Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, L. M.
Right arrow Articles by Gilliland, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, L. M.
Right arrow Articles by Gilliland, D. G.
Related Collections
Right arrow Neoplasia
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 January 2002, Vol. 99, No. 1, pp. 310-318

NEOPLASIA

FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model

Louise M. Kelly, Qing Liu, Jeffrey L. Kutok, Ifor R. Williams, Christina L. Boulton, and D. Gary Gilliland

From the Division of Hematology/Oncology, Department of Pathology, Brigham and Women's Hospital, and the Howard Hughes Medical Institute, Harvard Medical School, Boston, MA; and Department of Pathology, Emory University, Atlanta, GA.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

FLT3 receptor tyrosine kinase is expressed on lymphoid and myeloid progenitors in the hematopoietic system. Activating mutations in FLT3 have been identified in approximately 30% of patients with acute myelogenous leukemia, making it one of the most common mutations observed in this disease. Frequently, the mutation is an in-frame internal tandem duplication (ITD) in the juxtamembrane region that results in constitutive activation of FLT3, and confers interleukin-3 (IL-3)-independent growth to Ba/F3 and 32D cells. FLT3-ITD mutants were cloned from primary human leukemia samples and assayed for transformation of primary hematopoietic cells using a murine bone marrow transplantation assay. FLT3-ITDs induced an oligoclonal myeloproliferative disorder in mice, characterized by splenomegaly and leukocytosis. The myeloproliferative phenotype, which was associated with extramedullary hematopoiesis in the spleen and liver, was confirmed by histopathologic and flow cytometric analysis. The disease latency of 40 to 60 days with FLT3-ITDs contrasted with wild-type FLT3 and enhanced green fluorescent protein (EGFP) controls, which did not develop hematologic disease (> 200 days). These results demonstrate that FLT3-ITD mutant proteins are sufficient to induce a myeloproliferative disorder, but are insufficient to recapitulate the AML phenotype observed in humans. Additional mutations that impair hematopoietic differentiation may be required for the development of FLT3-ITD-associated acute myeloid leukemias. This model system should be useful to assess the contribution of additional cooperating mutations and to evaluate specific FLT3 inhibitors in vivo. (Blood. 2002;99:310-318)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

FLT3 (FMS-like receptor tyrosine kinase) also referred to as fetal liver kinase 2 (FLK-2) or stem cell tyrosine kinase 1 (STK-1) was originally described as a tyrosine kinase receptor with strong sequence similarity to FMS, KIT, and platelet-derived growth factor receptor (PDGFR).1,2 These proteins are all members of the receptor tyrosine kinase type (RTK) III subfamily based on a common domain structure including an interrupted kinase domain (for review, see Rosnet and Birnbaum3). FLT3 is expressed by cells found in the hematopoietic stem cell compartment (Sca1+, Lin-)1 and in more restricted progenitors of the lymphoid and myeloid series4,5 (for review, see Shurin et al6). Like the other RTK III family members, the stimulation of FLT3 by its ligand (FLT ligand, FL) has been proposed to play a role in cell proliferation.7,8

It is therefore interesting that activating mutations in FLT3 have been found in approximately 25% to 30% of patients with acute myelogenous leukemia (AML).9,10 The majority of FLT3 mutations are internal tandem duplications (ITDs) in the juxtamembrane domain encoded by exon 11, and were first reported in patients with AML in 1996.11 This mutation appears to confer a poor prognosis in several studies reported to date.12-14 All ITD repeats were in-frame, but varied significantly in length. No such ITD abnormalities were detected in remission samples, indicating that these were acquired mutations.11 Subsequent studies have confirmed the presence of the juxtamembrane ITDs in human leukemias, with an overall incidence of approximately 20% in AML. In addition, substitution mutations in the FLT3 kinase domain at Asp835 have recently been reported in approximately 7% of patients with AML.10 Both the FLT3-ITD and FLT3-Asp835 mutations result in constitutive activation of the receptor and are associated with FLT3 autophosphorylation and phosphorylation of downstream targets such as STAT5 and mitogen-activated protein (MAP) kinase.15-18 FLT3-ITD mutations are also found but at much lower frequencies in related diseases such as myelodysplastic syndrome (< 5%)9,10,19 and have rarely been identified in acute lymphocytic leukemia (ALL) unless they are biphenotypic.20

Constitutive activation of RTKs is not unprecedented in leukemias; however, the vast proportion of activated RTKs studied thus far are associated with chronic myelogenous leukemia (CML) phenotypes and occur as a result of a chromosomal translocation. Examples include the BCR/ABL, TEL/PDGFbeta R, TEL/JAK2, HIP1/PDGFbeta R, H4/PDGFbeta R, and TEL/ABL fusion proteins that are expressed as a consequence of the t(9;22)(q34;q22),21-25 t(5;12)(q33;p13),26-30 t(9;12)p(24;p13),31-33 t(5;7)(q33;q11.2),34,35 t(5;10)(q33;q11.2),36,37 and t(9;12)(q34;p13)38 translocations, respectively. Each of these fusion proteins contains a carboxy-terminal tyrosine kinase domain and an amino terminal oligomerization domain that constitutively activates the respective tyrosine kinase (for a review, see Sawyers39). These fusion proteins are all localized to the cytoplasm, and constitutive activation of the respective tyrosine kinase confers factor-independent growth to cultured hematopoietic cell lines.21-38,40,41 Furthermore, each of these fusions is capable of conferring a myeloproliferative phenotype in murine bone marrow transplant (BMT) assays for leukemia,21-38,40,41 indicating that tyrosine kinase fusions are sufficient to induce a myeloproliferative phenotype. Mutational analysis has demonstrated that transformation in cell culture, or in the murine BMT assay, is absolutely dependent on kinase activity.21-38,40,41

Activating mutations in FLT3 differ from tyrosine kinase fusions associated with the CML phenotypes. FLT3-ITD and activating loop mutants are localized to the plasma membrane as opposed to the cytoplasmic localization of tyrosine kinase fusions. The residual tyrosine kinase allele in the tyrosine kinase fusions associated with chromosomal translocations is typically either expressed at low levels or is localized to a different subcellular compartment than the tyrosine kinase fusion. In contrast, both the wild-type and FLT3-ITD alleles are expressed at comparable levels and are localized to the plasma membrane where they may interact. Perhaps most importantly, activating mutations in FLT3 are most frequently associated with AML rather than CML phenotypes.9 Furthermore, FLT3-ITDs are most often observed in AML patients negative for other cytogenetic abnormalities.14 Taken together, these data suggest that FLT3-ITDs may play a critical role in the development of AML.

We have investigated the transforming properties of the FLT3-ITD in primary hematopoietic cells using a murine BMT assay. We report that the FLT3-ITDs cloned from primary human myeloid leukemias confer factor-independent growth to Ba/F3 cells and induce a myeloproliferative phenotype similar to that observed with the translocation-associated tyrosine kinase fusions. These data have important implications for the contribution of the FLT3-ITD to the pathogenesis of human AML. Furthermore, this model should provide a useful system for analysis of cooperativity of FLT3 with other mutations and gene rearrangements associated with human leukemia and for testing of FLT3-specific low molecular weight inhibitors.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cloning and vector construction

