| |
|
|
|
|
|
|
|||
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Department of Medical and Surgical Sciences,
Second Chair of Internal Medicine, and the Department of Pharmacology
and Anesthesiology, University of Padua Medical School, Italy.
Type Vicenza variant of von Willebrand disease (VWD) is
characterized by a low plasma von Willebrand factor (VWF) level and supranormal VWF multimers. Two candidate mutations, G2470A and G3864A
at exons 17 and 27, respectively, of the VWF gene were recently reported to be present in this disorder. Four additional families, originating from northeast Italy, with both mutations of type
Vicenza VWD are now described. Like the original type Vicenza
subjects, they showed a mild bleeding tendency and a significant decrease in plasma VWF antigen level and ristocetin cofactor activity but normal platelet VWF content. Unlike the original patients, ristocetin-induced platelet aggregation was found to be normal. Larger
than normal VWF multimers were also demonstrated in the plasma.
Desmopressin (DDAVP) administration increased factor VIII (FVIII) and
VWF plasma levels, with the appearance of even larger multimers.
However, these forms, and all VWF oligomers, disappeared rapidly from
the circulation. The half-life of VWF antigen release and of
elimination was significantly shorter than that in healthy counterparts, so that at 4 hours after DDAVP administration, VWF antigen levels were close to baseline. Similar behavior was
demonstrated by VWF ristocetin cofactor activity and FVIII. According
to these findings, it is presumed that the low plasma VWF levels of
type Vicenza VWD are mainly attributed to reduced survival of the VWF molecule, which, on the other hand, is normally synthesized. In addition, because normal VWF-platelet GPIb interaction was observed before or after DDAVP administration, it is proposed that type Vicenza
VWD not be considered a 2M subtype.
(Blood. 2002;99:180-184) With type 2 von Willebrand disease (VWD), we refer
to structural and functional abnormalities of von Willebrand factor
(VWF).1,2 A defect in the A1 domain of VWF causes type 2B
or 2M VWD, as manifested by an enhanced or a decreased VWF affinity for
platelet GPIb, respectively.3,4 Even when large VWF
multimers are present (type 2M) or absent (type 2B), platelet plug
formation at the site of vascular injury is compromised.5
Type Vicenza VWD described in patients originating from the Vicenza
area in Italy, is characterized by autosomal dominant inheritance, low plasma VWF levels, and normal platelet VWF content6,7; its peculiarity is the presence of larger than normal (supranormal) VWF
multimers that usually are not present in the plasma but are observed
after the infusion of desmopressin (DDAVP; Emosint, Sclavo, Italy).6,8 From a hemostatic perspective,
high-molecular-weight multimers are known to be more efficient because
of their capacity to induce multiple binding sites at the
subendothelial matrix.9 However, the larger forms
displayed by type Vicenza VWF are not characterized by increased
hemostatic function10; indeed, their functional activity
is said to be decreased, which means that type Vicenza, which was
originally included in the type 1 group, is now classified as a 2M
subtype.11 Nonetheless, it is unclear whether the
decreased function in type Vicenza VWF is a quantitative problem or a
true functional abnormality. After the first demonstration that the
molecular defect is linked to the VWF gene, 2 candidate mutations were identified: the first one in exon 27 (G3864A; R1205H) and the other in exon 17 (G2470A; M740I).7,12,13 We here report 4 more families with type 2 Vicenza VWD with the same hemostatic profile as the patients originally described.
