS, et al.
Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15.
Proc Natl Acad Sci U S A.
1995;92:8705-8709
30.
Zhang Q, Nowak I, Vonderheid EC, et al.
Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin 2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sézary syndrome.
Proc Natl Acad Sci U S A.
1996;93:9148-9153 31. Schindler C, Darnell JE. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem. 1995;64:621-651[Medline] [Order article via Infotrieve]. 32. Barberis A, Superti-Furga G, Busslinger M. Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter. Cell. 1987;50:347-359[CrossRef][Medline] [Order article via Infotrieve].
33.
Gerber HP, Georgiev O, Harshman K, Schaffner W.
In vitro transcription complementation assay with miniextracts of transiently transfected COS-1 cells.
Nucl Acids Res.
1992;20:5855-5856
34.
Dummer R, Heald PW, Nestle FO, et al.
Sézary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-gamma receptor beta-chain).
Blood.
1996;88:1383-1389 35. Garatti SA, Roscetti E, Trecca D, Fracchiolla NS, Neri A, Berti E. bcl-1, bcl-2, p53, c-myc, and lyt-10 analysis in cutaneous lymphomas. Recent Results Cancer Res. 1995;139:249-261[Medline] [Order article via Infotrieve].
36.
Nicolaides NC, Gualdi R, Casadevall C, Manzella L, Calabretta B.
Positive autoregulation of c-myb expression via Myb binding sites in the 5' flanking region of the human c-myb gene.
Mol Cell Biol.
1991;11:6166-6176
37.
Majello B, Kenyon LC, Dalla-Favera R.
Human c-myb protooncogene: nucleotide sequence of cDNA and organization of the genomic locus.
Proc Natl Acad Sci U S A.
1986;83:9636-9649
38.
Qin J-Z, Dummer R, Burg G, Döbbeling U.
Constitutive and interleukin-7/interleukin-15 stimulated DNA binding of Myc, Jun, and novel Myc-like proteins in cutaneous T-cell lymphoma cells.
Blood.
1999;93:260-267 39. Qin J-Z, Kamarashev J, Zhang C-L, Dummer R, Burg G, Döbbeling U. Constitutive and IL-7 and IL-15 stimulated DNA-binding of STAT and novel factors in cutaneous t cell lymphoma (CTCL) cells. J Invest Dermatol. In press. 40. Bulfone-Paus S, Ungureanu D, Pohl T, et al. Interleukin-15 protects from lethal apoptosis in vivo. Nat Med. 1997;3:1124-1128[CrossRef][Medline] [Order article via Infotrieve].
41.
Vella A, Teague TK, Ihle J, Kappler J, Marrack P.
Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat6 is probably not required for the effect of IL-7.
J Exp Med.
1997;186:325-330
42.
Fehniger TA, Caligiuri MA.
Interleukin 15: biology and relevance to human disease.
Blood.
2001;97:14-32 43. Li XC, Demirci G, Ferrari-Lacraz S, et al. IL-15 and IL-2: a matter life and death for T cells in vivo. Nat Med. 2001;7:114-118[CrossRef][Medline] [Order article via Infotrieve].
44.
Takemoto S, Mulloy JC, Cereseto A, et al.
Proliferation of adult T cell leukemia/lymphoma cells is associated with the constitutive activation of JAK/STAT proteins [abstract].
Proc Natl Acad Sci U S A.
1997;94:13897 45. Endo TA, Masuhara M, Yokouchi M, et al. A new protein containing an SH2 domain that inhibits JAK kinases. Nature. 1997;387:921-924[CrossRef][Medline] [Order article via Infotrieve]. 46. Naka T, Narazaki M, Hirata M, et al. Structure and function of a new STAT-induced STAT inhibitor. Nature. 1997;387:924-928[CrossRef][Medline] [Order article via Infotrieve]. 47. Starr R, Wilson TA, Viney EM, et al. A family of cytokine-inducible inhibitors of signalling. Nature. 1997;387:917-921[CrossRef][Medline] [Order article via Infotrieve].
48.
Brender C, Nielsen M, Kaltoft K, et al.
STAT3-mediated constitutive expression of SOCS-3 in cutaneous T cell lymphoma.
Blood.