The complementary DNA (cDNA) for human FLT3 was kindly provided by H. E. Broxmeyer (Indiana University School of Medicine) and amplified by polymerase chain reaction (PCR) using primers containing an additional HpaI site, flt5'HpaI: GTTAACCATGCCGGCGTTGGCGC and FLT3'HpaI: GTTAACTACGAATCTTCGACC and cloned into pGEM-T easy (Stratagene, La Jolla, CA) according to the manufacturer's instructions and sequenced. After informed consent was obtained, DNA taken from leukemic blasts from 12 patients was screened by PCR strategy for length mutations in exon 11 of the FLT3 gene using the primers, F1: GGTGTTTGTCTCCTCTTCATTGTCA and B1: AAAGCACCTGATCCTAGTACCTTCC, to give a 223-base pair (bp) PCR product following amplification of the wild-type exon. The PCR was performed with Taq polymerase (Perkin Elmer, Foster City, CA) in the manufacturer's buffer including 10% glycerol for 35 cycles at an annealing temperature of 50°C using 3 µM of each primer. Higher molecular weight PCR products, indicative of a length mutation, were subcloned into "pGEM-T easy" and sequenced. The ITD mutations were recreated in the FLT3 cDNA by amplifying 2 PCR products that overlap in the duplicated region within exon 11. To generate the W51 mutation, a PCR product from nucleotides 603 to 1801 was generated using primers FLT3/604F: CAGGGGGAAAGCTGTAAAG and W51B2: GATCATATTCATATTCTCTG. The product was digested with XhoI, which cleaves at nucleotide 874. The second PCR product spanned nucleotides 1781 to 2982 at the end of the cDNA using primers W51F2 (phosphorylated): TCAGAGAATATGAATATGAT and SP6: TATTTAGGTGACACTATAG (binds in pGEM). The second product was digested with SacI, which cleaves in the pGEM polylinker 3' of the FLT3 cDNA. These 2 PCR fragments were ligated resulting in a fragment that contained the appropriate duplication and could be cloned into the XhoI and SacI sites in the FLT3 cDNA to replace the wild-type sequence. The same strategy was used to generate each of the mutants where the primers used to generate the W73, W78, T6, and POS mutant were W73B2: CCATATTCATATTCTCTGAAA and W73F2: GCTCTACGTTGATTTCAGAG; W78B2: CCTTCATATTCTCTGAAATCAACG and W78F2: GTTGGTACAGGTGACCGGCTC; T6B2: CCAAACTCTAAATTTTCTCTTGG and T6F2: TTACGTTGATTTCAGAGAATATG; POSB2: TAAATTTTCTCTTGGAAACTCCCATTTG and POSF2: TGCTCCTCAGATAATGAGTACTTC, respectively.

All FLT3 mutations were confirmed by sequencing and the entire cDNA was subcloned from pGEM to MSCV-EB neo42 or MSCV2.2 GFP (kindly provided by W. Pear, University of Pennsylvania)43 into the HpaI site in each case.

Cell culture and virus production

The Ba/F3 cells were maintained in RPMI, 10% fetal calf serum (FCS), and interleukin-3 (IL-3) (0.5 ng/mL, R & D Systems, Minneapolis, MN). The 293T cells were maintained in Dulbecco modified Eagle medium (DMEM) with 10% FCS. Retroviral stocks were generated as described previously.32 Briefly, transient cotransfection of equimolar amounts of MSCV constructs and a packaging construct, pIK6 (Cell Genesys, Redwood City, CA), was performed in 293T cells using Superfect (Qiagen, Valencia, CA) according to the manufacturer's instructions. Supernatants were harvested 48 hours after transfection, filtered (0.45 µM), and aliquoted for storage at -80°C. Viral titers were estimated by transduction of Ba/F3 cells in the presence of Polybrene (10 µg/mL) as described previously.44 Briefly, cells (1 × 106) were infected for 48 hours and analyzed by flow cytometry to determine the percentage of enhanced green fluorescent protein-positive (EGFP+) cells. Viral titers for all constructs used were normalized to the lowest titer and were used at titers of 1 × 105 infectious units/mL. To test for transforming ability, Ba/F3 cells were transduced as above with MSCV-neo constructs, cultured for 48 hours, and selected with G418 (Life Technologies, Carlsbad, CA) for 14 days. Factor-independent growth was determined by washing resistant cells 3 times in phosphate-buffered saline (PBS) followed by plating in medium without IL-3. Live cells, determined by trypan blue dye exclusion, were counted daily for 7 days.

Mouse strains and BMT

BALB/c mice were purchased from Taconic (Germantown, NY). BMT assays were carried out as described previously.32,44 Briefly, 4- to 6-week-old male donor mice were primed with intraperitoneal injection of 5'-fluorouracil (150 mg/kg, Sigma, St Louis, MO) and subsequently killed after 6 days by CO2 asphyxiation. Bone marrow was flushed from femurs and tibias, and red blood cells were lysed (Red Blood Cell Lysis, RBCL buffer, Sigma). Cells were cultured overnight with IL-3 (6 ng/mL, R & D Systems), IL-6 (10 ng/mL, R & D systems), and stem cell factor (10 ng/mL, Peprotech, Rocky Hill, NJ) in RPMI with 10% FCS (transplant medium). Cells were transduced by 2 rounds of spin-infection, at 24 hours and 48 hours after harvesting. Centrifugation of 1 mL viral supernatant and 4 × 106 cells in 3 mL transplant media containing 5 µg/mL Polybrene and 7.5 mM HEPES buffer was carried out for 90 minutes at 1800g. Cells were washed in PBS, resuspended in Hanks balanced salt solution (Life Technologies) and injected (5 × 105 cells/0.5 mL) into the lateral tail vein of lethally irradiated (2 × 450 cGy) female recipient mice. Mice were housed in microisolator cages with autoclaved chow and acidified water.

Histopathology

Murine tissues were fixed for at least 72 hours in 10% neutral buffered formalin (Sigma), dehydrated in alcohol, cleared in xylene, and infiltrated with paraffin on an automated processor (Leica, Bannockburn, IL). The tissue sections (4 µm thick) from paraffin-embedded tissue blocks were placed on charged slides and deparaffinized in xylene, rehydrated through graded alcohol solutions, and stained with hematoxylin and eosin. To visualize the reticulin fibers, rehydrated sections were sequentially treated with potassium permanganate (0.5%), potassium metabisulfite (2%), ferric ammonium sulfate (2%), ammonical silver solution, formalin (10%), gold chloride (0.2%), potassium metasulfite (2%), sodium thiosulfate (2%), and counterstained with methyl green dye according to the published method.45

Flow cytometric immunophenotyping and fluorescence-activated cell sorting

Single-cell suspensions of spleen, bone marrow, and blood were prepared as described previously.32,44 Briefly, red blood cells were lysed in RBCL buffer (Sigma) for 5 minutes at room temperature and frozen in 90% fetal bovine serum and 10% dimethyl sulfoxide. Prior to analysis, cells were washed in PBS/0.1% NaN3/0.1% bovine serum albumin (BSA) and preincubated for 20 minutes on ice with supernatant from the 2.4G2 hybridoma cell line (anti-CD16/CD32; American Type Culture Collection, Rockville, MD) to block nonspecific Fc receptor-mediated binding. Cells were stained for 20 minutes on ice with monoclonal antibodies, washed in staining buffer, and stained with secondary antibodies where necessary. Antibodies used were allophycocyanin (APC)-conjugated Gr-1 and CD4; phycoerythrin (PE)-conjugated Mac 1, Thy 1.2, and CD8; biotin-conjugated CD19; and APC-conjugated streptavidin. All antibodies were purchased from Pharmingen, San Diego, CA apart from APC-CD4 and APC streptavidin, which were purchased from Caltag, Burlingame, CA. Flow cytometric analysis was carried out using a 4-color FACSort cytometer (Becton Dickinson, Mountain View, CA) and analyzed using CellQuest software.

Fluorescence-activated cell sorting (FACS) was performed on a Coulter Epics Altra at approximately 15 000 cells/s. A single cell suspension from the spleen was resuspended in 1% BSA in PBS at 107 cells/mL and sorted into EGFP+ and EGFP- fractions. Gates were set around the clearly negative and positive cell populations and weakly EGFP+ cells not included in the gates were discarded (Figure 5C). The EGFP- fraction was 98.3% pure and the EGFP+ fraction was 86.5% pure after sorting. DNA was prepared as described below.

Southern analysis

DNA was prepared using a PUREGENE DNA isolation kit according to the manufacturer's protocol (Gentra Systems, Minneapolis, MN). After enzymatic digestion of 20 µg DNA with either EcoRI or XhoI and electrophoretic separation, the genomic DNA was blotted to Hybond-N+ nylon membranes (Amersham, Arlington Heights, IL) by capillary transfer.46 The green fluorescent protein (GFP) probe was a 750-bp fragment isolated using a NcoI/SalI digest from MSCV-EGFP. The 500-bp granzyme A probe was a kind gift from J. Pollock and T. Ley, Washington University. Probes were labeled with 32P by random priming using Radprime (Life Technologies), and Southern hybridization was performed as described.32

Western analysis

The Ba/F3 cells were washed 3 times in PBS and lysed in 10 mM Tris pH 7.5, 130 mM NaCl, 1% Triton X-100, 10 mM NaF, 10 mM sodium phosphate, 10 mM sodium pyrophosphate, 10 mM EDTA, 1 mM sodium vanadate, and protease inhibitor cocktail tablets (Roche-Boehringer, Indianapolis, IN). Total cell lysate (150 µg) was separated on a 7.5% gel and Western analysis was performed as described previously44 using a 1:200 dilution of anti-FLT3 SC-479 (Santa Cruz, Santa Cruz, CA) as the primary antibody, followed by horseradish peroxidase-conjugated secondary antibody (Amersham Life Science) and visualization by enhanced chemoluminescence (Amersham Life Science).