Patients
Materials and methods
VWF ristocetin cofactor activity (VWF:RCo) was measured with normal washed, formalin-fixed platelets and 1 mg/mL ristocetin, as described.17 VWF:Ag was determined by enzyme-linked immunosorbent assay (ELISA).16 Factor VIII (FVIII) coagulant (FVIII:C) was measured by a one-stage method, using cephaloplastin as activated cephalin, as reported elsewhere.18 Platelet VWF:Ag was evaluated by ELISA. VWF collagen binding activity (VWF:CBA) was evaluated by ELISA using type 1 and type 3 collagen diluted in acetic acid solution (95% and 5%, respectively), as described.19 Briefly, after overnight coating with collagen, microtiter plates were incubated with plasma VWF for 1 hour at room temperature; bound VWF was evaluated with an anti-horseradish peroxidase-conjugated VWF antibody (DAKO, The Netherlands). VWF multimer analysis was performed on high-gelling temperature agarose containing 0.1% sodium dodecyl sulfate, using 1.2% or 2.2% agarose gel to obtain low- or high-resolution conditions, respectively.20 After reaction with a purified sodium iodide I 125-labeled anti-VWF antibody, VWF multimers were detected by autoradiography. Autoradiographs were analyzed by densitometer scanner (LKB, Uppsala, Sweden). DDAVP was administered subcutaneously, at a dose of 0.4 µg/kg. Patient and normal blood samples were collected before
and 30, 60, 120, 180, 240, 480 minutes, and 24 hours after DDAVP
administration. Time courses of factor VWF and FVIII plasma
concentrations after DDAVP administration were analyzed according to a
one-compartment model with first-order input and output
kinetics,21 in which baseline concentrations,
B, were also incorporated, as follows: plasma concentration = A × (e Nucleotides of the complementary DNA are numbered from the major transcription cap site (+1), located 250 nucleotides upstream of the first nucleotide in the ATG initiation codon. Amino acid residues are numbered from the ATG initiation codon (residue 1) of the pre-pro-VWF. Genomic DNA was extracted from peripheral blood leukocytes using the Easy DNA extraction kit (Invitrogen, Carlsbad, CA). Exons 17 and 27 of the VWF gene were amplified from 100 ng genomic DNA by polymerase chain reaction with AmpliTaq polymerase (Perkin Elmer) in a thermal cycler (2400 Perkin Elmer). Primer sequences for amplification and sequencing of exon 17 were GGTGAGGCAGCGAGTATAG for 17A and CGTGAGGAATCTGGGCAGG for 17B. Primer sequences of exon 27 AGGAGGAGTTGGCTTCTAGG for 27A and AAGATTCATCACTTC AAACAAC for 27B. Before sequencing, polymerase chain reaction products were purified through Microcon filters (Amicon) to remove any remaining deoxyribonucleotide triphosphates and primers. Sequencing of the amplified fragments was performed by the dideoxy method using the Big Dye terminator sequencing kit (Perkin Elmer). Products were precipitated with ethanol and sodium acetate to remove excess dye terminator and were analyzed in the ABI PRISM 310 Genetic analyzer. We also amplified and sequenced exons 18 to 26 and exon 28 using the method described above, adapted to a panel of published primers.
The main hemostatic findings in the patients with VWD studied are
reported in Table 1. With the exception
of one patient (III-2), all had normal or almost normal bleeding times;
all had significant decreases in plasma VWF:Ag and VWF:RCo levels and less pronounced decreases in FVIII. The VWF:RCo/VWF:Ag ratio was normal
(0.99 ± 0.40; normal range, 0.8-1.2). Despite the low VWF levels,
RIPA was always normal, as were the platelet VWF:Ag content and the
platelet count whose values ranged from 154 000/µL to 294 000/µL
(normal range, 150 000-350 000/µL). Analysis of plasma VWF
multimers by means of a low-resolution gel (1.2% agarose) demonstrated
a decrease of all oligomers, with the presence of supranormal VWF
multimers in all patients studied (Figure
1A). Using high-resolution gel (2.2%
agarose), which resolves each single oligomer into 3 discrete bands,
the VWF multimer pattern of the patients appeared characterized by the
presence of doublets instead of the triplets observed in the normal
counterparts (Figure 2). More precisely,
a dark-stained band migrating as the central component of the normal
triplet was evident, as was a second band that ran like the fast moving
band of normal VWF. A slow migrating band, instead, was much less
represented. This pattern was demonstrable in all patients
investigated. Platelet VWF displayed a normal VWF multimer pattern
(Figure 1B). Because of the presence of these supranormal components,
the capability of patient VWF to bind collagen was investigated by
VWF:CBA. This activity was decreased when it was expressed as an
absolute value (mean, 13.06 ± 6.35 U/dL; normal range, 70-140 U/dL),
but it was normal when expressed as a ratio (mean 0.91 ± 0.26;
normal range, 0.8-1.3) in all patients studied. These findings
suggested that the activity of the supranormal VWF multimers was not
increased as far as collagen binding function was concerned.