2001;97:1056-1062
© 2001 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  C.-D. Klemke, D. Brenner, E.-M. Weiss, M. Schmidt, M. Leverkus, K. Gulow, and P. H. Krammer Lack of T-Cell Receptor-Induced Signaling Is Crucial for CD95 Ligand Up-regulation and Protects Cutaneous T-Cell Lymphoma Cells from Activation-Induced Cell Death Cancer Res., May 15, 2009; 69(10): 4175 - 4183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Tun-Kyi, J. -Z. Qin, P. A. Oberholzer, A. A. Navarini, J. C. Hassel, R. Dummer, and U. Dobbeling Arsenic trioxide down-regulates antiapoptotic genes and induces cell death in mycosis fungoides tumors in a mouse model Ann. Onc., August 1, 2008; 19(8): 1488 - 1494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Rolle, R. Carrio, and T. R. Malek Modeling the CD8+ T Effector to Memory Transition in Adoptive T-Cell Antitumor Immunotherapy Cancer Res., April 15, 2008; 68(8): 2984 - 2992. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sors, F. Jean-Louis, E. Begue, L. Parmentier, L. Dubertret, M. Dreano, G. Courtois, H. Bachelez, and L. Michel Inhibition of I{kappa}B Kinase Subunit 2 in Cutaneous T-Cell Lymphoma Down-Regulates Nuclear Factor-{kappa}B Constitutive Activation, Induces Cell Death, and Potentiates the Apoptotic Response to Antineoplastic Chemotherapeutic Agents Clin. Cancer Res., February 1, 2008; 14(3): 901 - 911. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. V. Cabrera, M. Amano, J. Mitoma, J. Chan, J. Said, M. Fukuda, and L. G. Baum Haploinsufficiency of C2GnT-I glycosyltransferase renders T lymphoma cells resistant to cell death Blood, October 1, 2006; 108(7): 2399 - 2406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sors, F. Jean-Louis, C. Pellet, L. Laroche, L. Dubertret, G. Courtois, H. Bachelez, and L. Michel Down-regulating constitutive activation of the NF-{kappa}B canonical pathway overcomes the resistance of cutaneous T-cell lymphoma to apoptosis Blood, March 15, 2006; 107(6): 2354 - 2363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-i. Yamanaka, R. Clark, B. Rich, R. Dowgiert, K. Hirahara, D. Hurwitz, M. Shibata, N. Mirchandani, D. A. Jones, D. S. Goddard, et al. Skin-derived interleukin-7 contributes to the proliferation of lymphocytes in cutaneous T-cell lymphoma Blood, March 15, 2006; 107(6): 2440 - 2445. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Marleau and N. Sarvetnick T cell homeostasis in tolerance and immunity J. Leukoc. Biol., September 1, 2005; 78(3): 575 - 584. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. W. Blaser, S. Roychowdhury, D. J. Kim, N. R. Schwind, D. Bhatt, W. Yuan, D. F. Kusewitt, A. K. Ferketich, M. A. Caligiuri, and M. Guimond Donor-derived IL-15 is critical for acute allogeneic graft-versus-host disease Blood, January 15, 2005; 105(2): 894 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Petrovas, Y. M. Mueller, I. D. Dimitriou, P. M. Bojczuk, K. C. Mounzer, J. Witek, J. D. Altman, and P. D. Katsikis HIV-Specific CD8+ T Cells Exhibit Markedly Reduced Levels of Bcl-2 and Bcl-xL J. Immunol., April 1, 2004; 172(7): 4444 - 4453. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Stassi, M. Todaro, M. Zerilli, L. Ricci-Vitiani, D. Di Liberto, M. Patti, A. Florena, F. Di Gaudio, G. Di Gesu, and R. De Maria Thyroid Cancer Resistance to Chemotherapeutic Drugs via Autocrine Production of Interleukin-4 and Interleukin-10 Cancer Res., October 15, 2003; 63(20): 6784 - 6790. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Lindemann, M. Benczik, and S. L. Gaffen Anti-apoptotic Signaling by the Interleukin-2 Receptor Reveals a Function for Cytoplasmic Tyrosine Residues within the Common gamma (gamma c) Receptor Subunit J. Biol. Chem., March 14, 2003; 278(12): 10239 - 10249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. Mueller, P. M. Bojczuk, E. S. Halstead, A. H. J. Kim, J. Witek, J. D. Altman, and P. D. Katsikis IL-15 enhances survival and function of HIV-specific CD8+ T cells Blood, February 1, 2003; 101(3): 1024 - 1029. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nikolova, P. Musette, M. Bagot, L. Boumsell, and A. Bensussan Engagement of ILT2/CD85j in Sezary syndrome cells inhibits their CD3/TCR signaling Blood, July 18, 2002; 100(3): 1019 - 1025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Zucker-Franklin ; and U. Dobbeling The role of interleukin-7 and interleukin-15 in cutaneous T-cell lymphoma Blood, May 1, 2002; 99(9): 3488 - 3489. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2001 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