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Cloning of FLT3-ITD mutations from primary human AML cells

The DNA samples from peripheral blood of 12 patients with AML were screened by PCR (see "Materials and methods") for length mutations in the juxtamembrane region, encoded by exon 11. Four independent FLT3-ITD mutants were cloned, which had a duplicated sequence of between 7 and 25 amino acids (Figure 1). The length and position of the duplication varied between samples and differed from other published FLT3-ITD mutants.9,11,13,15 No abnormalities were observed in samples from 54 healthy individuals, consistent with published data.9 Each FLT3-ITD mutant, including a previously reported FLT3-ITD mutant (Npos is Mut117) positive control, and the wild-type FLT3 gene were subcloned into a MSCV murine ecotropic retrovirus that expressed either the neomycin selectable marker or the EGFP under the control of an internal ribosome entry site (IRES).


View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. A schematic diagram of the FLT3 receptor tyrosine kinase. The extracellular domain is labeled and shaded light gray, arrows point to the transmembrane (hatched box) and juxtamembrane domains, and the 2 protein kinase domains (PTK) are shaded dark gray and labeled. The amino acid sequence of exon 11, which encodes the juxtamembrane sequence, is shown below. WT is the wild-type sequence and W78, W73, W51, Npos, and T6 are the FLT3-ITD mutations where the duplicated residues are shown, together with an arrow indicating the duplication position with respect to wild-type exon 11. The amino terminus is labeled NH2 and the carboxy terminus is labeled COOH.

Expression and transforming properties of FLT3 and FLT3 mutants in Ba/F3 cells

To confirm that the FLT3-ITD mutants we cloned had similar properties to those previously reported, Ba/F3 cells were stably transduced with MSCV-neo retrovirus containing either the wild-type FLT3 or FLT-ITD cDNAs. Pools of transduced cells were maintained in IL-3 and selected with G418 for 2 weeks prior to analysis of factor-independent growth. Each of the FLT3-ITD mutants including the previously reported positive control Npos,17 conferred IL-3 factor-independent growth to Ba/F3 cells. Parental cells or cells stably transduced with the wild-type FLT3 died after IL-3 deprivation (Figure 2A). There were no significant differences in growth rates in replicate experiments over the time course of this assay. A point mutation in the activation loop that inhibits kinase activity of wild-type FLT347 abrogated transforming activity of FLT3-ITD when mutated in the context of W51 (data not shown). Western blot analysis confirmed that the cell pools expressed comparable levels of FLT3 and each FLT3-ITD mutant at the expected molecular weights of approximately 130 and 155 kd (Figure 2B), and that parental Ba/F3 cells did not express FLT3 (Figure 2B). The FLT3 wild-type protein was identified by immunoprecipitation analysis as 2 distinct bands of approximately 130 and 155 kd, respectively. It has been previously demonstrated by expression in COS-1 and COS-7 cells that these 2 bands are generated from a predicted 110-kd protein via posttranslational glycosylation.15,47


View larger version (53K):
[in this window]
[in a new window]
 
Figure 2. Growth rate of Ba/F3 cells expressing wild-type and ITD mutant FLT3 receptor. (A) Cell number is indicated on the y-axis, and time in days on the x-axis. Ba/F3 cells transduced with MSCV-neo retroviruses containing FLT3 wild-type and ITD mutant cDNAs were selected for 14 days with G418 in the presence of IL-3. The cell numbers plotted represent the viable cells in each population over 5 days when cells were cultured in the absence of IL-3. The legend on the right indicates the symbols used for the curves of Ba/F3 cells, cells transduced with wild-type Flt3 (Wt) and each of the FLT3-ITD mutants, W51, W73, W78, T6, and Npos. (B) Western analysis of Ba/F3 cells expressing either wild-type (Wt) or ITD mutant FLT3 using an anti-FLT3 antibody. Two FLT3-specific bands are detected in cells transduced with the FLT3 constructs as indicated by arrows, where the upper band is a more glycosylated form. The position of molecular weight markers of 216 and 91 kd is indicated.

Two independent FLT3-ITD mutants, but not wild-type FLT3, induce a lethal myeloproliferative disease in a murine BMT assay

Donor mice were treated with 5-fluorouracil to increase the number of cycling stem cells for retroviral transduction, as described in "Materials and methods." Equivalent titers of FLT3-ITD or FLT3 were then transduced into primary mouse bone marrow cells using the MSCV-EGFP retrovirus. Transduced bone marrow for each construct was also analyzed by flow cytometry to confirm EGFP expression in a comparable fraction of the transplanted cells. Transduced bone marrow cells were transferred by injection into the lateral tail vein of lethally irradiated syngeneic recipient mice. Mice receiving transplants of cells transduced with retrovirus containing the wild-type FLT3 or the MSCV vector expressing EGFP engrafted normally and had a normal survival with a follow-up of more than 200 days (Figure 3). In contrast, animals transduced with cells containing either the FLT3-ITD/51 or FLT3-ITD/78 developed a lethal hematopoietic disease with a median latency of approximately 40 to 50 days (Figure 3 and Table 1).


View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Kaplan Meier plot of survival. Mice receiving transplants of bone marrow transduced with wild-type FLT3 (n = 8), EGFP (n = 4), FLT3-ITD/51 (n = 9), or FLT3-ITD/78 (n = 8). The percentage of surviving mice (y-axis) is plotted with respect to time in days (x-axis).


                              
View this table:
[in this window]
[in a new window]
 
Table 1. Analysis of mice that received transplants of wild-type FLT3 or FLT3-ITD-transduced bone marrow

Animals receiving transplants of FLT3-ITD developed marked leukocytosis, with a white blood cell (WBC) count ranging from 28 to 145 × 103/µL (Table 1). Differential counts analyzed by the scatter property of peripheral blood of several animals indicated that the increase in WBCs was due almost entirely to neutrophils, which were increased from between 13.7% to 21.8% in 3 controls to 75.7% to 87% in 3 FLT3-ITD-diseased animals analyzed. Animals with FLT3-ITD-induced disease appeared to have a higher proportion of mature neutrophils with fewer immature myeloid cells observed than in animals with myeloproliferative disease associated with other tyrosine kinase fusions.28 The absolute numbers of other blood cells were unchanged and no abnormality in erythrocyte count or composition was observed. Wright-Giemsa stains of peripheral blood demonstrated leukocytosis with myeloid lineage cells in all stages of maturation, predominantly terminally differentiated neutrophils (Figure 4A).


View larger version (141K):
[in this window]
[in a new window]
 
Figure 4. Histopathology of mice receiving transplants of FLT3-ITD-transduced bone marrow. (A) Peripheral blood smear (Wright-Giemsa stain, original magnification × 400) from a representative FLT3-ITD mouse (mouse 51.1) reveals marked leukocytosis comprised predominantly of maturing myeloid elements. (B) Bone marrow from the femur of the same mouse (hematoxylin and eosin, original magnification × 500) reveals features of a myeloproliferative disorder with marked hypercellularity and myeloid hyperplasia consisting predominantly of mature granulocytic elements. Spleen (C) and liver (D) (hematoxylin and eosin, original magnification, × 500) also reveal an identical myeloid infiltrate in the Flt3-ITD mouse (mouse 51.1). (E) Bone marrow of a Flt3-ITD mouse (mouse 78.5) and (F) bone marrow from a wild-type FLT3 mouse. Both were stained to highlight reticulin fibers (black) (original magnification, × 500). There is a marked increase in reticulin fibrosis in the FLT3-ITD mice compared to wild-type FLT3 mice.