DDAVP infusion To better characterize the type of VWD or to prepare the patients for surgical procedures, DDAVP was administered to 5 of the 7 patients. Time courses of FVIII, VWF:Ag, and VWF:RCo after DDAVP administration in patients and healthy subjects were expressed as the best-fit curve. Data pertaining to patient II-1 and a healthy subject are reported in Figure 3. At the peak FVIII, VWF:Ag, and VWF:RCo levels reached normal values, but starting at 120 minutes after DDAVP, their levels decreased at a significant rate so that at 240 minutes their concentrations were near the preinfusion level. Different behavior was observed in a healthy counterpart (Figure 3). The kinetics of plasma FVIII and VWF were investigated by means a one-compartment model (see "Patients, materials, and methods") that satisfactorily described the time-course of post-DDAVP plasma VWF:Ag, VWF:RCo, and FVIII concentrations (r2 median, 0.97; range, 0.91-0.99). Table 2 summarizes the mean values of the main kinetic parameters. It appears that patients had considerably lower AUCs for FVIII, VWF:Ag, and VWF:RCo than healthy subjects. Furthermore, both t1/2 re and t1/2 el for all parameters were shorter in patients than in healthy subjects. In particular, in type Vicenza VWD, VWF:Ag and FVIII t1/2 el levels were 22% and 27% of the control value (1.24 hours vs 5.51 hours and 1.04 hours vs 3.85 hours, respectively). In addition, the t1/2 el of VWF:RCo was reduced, though to a lesser extent (1.15 hours vs 2.61 hours). The t1/2 re was also reduced for VWF:Ag (10.5 minutes vs 28.8 minutes) and VWF:RCo (21.0 minutes vs 46.7 minutes), whereas it appeared to be normal for FVIII (16.6 minutes vs 19.3 minutes). Altogether these findings suggest that the release and the elimination of type Vicenza VWF are consistently different from those in healthy counterparts.
The infusion of DDAVP further evidenced the extra-large VWF multimers
present at baseline and the appearance of multimers with higher
molecular weights. However, these components disappeared starting at
120 minutes after infusion, together with all the other oligomers
(Figure 4).
Genetic analysis Genetic analysis performed in the portion of the VWF gene encoding the amino-terminal portion of the VWF molecule (exons 17-27) disclosed the presence of 2 mutations at the heterozygous level in exons 17 and 27. In exon 17, a G2470A mutation was demonstrated that changes a methionine with a histidine at position 740 of VWF molecule (M740I). In exon 27, a G3864A mutation, predicting a change in the amino acid arginine at position 1205 with histidine (R1205H), was identified. These mutations were not detectable in the nonaffected members of the families studied. Sequencing from exons 18 to 28 disclosed no other nucleotide substitutions in the amplified products, with the exception of many known polymorphisms.