Gross pathologic examination demonstrated emaciation, ruffled fur, and marked splenomegaly, with spleen weights ranging from 300 to 1000 mg in FLT3-ITD/51 and 250 to 900 mg in FLT3-ITD/78 compared to 100 to 171 mg in wild-type FLT3 or EGFP controls (Table 1). The slight increase in spleen weight in the controls was typical for animals after irradiation and BM transplantation. Bone marrow stained with hematoxylin-eosin demonstrated hypercellularity with a marked predominance of maturing myeloid lineage cells, consistent with a myeloproliferative disease (Figure 4B). In addition, the bone marrow, as in other mouse models of myeloproliferative disease,48 displayed a significant degree of reticulin fibrosis as demonstrated by silver stain when compared to control FLT3 mice (Figure 4E,F). A reduced yield of cells was obtained from the marrow of FLT3-ITD animals compared to EGFP and wild-type FLT3 controls. Splenic architecture was effaced by a marked expansion of red pulp comprised of maturing myeloid cells (Figure 4C) and scattered admixed megakaryocytes (not shown). Analysis of the liver demonstrated a perivascular parenchymal infiltration comprised predominantly of maturing myeloid elements, with admixed erythroid and megakaryocytic elements similar to that seen in the spleen (Figure 4D). The lungs showed evidence of pulmonary hemorrhage, as observed in BMT assays with other tyrosine kinase fusions such as with TEL/PDGFbeta R28 and TEL/JAK2.48 FLT3-ITD disease was not transplantable into lethally irradiated secondary recipient mice (n = 16) when 1 × 106 spleen cells from 4 independent mice with myeloproliferative disease were used as donors with a follow-up of more than 80 days. This is consistent with observations made in other tyrosine kinase fusion models of myeloproliferative disease.29,32

Flow cytometric analysis of blood and spleen cells from FLT3-ITD mice further confirmed the myeloproliferative phenotype. Several FLT3-ITD animals were examined in detail showing 57% to 70% of cells in the spleen (n = 3) and 70% to 90% of cells in the blood (n = 5) were positive for the late myeloid markers Gr-1 (Ly 6-G) and Mac-1, indicative of mature neutrophils, compared to 5% to 9% and 16% to 24% Gr-1, Mac-1 double-positive cells in spleen and blood of controls, respectively. A representative set of samples of one EGFP control, one wild-type FLT3, and one FLT3-ITD are presented in Figure 5. Gr-1+ cells were also EGFP+, consistent with proviral integration in these cells. In addition, significant proportions of Gr-1+ cells were EGFP- (Figure 5). Potential explanations for this observation include cell nonautonomous contributions to myeloid proliferation,49 lower undetectable levels of EGFP in some clones due to lower expression levels depending on integration site of the provirus, or loss of EGFP by leaching from the short-lived neutrophils, which are highly overrepresented in this disease.50 To address this issue, we sorted cells from the spleen into EGFP- and EGFP+ fractions and carried out Southern analysis for the presence of the provirus in both populations. Hybridization with a probe for EGFP shows that cells both positive and negative for EGFP by flow cytometry carry the provirus (Figure 5C). The blot was hybridized with a second probe (granzyme A) as a control for DNA loading and relative copy number. This indicates that the expansion in the Gr-1+, EGFP- population observed (Figure 5A, B) is probably due to a cell autonomous effect as a direct result of FLT3-ITD expression.


View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. Immunophenotype of cells from the peripheral blood and spleen of FLT3-ITD mice. Spleen (A) and blood (B) cells from mice that received bone marrow transduced with retroviruses encoding EGFP only, wild-type FLT3 and EGFP, or FLT3-ITD (mouse N78.5) and EGFP. Cells were stained with APC-conjugated anti-Gr-1 alone, APC-anti-Gr-1 and PE-conjugated Mac-1, APC-conjugated CD4 and PE-conjugated CD8 or the combination of biotinylated anti-CD19 and PE-conjugated anti-Thy-1.2 followed by APC-conjugated streptavidin. The dot plots are gated for live cells based on forward and side scatter profiles. (C) Retroviral integration. EGFP- and EGFP+ fractions of spleen cells were sorted and the purity of each population is shown using EGFP fluorescence and forward scatter. Southern analysis of these samples, where an EGFP probe demonstrates viral integration or a granzyme A probe demonstrates DNA loading, is shown on the right.

No abnormalities were observed in T-cell (Figure 5A) or B-cell (Figure 5A, B) populations. Comparable results were obtained from immunophenotypic analysis of cells from the bone marrow (n = 4), with an increase in Gr-1+ cells from 54% on average in controls to 87% average in FLT3-ITD mice.

Southern blot analysis of spleen, bone marrow, and blood demonstrated proviral integration in all affected tissues. Data from the spleen are shown in Figure 6, where the DNA was digested to excise the proviral DNA as a single band (3 kb for MSCV-EGFP or 6 kb for the FLT3 series in MSCV-EGFP) or cleaved once within the construct and randomly in the flanking DNA, according to the insertion position, which demonstrated the clonality. DNA integrity and equal loading was demonstrated by reprobing the blot for an endogenous gene, granzyme A (Figure 6, lower panel). Southern blot analysis of control mice sacrificed at the same time confirmed transduction of bone marrow cells with FLT3-ITD and MSCV-EGFP, although these animals did not develop disease. Restriction digests designed to determine clonality indicated that the myeloproliferative disease induced by the FLT3-ITD was oligoclonal (Figure 6, upper panel).


View larger version (120K):
[in this window]
[in a new window]
 
Figure 6. Southern analysis of proviral integration in the spleen cells of animals that received transplants of wild-type FLT3 and FLT3-ITD. For each animal analyzed 2 digests were performed; An XhoI digest (X) cleaves in the retroviral long terminal repeats (LTRs) releasing a fragment corresponding to the intact retrovirus and an EcoRI (E) digest cleaves within the proviral sequence and in the flanking genomic sequence allowing the clonality of the disease to be estimated. The mouse identity number for each construct is shown above the enzyme digest. The upper panel shows hybridization with a probe for EGFP. In the lower panel hybridization of the same blot with a probe for granzyme A exon I and II. The size of molecular weight marker bands is indicated on the left of each panel.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

This is the first demonstration that expression of FLT3-ITD, but not wild-type FLT3, has transforming properties in primary bone marrow cells. FLT3-ITD expression causes a myeloproliferative phenotype characterized by leukocytosis and comprised mainly of mature neutrophils. Splenomegaly with extramedullary hematopoiesis in the spleen and the liver are also consistently observed. Myeloproliferative disease induced by FLT3-ITD has a latency of 40 to 60 days and is oligoclonal.

These findings demonstrate that FLT3-ITD is sufficient to induce a myeloproliferative disease. However, although the FLT3-ITD is primarily associated with AML in humans, it is not sufficient to induce an AML phenotype in the murine BMT assay. These data suggest that FLT3-ITDs may require additional cooperating mutations to generate the AML phenotype. Evidence supporting this hypothesis includes clinical observations that FLT3-ITD may coexist with virtually any known chromosomal translocation associated with AML, including the t(8;21), inv(16), and t(15;17) associated with the AML1/ETO, CBFbeta /MHY11, and PML/RARalpha fusion proteins, respectively14 (S. Schnittger, abstract 3569, American Society of Hematology, 2000). Furthermore, several laboratories have convincingly demonstrated that each of these latter fusions alone is not sufficient to cause AML, but require secondary mutations.51-55 Taken together, these data support a 2-hit model of AML in which one mutation, such as FLT3-ITD, serves primarily to provide proliferative and survival signals to cells, with minimal effects on differentiation. A second mutation, such as the AML1/ETO gene rearrangement, which may confer subtle proliferative or survival advantage, serves primarily to impair hematopoietic differentiation. The combination of these mutations may generate the AML phenotype due to the unregulated proliferation of hematopoietic cells with impaired differentiation.

Initial analysis suggests that FLT3 and FLT3-ITD use the same signal transduction pathways. On stimulation with FL, FLT3 activates signal transduction pathways through engagement of SH2-containing proteins, including PLCgamma , RAS-GTPase activating protein, the p85 subunit of PI3K, SHC, GRB2, STAT5, VAV, FYN, and SRC, among others.17,18,56,57 The consequence of the ITD, regardless of length, appears to be a constitutive increase in FLT3 tyrosine autophosphorylation. Expression of various FLT3-ITD mutants in the murine 32D and Ba/F3 hematopoietic cell lines demonstrates this autophosphorylation, activation of known downstream effectors of FLT3 activation, including PI3K, STAT5, and transformation to growth factor independence.16-18,58 Wild-type FLT3 is expressed at high levels in blast cells of more than 75% of AML patients,59 and is also expressed in a significant proportion of patients with ALL and in leukemia-lymphoma cell lines.11,16,60 The physiologic consequences of FLT3 activation by the ITD differ from activation of wild-type FLT3 by its ligand. The wild-type receptor, when overexpressed in Ba/F3 and 32D cells, may be weakly tyrosine phosphorylated and may activate downstream effectors, but it does not confer factor independent growth. Furthermore, stimulation of FLT3-overexpressing cells with FL is also not sufficient to confer IL-3-independent growth.17,61 In contrast each of the FLT3 mutants that we and others have tested confer factor-independent growth to Ba/F3 cells. It has also been suggested that FLT3-ITD but not wild-type FLT3 activates STAT5 and could be responsible for its constitutive activation in AML samples analyzed.17,62 Furthermore, in the murine BMT assay, FLT3-ITD but not wild-type FLT3, induces a myeloproliferative phenotype. These data indicate that there are qualitative or quantitative differences in signal transduction mediated by FLT-ITD compared to wild-type FLT3.

The mechanism by which the ITD activates the FLT3 tyrosine kinase is not understood. However, insertion of the duplicated residues may disrupt a kinase inhibitory domain, resulting in kinase activation. Several lines of evidence support this hypothesis. First, FLT3-ITD in-frame mutations in patients with AML may range in size from several to more than 40 amino acids and vary in position within the juxtamembrane domain. In addition, it has recently been demonstrated that deletion of several amino acid residues in the juxtamembrane domain of FLT3 also results in constitutive activation of FLT3.58 The observation that a spectrum of insertions or deletions in the JM domain serve to activate the kinase is most consistent with loss of function of a kinase inhibitory domain through disruption of the tertiary structure. Second, in-frame deletions in the juxtamembrane domain of c-KIT, a related type III receptor tyrosine kinase, results in constitutive activation of c-KIT in gastrointestinal stromal cell tumors and mastocytoses.63,64 Third, regulation of the FLT1 receptor tyrosine kinase through an autoinhibitory function of the JM domain has recently been reported.65 Collectively, these data support the hypothesis that disruption of an autoinhibitory motif in the JM domain, either by deletion or insertion, results constitutive activation of the FLT3 kinase. Structural analysis of FLT3 and related mutants will be required to confirm this hypothesis. An additional question regarding the mechanism of FLT3-ITD transformation relates to the involvement of the wild-type FLT3 in modulating the signal transduction by the mutant. It is plausible that wild-type FLT3 could potentiate or impair signal transduction by FLT3-ITD.

The data from the FLT3-ITD murine BMT assay are consistent with previously reported data on the role of FL and FLT3 receptor in hematopoiesis. FL synergizes with other growth factors in colony assays to stimulate proliferation of hematopoietic progenitors and myeloid precursors but not erythroid precursors.66,67 Furthermore, mice that do not express the FLT3 receptor have reduced B lymphopoiesis.68 On transplantation, reduced T lymphopoiesis and myelopoiesis are also observed.68 Mice that lack FL have reduced numbers of myeloid and B-lymphoid progenitors and a deficiency in natural killer and dendritic cells.69 In addition, mice treated with exogenous FL accumulate progenitor cells in the peripheral blood.70 Overexpression of FL in a BMT assay induces a proliferative phenotype71 and can predispose animals to leukemia after a 5-month latency period where the malignant cells were all shown to express FLT3.72 Taken together these data suggest that the FLT3-FL signaling pathway has a unique role in expansion of stem and progenitor cells and sustained activation of FLT3 can lead to hyperproliferation of cells expressing the FLT3 receptor.

Our findings confirm the role of FLT3 in cellular proliferation and support the hypothesis that FLT3-ITD mutations contribute to the pathogenesis of human leukemias. Each independent FLT3-ITD mutant tested was sufficient to induce a myeloproliferative disease in the murine BMT assay, a phenotype similar to that generated by the activated tyrosine kinases that result from chromosomal translocations.21-38,40,41 These data suggest that it may be worthwhile to investigate other myeloproliferative syndromes, such as myeloid metaplasia with myelofibrosis, polycythemia vera, and essential thrombocythemia, for the presence of activating mutations in FLT3.

Finally, the recently reported successes in the therapy of chronic myelogenous leukemias associated with the BCR/ABL gene rearrangement with the ABL-specific kinase inhibitor STI57173,74 suggest that small molecule inhibitors of FLT3 may have therapeutic efficacy in AML.75 This murine model should also allow pharmacologic and therapeutic properties of small molecule inhibitors to be tested in vivo.


    Acknowledgments

We thank L. Seaton for administrative assistance. We thank J. Daley and S. Lazo for expert cell sorting, and D. Cain and S. Amaral for technical support. We also thank E. Anastasiadou, A. Dash, D. Sternberg, and other members of the Gilliland and Tenen laboratories for valuable discussions.


    Footnotes

Submitted May 7, 2001; accepted September 4, 2001.

Supported in part by National Institutes of Health grants CA66996 and DK50654. L.M.K. is an associate and D.G.G. is an associate investigator of the Howard Hughes Medical Institute.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: D. Gary Gilliland, Harvard Institutes of Medicine, 4 Blackfan Cir, Rm 418, Boston, MA 02115; e-mail: gilliland{at}calvin.bwh.harvard.edu.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Matthews W, Jordan C, Gavin M, Jenkins N, Copeland N, Lemischka I. A receptor tyrosine kinase cDNA isolated from a population of enriched primitive hematopoietic cells and exhibiting close genetic linkage to c-kit. Proc Natl Acad Sci U S A. 1991;88:9026-9039[Abstract/Free Full Text].

2. Rosnet O, Marchetto S, deLapeyriere O, Birnbaum D. Murine Flt3, a gene encoding a novel tyrosine kinase receptor of the PDGFR/CSF1R family. Oncogene. 1991:641-650.

3. Rosnet O, Birnbaum D. Hematopoietic receptors of class III receptor-type tyrosine kinases. Crit Rev Oncog. 1993;4:595-613[Medline] [Order article via Infotrieve].

4. Zeigler FC, Bennett BD, Jordan CT, et al. Cellular and molecular characterization of the role of the flk-2/flt-3 receptor tyrosine kinase in hematopoietic stem cells. Blood. 1994;84:2422-2430[Abstract/Free Full Text].

5. Rappold I, Ziegler BL, Kohler I, et al. Functional and phenotypic characterization of cord blood and bone marrow subsets expressing FLT3 (CD135) receptor tyrosine kinase. Blood. 1997;90:111-125[Abstract/Free Full Text].

6. Shurin M, Esche C, Lotze M. FLT3: receptor and ligand. Biology and potential clinical application. Cytokine Growth Factor Rev. 1998;9:37-48[CrossRef][Medline] [Order article via Infotrieve].

7. Muench MO, Roncarolo MG, Menon S, et al. FLK-2/FLT-3 ligand regulates the growth of early myeloid progenitors isolated from human fetal liver. Blood. 1995;85:963-972[Abstract/Free Full Text].

8. Molineux G, McCrea C, Yan XQ, Kerzic P, McNiece I. Flt-3 ligand synergizes with granulocyte colony-stimulating factor to increase neutrophil numbers and to mobilize peripheral blood stem cells with long-term repopulating potential. Blood. 1997;89:3998-4004[Abstract/Free Full Text].

9. Yokota S, Kiyoi H, Nakao M, et al. Internal tandem duplication of the FLT3 gene is preferentially seen in acute myeloid leukemia and myelodysplastic syndrome among various hematological malignancies. A study on a large series of patients and cell lines. Leukemia. 1997;11:1605-1609[CrossRef][Medline] [Order article via Infotrieve].

10. Yamamoto Y, Kiyoi H, Nakano Y, et al. Activating mutation of D835 within the activation loop of FLT3 in human hematologic malignancies. Blood. 2001;97:2434-2439[Abstract/Free Full Text].

11. Nakao M, Yokota S, Iwai T, et al. Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia. 1996;10:1911-1918[Medline] [Order article via Infotrieve].

12. Kiyoi H, Naoe T, Nakano Y, et al. Prognostic implication of FLT3 and N-RAS gene mutations in acute myeloid leukemia. Blood. 1999;93:3074-3080[Abstract/Free Full Text].