We describe 7 patients from 4 unrelated families with type Vicenza VWD, characterized by hemostatic profiles similar to those of the original type Vicenza subjects, and showing the 2 candidate mutations recently associated with this variant. Indeed, besides supranormal plasma VWF multimers, plasma VWF survival in our patients was consistently reduced than in their healthy counterparts, as demonstrated by the behavior of the VWF released by DDAVP. After the first description of type Vicenza VWD, other cases were
reported in Germany and Hungary,8,22 suggesting a broader distribution of this variant. Two subtypes were identified, one characterized by normal platelet VWF content, as in the original type
Vicenza patients, the other characterized by reduced platelet VWF.8 In so-called classic type Vicenza VWD, besides the
presence of supranormal VWF multimers in plasma, the pathognomonic
hemostatic aspect is the very low level of plasma VWF despite the
normal level of platelet VWF. This latter finding clearly demonstrates that VWF synthesis is normal because platelet VWF content is seen as
the expression of VWF synthesis by endothelial cells. Hence, type
Vicenza VWF is normally synthesized, stored, and released; nevertheless, it is significantly decreased in the plasma. Schneppeneim et al7 advanced an impaired constitutive VWF secretion by
endothelial cells, with near-intact stimulated release. This hypothesis
could explain the abnormal baseline VWF level and the normal DDAVP
response. Based on the results of our study, however, we conclude that
a decrease in VWF survival is the cause of the Vicenza VWD variant. This conclusion is based on the observation that, after DDAVP, the
kinetics of plasma type Vicenza VWF differed from those of healthy
subjects. Indeed, the AUC(s) of the DDAVP-induced VWF:Ag, VWF:RCo, and
FVIII concentration time courses were consistently lower in patients
with VWD than in healthy subjects. Recalling that AUC is given by the
amount of molecule released (Q) divided by its plasma clearance (Cl), a
reduced AUC may be attributed either to a smaller Q or a greater Cl. An
increase in Cl is likely, because t1/2 of elimination
was invariably shortened. In addition, the release process of VWF:Ag
and VWF:RCo (but not of FVIII) appears to be quicker in patients than
in healthy subjects. If normal VWF plasma concentration is viewed as
the result of the entry of newly synthesized VWF and the removal of VWF
from circulation, in type Vicenza VWF the reaction is shifted toward
removal, even though more complex alterations have been taken into
account To date, the cause of the rapid disappearance of circulating type Vicenza VWF has not been clarified. The 2 candidate mutations in exons 17 and 27 of the VWF gene may predict abnormalities in the D' and D2 domains, respectively, encoded by these exons; however, their role and the underlying mechanisms are not yet described. On the other hand, it is unclear whether the presence of supranormal VWF multimers is the cause or the consequence of reduced survival or it is an unrelated finding. At any rate it is intriguing to note that, based on our results, the half-life of VWF:RCo is less compromised than is that of VWF:Ag and FVIII. That all our type Vicenza patients come from northeast Italy and have the 2 mutations, G2740A and G3864A, identified in the patients originally described7, in contrast with the patients coming from Milan and Germany,13 may indicate a founder effect. Regarding the specific role of the 2 candidate mutations, we have no explanation; the finding that patients with the G3864A mutation in exon 27 alone show the same hemostatic pattern as those with the 2 mutations, however, seems to indicate a major contribution of the G3864A mutation to the development of abnormal plasma VWF levels and multimer patterns. Type Vicenza patients offer the first clear demonstration that a decrease in the half-life of VWF may be one of the causes of VWD. This condition differs from that observed in type 2A VWD, in which the decreased survival of circulating VWF mainly concerns the high and intermediate molecular weight multimers.26,27 In type Vicenza VWD, all multimers are instead involved, and all the components of VWF are rapidly removed from the plasma. This appears more similar to the physiological situation, where no specific multimers seem to be selected for removal at the end of VWF survival.
Submitted April 18, 2001; accepted August 29, 2001.
Supported by grants from Murst (60%, 98) and Telethon Foundation, Rome, Italy.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Alessandra Casonato, Department of Medical and Surgical Sciences, University of Padua Medical School, Via Ospedale Civile 105, Padua, Italy; e-mail: sandra.casonato{at}unipd.it.
1.
Ruggeri ZM, Zimmerman TS.
Von Willebrand factor and von Willebrand disease.
Blood.
1987;70:895-904 2. Sadler JE. A revised classification of von Willebrand disease. Thromb Haemost. 1994;71:520-525[Medline] [Order article via Infotrieve]. 3. Ruggeri ZM, Pareti FI, Mannucci PM, Ciavarella N, Zimmernal TS. Heightened interaction between platelets and factor VIII/von Willebrand factor in a new subtype of von Willebrand disease. N Engl J Med. 1980;302:1047-1051[Abstract].