13. Abu-Duhier FM, Goodeve AC, Wilson GA, et al. FLT3 internal tandem duplication mutations in adult acute myeloid leukaemia define a high-risk group. Br J Haematol. 2000;111:190-195[CrossRef][Medline] [Order article via Infotrieve].

14. Meshinchi S, Woods WG, Stirewalt DL, et al. Prevalence and prognostic significance of Flt3 internal tandem duplication in pediatric acute myeloid leukemia. Blood. 2001;97:89-94[Abstract/Free Full Text].

15. Kiyoi H, Towatari M, Yokota S, et al. Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product. Leukemia. 1998;12:1333-1337[CrossRef][Medline] [Order article via Infotrieve].

16. Fenski R, Flesch K, Serve S, Mizuki M, et al. Constitutive activation of FLT3 in acute myeloid leukaemia and its consequences for growth of 32D cells. Br J Haematol. 2000;108:322-330[CrossRef][Medline] [Order article via Infotrieve].

17. Hayakawa F, Towatari M, Kiyoi H, et al. Tandem-duplicated Flt3 constitutively activates STAT5 and MAP kinase and introduces autonomous cell growth in IL-3-dependent cell lines. Oncogene. 2000;19:624-631[CrossRef][Medline] [Order article via Infotrieve].

18. Tse K-F, Mukherjee G, Small D. Constitutive activation of FLT3 stimulates multiple intracellular signal transducers and results in transformation. Leukemia. 2000;14:1766-1776[CrossRef][Medline] [Order article via Infotrieve].

19. Horiike S, Yokota S, Nakao M, et al. Tandem duplications of the FLT3 receptor gene are associated with leukemic transformation of myelodysplasia. Leukemia. 1997;11:1442-1446[CrossRef][Medline] [Order article via Infotrieve].

20. Xu F, Taki T, Yang H, et al. Tandem duplication of the FLT3 gene is found in acute lymphoblastic leukaemia as well as acute myeloid leukaemia but not in myelodysplastic syndrome or juvenile chronic myelogenous leukaemia in children. Br J Haematol. 1999;105:155-162[CrossRef][Medline] [Order article via Infotrieve].

21. Daley GQ, McLaughlin J, Witte ON, Baltimore D. The CML-specific P210 bcr/abl protein, unlike v-abl, does not transform NIH/3T3 fibroblasts. Science. 1987;237:532-535[Abstract/Free Full Text].

22. Matulonis U, Salgia R, Okuda K, Druker B, Griffin JD. Interleukin-3 and p210 BCR/ABL activate both unique and overlapping pathways of signal transduction in a factor-dependent myeloid cell line. Exp Hematol. 1993;21:1460-1466[Medline] [Order article via Infotrieve].

23. Pendergast AM, Gishizky ML, Havlik MH, Witte O. SH1 domain autophosphorylation of P210 BCR/ABL is required for transformation but not growth factor independence. Mol Cell Biol. 1993;13:1728-1736[Abstract/Free Full Text].

24. Pendergast AM, Quilliam LA, Cripe LD, et al. BCR-ABL-induced oncogenesis is mediated by direct interaction with the SH2 domain of the GRB-2 adapter protein. Cell. 1993;75:175-185[CrossRef][Medline] [Order article via Infotrieve].

25. Ilaria RLJ, Van Etten RA. P210 and P190(BCR/ABL) induce the tyrosine phosphorylation and DNA binding activity of multiple specific STAT family members. J Biol Chem. 1996;271:31704-31710[Abstract/Free Full Text].

26. Carroll M, Tomasson MH, Barker GF, Golub TR, Gilliland DG. The TEL/platelet-derived growth factor beta  receptor (PDGFbeta R) fusion in chronic myelomonocytic leukemia is a transforming protein that self-associates and activates PDGFbeta R kinase-dependent signaling pathways. Proc Natl Acad Sci U S A. 1996;93:14845-14850[Abstract/Free Full Text].

27. Carroll M, Ohno-Jones S, Tamura S, et al. CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins. Blood. 1997;90:4947-4952[Abstract/Free Full Text].

28. Tomasson MH, Williams IR, Hasserjian R, et al. TEL/PDGFbeta R induces hematologic malignancy in mice that responds to the tyrosine kinase inhibitor CGP57148. Blood. 1999;93:1707-1714[Abstract/Free Full Text].

29. Tomasson MH, Sternberg DW, Williams IR, et al. Fatal myeloproliferation, induced in mice by TEL/PDGFbeta R expression, depends on PDGFbeta R tyrosines 579/581. J Clin Invest. 2000;105:423-432[Medline] [Order article via Infotrieve].

30. Wilbanks AM, Mahajan S, Frank DA, Druker BJ, Gilliland DG, Carroll M. TEL/PDGFbetaR fusion protein activates STAT1 and STAT5: a common mechanism for transformation by tyrosine kinase fusion proteins. Exp Hematol. 2000;28:5.

31. Lacronique V, Boureux A, Valle VD, et al. A TEL-JAK2 fusion protein with constitutive kinase activity in human leukemia. Science. 1997;278:1309-1312[Abstract/Free Full Text].

32. Schwaller J, Frantsve J, Tomasson M, et al. Transformation of hematopoietic cell lines to growth-factor independence and induction of a fatal myeloid and lymphoproliferative disease in mice by retrovirally transduced TEL/JAK2 fusion gene. EMBO J. 1998;17:5321-5333[CrossRef][Medline] [Order article via Infotrieve].

33. Schwaller J, Parganas E, Wang D, et al. Stat5a/b is essential for the myelo- and lymphoproliferative disease induced by TEL/JAK2. Mol Cell. 2000;6:693-704[CrossRef][Medline] [Order article via Infotrieve].

34. Ross TS, Bernard OA, Berger R, Gilliland DG. Fusion of Huntingtin interacting protein 1 to PDGFbeta R in chronic myelomonocytic leukemia with t(5;7)(q33;q11.2). Blood. 1998;91:4419-4426[Abstract/Free Full Text].

35. Ross TS, Gilliland DG. Transforming properties of the Huntingtin interacting protein 1/platelet-derived growth factor beta receptor fusion protein. J Biol Chem. 1999;274:22328-22336[Abstract/Free Full Text].

36. Kulkami S, Heath C, Partker SEA. Fusion of H4/D10S170 to the platelet-derived growth factor receptor beta in BCR/ABL negative myeloproliferative disorders with a t(5;10)(q33;q21). Cancer Res. 2000;60:3592-3598[Abstract/Free Full Text].

37. Schwaller J, Anastasiadou A, Cain D, et al. H4(D10S170), a gene frequently rearranged in papillary thyroid carcinoma, is fused to the platelet-derived growth factor receptor beta  gene in atypical chronic myeloid leukemia with t(5;10)(q33;q22). Blood. 2001. In press.

38. Golub TR, Goga A, Barker G, et al. Oligomerization of the ABL tyrosine kinase by the ETS protein TEL in human leukemia. Mol Cell Biol. 1996;16:4107-4116[Abstract].

39. Sawyers CL. Molecular abnormalities in myeloid leukemias and myelodysplastic syndromes. Leuk Res. 1998;22:1113-1122[CrossRef][Medline] [Order article via Infotrieve].

40. Papadopoulos P, Ridge SA, Boucher CA, Stocking C, Wiedemann LM. The novel activation of ABL by fusion to an ets-related gene, TEL. Cancer Res. 1995;55:34-38[Abstract/Free Full Text].

41. Peeters P, Raynaud SD, Cools J, et al. Fusion of TEL, the ETS-variant gene 6 (ETV6), to the receptor-associated kinase JAK2 as a result of t(9;12) in a lymphoid and t(9;15;12) in a myeloid leukemia. Blood. 1997;90:2535-2540[Abstract/Free Full Text].

42. Hawley RG, Lieu FH, Fong AZ, Hawley TS. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1994;1:136-138[Medline] [Order article via Infotrieve].

43. Persons DA, Allay JA, Allay ER, et al. Retroviral-mediated transfer of the green fluorescent protein gene into murine hematopoietic cells facilitates scoring and selection of transduced progenitors in vitro and identification of genetically modified cells in vivo. Blood. 1997;90:1777-1786[Abstract/Free Full Text].

44. Liu Q, Schwaller J, Kutok J, et al. Signal transduction and transforming properties of the TEL-TRKC fusions associated with t(12;15)(p13;q25) in congenital fibrosarcoma and acute myelogenous leukemia. EMBO J. 2000;19:1827-1838[CrossRef][Medline] [Order article via Infotrieve].

45. Gomori G. Silver impregnation of reticulum in paraffin sections. Am J Pathol. 1937;13:993-1002.

46. Sambrook J, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. New York: CSHL Press; 1989.

47. Maroc N, Rottapel R, Rosnet O, et al. Biochemical characterization and analysis of the transforming potential of the FLT3/FLK2 receptor tyrosine kinase. Oncogene. 1993;8:909-918[Medline] [Order article via Infotrieve].

48. Schwaller J, Parganas E, Wang D, et al. Stat5 is essential for the myelo- and lymphoproliferative disease induced by TEL/JAK2. Mol Cell. 2000;6:693-704.

49. Zhang X, Ren R. Bcr-Abl efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukemia. Blood. 1998;92:3829-3840[Abstract/Free Full Text].

50. Tomasson MH, Williams IR, Li S, et al. Induction of myeloproliferative disease in mice by tyrosine kinase fusion oncogenes does not require granulocyte-macrophage colony-stimulating factor or interleukin-3. Blood. 2001;97:1435-1441[Abstract/Free Full Text].

51. Grisolano JL, Wesselschmidt RL, Pelicci PG, Ley TJ. Altered myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha under control of cathepsin G regulatory sequences. Blood. 1997;89:376-387[Abstract/Free Full Text].

52. He LZ, Tribioli C, Rivi R, et al. Acute leukemia with promyelocytic features in PML/RARalpha transgenic mice. Proc Natl Acad Sci U S A. 1997;94:5302-5307[Abstract/Free Full Text].

53. Okuda T, Cai Z, Yang S, et al. Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood. 1998;91:3134-3143[Abstract/Free Full Text].

54. Castilla LH, Garrett L, Adya N, et al. The fusion gene Cbfb-MYH11 blocks myeloid differentiation and predisposes mice to acute myelomonocytic leukaemia. Nat Genet. 1999;23:144-146[CrossRef][Medline] [Order article via Infotrieve].

55. Rhoades KL, Hetherington CJ, Harakawa N, et al. Analysis of the role of AML1-ETO in leukemogenesis, using an inducible transgenic mouse model. Blood. 2000;96:2108-2115[Abstract/Free Full Text].

56. Dosil M, Wang S, Lemischka IR. Mitogenic signaling and substrate specificity of the Flk2/Flt3 receptor tyrosine kinase in fibroblasts and interleukin 3-dependent hematopoietic cells. Mol Cell Biol. 1993;13:6572-6585[Abstract/Free Full Text].

57. Rottapel R, Turck C, Casteran N, et al. Substrate specificities and identification of a putative binding site for PI3K in the carboxy tail of the murine Flt3 receptor tyrosine kinase. Oncogene. 1994;9:1755-1765[Medline] [Order article via Infotrieve].

58. Mizuki M, Fenski R, Halfter H, et al. Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways. Blood. 2000;96:3907-3914[Abstract/Free Full Text].

59. Birg F, Courcoul M, Rosnet O, et al. Expression of the FMS/KIT-like gene FLT3 in human acute leukemias of the myeloid and lymphoid lineages. Blood. 1992;80:2584-2593[Abstract/Free Full Text].

60. Meierhoff G, Dehmel U, Gruss HJ, et al. Expression of FLT3 receptor and FLT3-ligand in human leukemia-lymphoma cell lines. Leukemia. 1995;9:1368-1372[Medline] [Order article via Infotrieve].

61. Zhang S, Mantel C, Broxmeyer H. Flt3 signaling involves tyrosyl-phosphorylation of SHP-2 and SHIP and their association with Grb2 and Shc in Baf3/Flt3 cells. J Leukoc Biol. 1999;65:372-380[Abstract].

62. Zhang S, Fukuda S, Lee Y, et al. Essential role of signal transducer and activator of transcription (Stat)5a but not Stat5b for Flt3-dependent signaling. J Exp Med. 2000;192:719-728[Abstract/Free Full Text].

63. Boissan M, Feger F, Guillosson JJ, Arock M. c-Kit and c-kit mutations in mastocytosis and other hematological diseases. J Leukoc Biol. 2000;67:135-148[Abstract].

64. Hirota S, Isozaki K, Moriyama Y, et al. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 1998;279:577-580[Abstract/Free Full Text].

65. Gille H, Kowalski J, Yu L, et al. A repressor sequence in the juxtamembrane domain of Flt-1 (VEGFR-1) constitutively inhibits vascular endothelial growth factor-dependent phosphatidylinositol 3'-kinase activation and endothelial cell migration. EMBO J. 2000;19:4064-4073[CrossRef][Medline] [Order article via Infotrieve].

66. Jacobsen SE, Okkenhaug C, Myklebust J, Veiby OP, Lyman SD. The FLT3 ligand potently and directly stimulates the growth and expansion of primitive murine bone marrow progenitor cells in vitro: synergistic interactions with interleukin (IL) 11, IL-12, and other hematopoietic growth factors. J Exp Med. 1995;181:1357-1363[Abstract/Free Full Text].

67. Piacibello W, Fubini L, Sanavio F, et al. Effects of human FLT3 ligand on myeloid leukemia cell growth: heterogeneity in response and synergy with other hematopoietic growth factors. Blood. 1995;86:4105-4114[Abstract/Free Full Text].

68. Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity. 1995;3:147-161[CrossRef][Medline] [Order article via Infotrieve].

69. McKenna H, Stocking K, Miller R, et al. Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells. Blood. 2000;95:3489-3497[Abstract/Free Full Text].

70. Brasel K, McKenna H, Morrissey P, et al. Hematologic effects of flt3 ligand in vivo in mice. Blood. 1996;88:2004-2012[Abstract/Free Full Text].

71. Juan T, McNiece I, Van G, et al. Chronic expression of murine flt3 ligand in mice results in increased circulating white blood cell levels and abnormal cellular infiltrates associated with splenic fibrosis. Blood. 1997;90:76-84[Abstract/Free Full Text].

72. Hawley TS, Fong AZ, Griesser H, Lyman SD, Hawley RG. Leukemic predisposition of mice transplanted with gene-modified hematopoietic precursors expressing flt3 ligand. Blood. 1998;92:2003-2011[Abstract/Free Full Text].

73. Gambacorti-Passerini C, Barni R, Marchesi E, et al. Sensitivity to the abl inhibitor STI571 in fresh leukaemic cells obtained from chronic myelogenous leukaemia patients in different stages of disease. Br J Haematol. 2001;112:972-974[CrossRef][Medline] [Order article via Infotrieve].

74. Druker BJ, Talpaz M, Resta DJ, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 2001;344:1031-1037[Abstract/Free Full Text].

75. Zhao M, Kiyoi H, Yamamoto Y, et al. In vivo treatment of mutant FLT3-transformed murine leukemia with a tyrosine kinase inhibitor. Leukemia. 2000;14:374-378[CrossRef][Medline] [Order article via Infotrieve].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?