4.
Rabinowitz I, Tuley EA, Mancuso DJ, et al.
von Willebrand disease type B: a missense mutation selectively abolishes ristocetin-induced von Willebrand factor binding to platelet glycoprotein Ib.
Proc Natl Acad Sci U S A.
1992;89:9846-9849 5. Ruggeri ZM, Zimmerman TS. Variant von Willebrand's disease: characterization of two subtypes by analysis of multimeric composition of factor VIII/von Willebrand factor in plasma and platelets. J Clin Invest. 1980;65:1318-1325.
6.
Mannucci PM, Lombardi R, Castaman G, et al.
von Willebrand disease "Vicenza" with larger-than normal (supranormal) von Willebrand factor multimers.
Blood.
1988;71:65-70 7. Schneppenheim R, Federici AB, Budde U, et al. Von Willebrand disease type 2M "Vicenza" in Italian and German patients: identification of the first candidate mutation (G3864A; R1205H) in 8 families. Thromb Haemost. 2000;82:136-140. 8. Zieger B, Budde U, Jessat U, et al. New families with von Willebrand disease type 2M (Vicenza). Thromb Res. 1997;87:57-64[CrossRef][Medline] [Order article via Infotrieve].
9.
Gralnick HR, Williams SB, Morisato DK.
Effect of multimeric structure of the factor VIII/von Willebrand factor protein on binding to platelets.
Blood.
1981;58:387-392 10. d'Alessio PA, Castaman G, Rodeghiero F, et al. In vivo experiments indicate that relatively high platelet deposition in von Willebrand disease "Vicenza" is caused by normal platelet-VWF levels rather than by high VWF-multimers in plasma. Thromb Res. 1992;65:221-228[CrossRef][Medline] [Order article via Infotrieve]. 11. Sadler JE, Matsushita T, Dong Z, Tuely EA, Westfield LA. Molecular mechanism and classification of von Willebrand factor disease. Thromb Haemost. 1995;74:161-164[Medline] [Order article via Infotrieve]. 12. Randi AM, Sacchi E, Castaman G, Rodeghiero F, Mannucci PM. The genetic defect of type I von Willebrand disease "Vicenza" is linked to the von Willebrand factor gene. Thromb Haemost. 1993;69:173-176[Medline] [Order article via Infotrieve]. 13. Castaman G, Missiaglia E, Federici AB, Schneppenheim R, Rodeghiero F. An additional unique candidate mutation (G2470A; M740I) in the original families with von Willebrand disease type 2M Vicenza and the G3864A (R1205H) mutation. Thromb Haemost. 2000;84:350-351[Medline] [Order article via Infotrieve]. 14. Casonato A, Pontara E, Dannhauser D, Bertomoro A, Sartori MT, Girolami A. A new variant of von Willebrand's disease (type I Padua): doublet-organized plasma von Willebrand oligomers in the presence of all size multimers. Haematologia. 1994;26:97-109[Medline] [Order article via Infotrieve].
15.
Casonato A, De Marco L, Mazzuccato M, et al.
A new congenital platelet abnormality characterized by spontaneous platelet aggregation, enhanced von Willebrand factor platelet interaction and the presence of all von Willebrand factor multimers in plasma.
Blood.
1989;74:2028-2033 16. Casonato A, Sartori MT, Pontara E, Zucchetto S, Girolami A. Impaired release of tissue plasminogen activator (t-PA) following DDAVP infusion in von Willebrand's disease with low platelet von Willebrand factor content. Blood Coagul Fibrinolysis. 1992;3:149-153[Medline] [Order article via Infotrieve]. 17. Casonato A, Fabris F, Vicariotto M, Girolami A. The evaluation of factor VIII antigen by means of a simple slide test. Am J Clin Pathol. 1985;29:309-316. 18. Girolami A, Molaro G, Lazzarin M, Scarpa R, Brunetti A. A new congenital haemorrhagic condition due to the presence of abnormal factor X (factor X Friuli): study of a large kindred. Br J Haematol. 1970;19:179-192[Medline] [Order article via Infotrieve]. 19. Casonato A, Pontara E, Bertomoro A, Zucchetto S, Zerbinati P, Girolami A. Abnormal collagen binding activity of 2A von Willebrand factor: evidence that the defects depends only on the lack of large multimers. J Lab Clin Med. 1997;129:251-259[CrossRef][Medline] [Order article via Infotrieve].
20.
Ruggeri ZM, Mannucci PM, Lombardi R, Federici AB, Zimmerman TS.
Multimeric composition of factor VIII/von Willebrand factor following administration of DDAVP: implications for pathophysiology and therapy in von Willebrand's disease subtypes.
Blood.
1982;59:1272-1278 21. Gibaldi M, Perrier D. Pharmacokinetics. New York, NY: Marcel Dekker; 1975. 22. Bodo' I, Katsumi A, Tuley E, Schlammadinger A, Boda Z, Sadler JE. Mutations causing dominant type 1 von Willebrand disease with high penetrance [abstract]. Blood. 1991;94(suppl 1):1661. 23. Fressinaud E, Federici AB, Castaman G, et al. The role of platelet von Willebrand factor in platelet adhesion and thrombus formation: a study of 34 patients with various subtypes of type I von Willebrand disease. Br J Haematol. 1994;86:127-132. 24. Favaloro EJ, Dean M, Grispo L, Exner T, Koutts J. Von Willebrand's disease: use of collagen binding assay provides potential improvement to laboratory monitoring of desmopressin (DDAVP) therapy. Am J Haematol. 1994;45:205-211[Medline] [Order article via Infotrieve]. 25. Casonato A, Pontara E, Bertomoro A, Sartorello F, Girolami A. Which assay is the most suitable to investigate von Willebrand factor functional activity? Thromb Haemost. 1999;81:994-995[Medline] [Order article via Infotrieve].
26.
Gralnick HR, Williams SB, McKeown LP, et al.
In vitro correction of the abnormal multimeric structure of von Willebrand factor in type IIA von Willebrand's disease: studies with protease inhibitors.
Blood.
1985;68:1207-1212
27.
Dent J, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM.
Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type IIA von Willebrand factor.
Proc Natl Acad Sci U S A.
1990;87:6306-6310
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
F. Rodeghiero, G. Castaman, and A. Tosetto How I treat von Willebrand disease Blood, August 6, 2009; 114(6): 1158 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. van Schooten, S. Shahbazi, E. Groot, B. D. Oortwijn, H. M. van den Berg, C. V. Denis, and P. J. Lenting Macrophages contribute to the cellular uptake of von Willebrand factor and factor VIII in vivo Blood, September 1, 2008; 112(5): 1704 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Haberichter, G. Castaman, U. Budde, I. Peake, A. Goodeve, F. Rodeghiero, A. B. Federici, J. Batlle, D. Meyer, C. Mazurier, et al. Identification of type 1 von Willebrand disease patients with reduced von Willebrand factor survival by assay of the VWF propeptide in the European study: Molecular and Clinical Markers for the Diagnosis and Management of Type 1 VWD (MCMDM-1VWD) Blood, May 15, 2008; 111(10): 4979 - 4985. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Castaman, S. Lethagen, A. B. Federici, A. Tosetto, A. Goodeve, U. Budde, J. Batlle, D. Meyer, C. Mazurier, E. Fressinaud, et al. Response to desmopressin is influenced by the genotype and phenotype in type 1 von Willebrand disease (VWD): results from the European Study MCMDM-1VWD Blood, April 1, 2008; 111(7): 3531 - 3539. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gallinaro, M. G. Cattini, M. Sztukowska, R. Padrini, F. Sartorello, E. Pontara, A. Bertomoro, V. Daidone, A. Pagnan, and A. Casonato A shorter von Willebrand factor survival in O blood group subjects explains how ABO determinants influence plasma von Willebrand factor Blood, April 1, 2008; 111(7): 3540 - 3545. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. M. van Schooten, C. V. Denis, T. Lisman, J. C. J. Eikenboom, F. W. Leebeek, J. Goudemand, E. Fressinaud, H. M. van den Berg, P. G. de Groot, and P. J. Lenting Variations in glycosylation of von Willebrand factor with O-linked sialylated T antigen are associated with its plasma levels Blood, March 15, 2007; 109(6): 2430 - 2437. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Haberichter, M. Balistreri, P. Christopherson, P. Morateck, S. Gavazova, D. B. Bellissimo, M. J. Manco-Johnson, J. C. Gill, and R. R. Montgomery Assay of the von Willebrand factor (VWF) propeptide to identify patients with type 1 von Willebrand disease with decreased VWF survival Blood, November 15, 2006; 108(10): 3344 - 3351. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Michiels, Z. Berneman, A. Gadisseur, M. van der Planken, W. Schroyens, A. van de Velde, and H. van Vliet Characterization of Recessive Severe Type 1 and 3 von Willebrand Disease (VWD), Asymptomatic Heterozygous Carriers Versus Bloodgroup O-Related von Willebrand Factor Deficiency, and Dominant Type 1 VWD Clinical and Applied Thrombosis/Hemostasis, July 1, 2006; 12(3): 277 - 295. [Abstract] [PDF] |
||||
![]() |
A. Schlammadinger, K. Vanhoorelbeke, P. Laszlo, Z. Bereczky, L. Muszbek, H. Deckmyn, and Z. Boda Von Willebrand Factor Antigen Latex Immunoassays are Affected to a Different Extent by Rheumatoid Factor Clinical and Applied Thrombosis/Hemostasis, April 1, 2006; 12(2): 242 - 243. [PDF] |
||||
![]() |
A. Gezsi, G. Balazsi, K. Sallai, A. Mohl, E. Nagy, T. Szabo, J. E. Sadler, and I. Bodo Increased Clearance Explains the Ultra-Large Multimers in Von Willebrand Disease Type 2M Vicenza; Lessons from Recombinant VWF Vicenza and Modeling of Multimer Catabolism. Blood (ASH Annual Meeting Abstracts), November 16, 2004; 104(11): 3669 - 3669. [Abstract] [Full Text] |
||||
![]() |
P. J. Lenting, E. Westein, V. Terraube, A.-S. Ribba, E. G. Huizinga, D. Meyer, P. G. de Groot, and C. V. Denis An Experimental Model to Study the in Vivo Survival of von Willebrand Factor: BASIC ASPECTS AND APPLICATION TO THE R1205H MUTATION J. Biol. Chem., March 26, 2004; 279(13): 12102 - 12109. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Montgomery Responsiveness of patients with VWD to DDAVP Blood, March 15, 2004; 103(6): 1975 - 1976. [Full Text] [PDF] |
||||
![]() |
A. B. Federici, C. Mazurier, E. Berntorp, C. A. Lee, I. Scharrer, J. Goudemand, S. Lethagen, I. Nitu, G. Ludwig, L. Hilbert, et al. Biologic response to desmopressin in patients with severe type 1 and type 2 von Willebrand disease: results of a multicenter European study Blood, March 15, 2004; 103(6): 2032 - 2038. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Sadler Von Willebrand disease type 1: a diagnosis in search of a disease Blood, March 15, 2003; 101(6): 2089 - 2093. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casonato, F. Sartorello, M. G. Cattini, E. Pontara, C. Soldera, A. Bertomoro, and A. Girolami An Arg760Cys mutation in the consensus sequence of the von Willebrand factor propeptide cleavage site is responsible for a new von Willebrand disease variant Blood, January 1, 2003; 101(1): 151 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Castaman, F. Rodeghiero, P. M. Mannucci, A. Casonato, E. Pontara, F. Sartorello, M. G. Cattini, and A. Girolami The elusive pathogenesis of von Willebrand disease Vicenza Blood, May 13, 2002; 99(11): 4243 - 4245. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||