Related Letter in Blood Online:

Platelet-dependent action of high-dose factor VIIa
Maureane Hoffman, Dougald M. Monroe, Harold R. Roberts, Kenneth G. Mann, and Saulius Butenas
Blood 2002 100: 364-366. [Full Text] [PDF]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Haeno, R. L. Levine, D. G. Gilliland, and F. Michor
A progenitor cell origin of myeloid malignancies
PNAS, September 29, 2009; 106(39): 16616 - 16621.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Fukuda, P. Singh, A. Moh, M. Abe, E. M. Conway, H. S. Boswell, S. Yamaguchi, X.-Y. Fu, and L. M. Pelus
Survivin mediates aberrant hematopoietic progenitor cell proliferation and acute leukemia in mice induced by internal tandem duplication of Flt3
Blood, July 9, 2009; 114(2): 394 - 403.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Breitenbuecher, S. Schnittger, R. Grundler, B. Markova, B. Carius, A. Brecht, J. Duyster, T. Haferlach, C. Huber, and T. Fischer
Identification of a novel type of ITD mutations located in nonjuxtamembrane domains of the FLT3 tyrosine kinase receptor
Blood, April 23, 2009; 113(17): 4074 - 4077.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. Schmidt-Arras, S.-A. Bohmer, S. Koch, J. P. Muller, L. Blei, H. Cornils, R. Bauer, S. Korasikha, C. Thiede, and F.-D. Bohmer
Anchoring of FLT3 in the endoplasmic reticulum alters signaling quality
Blood, April 9, 2009; 113(15): 3568 - 3576.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. von Bubnoff, R. A. Engh, E. Aberg, J. Sanger, C. Peschel, and J. Duyster
FMS-Like Tyrosine Kinase 3-Internal Tandem Duplication Tyrosine Kinase Inhibitors Display a Nonoverlapping Profile of Resistance Mutations In vitro
Cancer Res., April 1, 2009; 69(7): 3032 - 3041.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. G. Cornejo, M. G. Kharas, M. B. Werneck, S. L. Bras, S. A. Moore, B. Ball, M. Beylot-Barry, S. J. Rodig, J. C. Aster, B. H. Lee, et al.
Constitutive JAK3 activation induces lymphoproliferative syndromes in murine bone marrow transplantation models
Blood, March 19, 2009; 113(12): 2746 - 2754.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Nordigarden, M. Kraft, P. Eliasson, V. Labi, E. W.-F. Lam, A. Villunger, and J.-I. Jonsson
BH3-only protein Bim more critical than Puma in tyrosine kinase inhibitor-induced apoptosis of human leukemic cells and transduced hematopoietic progenitors carrying oncogenic FLT3
Blood, March 5, 2009; 113(10): 2302 - 2311.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Akagi, L.-Y. Shih, M. Kato, N. Kawamata, G. Yamamoto, M. Sanada, R. Okamoto, C. W. Miller, D.-C. Liang, S. Ogawa, et al.
Hidden abnormalities and novel classification of t(15;17) acute promyelocytic leukemia (APL) based on genomic alterations
Blood, February 19, 2009; 113(8): 1741 - 1748.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Weisberg, J. Roesel, G. Bold, P. Furet, J. Jiang, J. Cools, R. D. Wright, E. Nelson, R. Barrett, A. Ray, et al.
Antileukemic effects of the novel, mutant FLT3 inhibitor NVP-AST487: effects on PKC412-sensitive and -resistant FLT3-expressing cells
Blood, December 15, 2008; 112(13): 5161 - 5170.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. F. Tam, T.-L. Gu, J. Chen, B. H. Lee, L. Bullinger, S. Frohling, A. Wang, S. Monti, T. R. Golub, and D. G. Gilliland
Id1 is a common downstream target of oncogenic tyrosine kinases in leukemic cells
Blood, September 1, 2008; 112(5): 1981 - 1992.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Kikushige, G. Yoshimoto, T. Miyamoto, T. Iino, Y. Mori, H. Iwasaki, H. Niiro, K. Takenaka, K. Nagafuji, M. Harada, et al.
Human Flt3 Is Expressed at the Hematopoietic Stem Cell and the Granulocyte/Macrophage Progenitor Stages to Maintain Cell Survival
J. Immunol., June 1, 2008; 180(11): 7358 - 7367.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. M. Loriaux, R. L. Levine, J. W. Tyner, S. Frohling, C. Scholl, E. P. Stoffregen, G. Wernig, H. Erickson, C. A. Eide, R. Berger, et al.
High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia
Blood, May 1, 2008; 111(9): 4788 - 4796.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Weisberg, L. Banerji, R. D. Wright, R. Barrett, A. Ray, D. Moreno, L. Catley, J. Jiang, E. Hall-Meyers, M. Sauveur-Michel, et al.
Potentiation of antileukemic therapies by the dual PI3K/PDK-1 inhibitor, BAG956: effects on BCR-ABL- and mutant FLT3-expressing cells
Blood, April 1, 2008; 111(7): 3723 - 3734.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Li, O. Piloto, H. B. Nguyen, K. Greenberg, K. Takamiya, F. Racke, D. Huso, and D. Small
Knock-in of an internal tandem duplication mutation into murine FLT3 confers myeloproliferative disease in a mouse model
Blood, April 1, 2008; 111(7): 3849 - 3858.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Garzon, M. Garofalo, M. P. Martelli, R. Briesewitz, L. Wang, C. Fernandez-Cymering, S. Volinia, C.-G. Liu, S. Schnittger, T. Haferlach, et al.
Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin
PNAS, March 11, 2008; 105(10): 3945 - 3950.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H.-G. Kim, K. Kojima, C. S. Swindle, C. V. Cotta, Y. Huo, V. Reddy, and C. A. Klug
FLT3-ITD cooperates with inv(16) to promote progression to acute myeloid leukemia
Blood, February 1, 2008; 111(3): 1567 - 1574.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. V. Barry, J. J. Clark, J. Cools, J. Roesel, and D. G. Gilliland
Uniform sensitivity of FLT3 activation loop mutants to the tyrosine kinase inhibitor midostaurin
Blood, December 15, 2007; 110(13): 4476 - 4479.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
E. Weisberg, A. L. Kung, R. D. Wright, D. Moreno, L. Catley, A. Ray, L. Zawel, M. Tran, J. Cools, G. Gilliland, et al.
Potentiation of antileukemic therapies by Smac mimetic, LBW242: effects on mutant FLT3-expressing cells
Mol. Cancer Ther., July 1, 2007; 6(7): 1951 - 1961.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. Wagner-Ballon, D. F. Pisani, T. Gastinne, M. Tulliez, R. Chaligne, C. Lacout, F. Aurade, J.-L. Villeval, P. Gonin, W. Vainchenker, et al.
Proteasome inhibitor bortezomib impairs both myelofibrosis and osteosclerosis induced by high thrombopoietin levels in mice
Blood, July 1, 2007; 110(1): 345 - 353.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Mrozek, G. Marcucci, P. Paschka, S. P. Whitman, and C. D. Bloomfield
Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification?
Blood, January 15, 2007; 109(2): 431 - 448.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Knapper, A. K. Burnett, T. Littlewood, W. J. Kell, S. Agrawal, R. Chopra, R. Clark, M. J. Levis, and D. Small
A phase 2 trial of the FLT3 inhibitor lestaurtinib (CEP701) as first-line treatment for older patients with acute myeloid leukemia not considered fit for intensive chemotherapy
Blood, November 15, 2006; 108(10): 3262 - 3270.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Knapper, K. I. Mills, A. F. Gilkes, S. J. Austin, V. Walsh, and A. K. Burnett
The effects of lestaurtinib (CEP701) and PKC412 on primary AML blasts: the induction of cytotoxicity varies with dependence on FLT3 signaling in both FLT3-mutated and wild-type cases
Blood, November 15, 2006; 108(10): 3494 - 3503.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Levis
FLT3: the root of the problem
Blood, October 15, 2006; 108(8): 2501 - 2502.
[Full Text] [PDF]


Home page
BloodHome page
J. L. Rocnik, R. Okabe, J.-C. Yu, B. H. Lee, N. Giese, D. P. Schenkein, and D. G. Gilliland
Roles of tyrosine 589 and 591 in STAT5 activation and transformation mediated by FLT3-ITD
Blood, August 15, 2006; 108(4): 1339 - 1345.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Palmqvist, B. Argiropoulos, N. Pineault, C. Abramovich, L. M. Sly, G. Krystal, A. Wan, and R. K. Humphries
The Flt3 receptor tyrosine kinase collaborates with NUP98-HOX fusions in acute myeloid leukemia
Blood, August 1, 2006; 108(3): 1030 - 1036.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Wernig, T. Mercher, R. Okabe, R. L. Levine, B. H. Lee, and D. G. Gilliland
Expression of Jak2V617F causes a polycythemia vera-like disease with associated myelofibrosis in a murine bone marrow transplant model
Blood, June 1, 2006; 107(11): 4274 - 4281.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Reindl, K. Bagrintseva, S. Vempati, S. Schnittger, J. W. Ellwart, K. Wenig, K.-P. Hopfner, W. Hiddemann, and K. Spiekermann
Point mutations in the juxtamembrane domain of FLT3 define a new class of activating mutations in AML
Blood, May 1, 2006; 107(9): 3700 - 3707.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Adam, V. Pogacic, M. Bendit, R. Chappuis, M. C. Nawijn, J. Duyster, C. J. Fox, C. B. Thompson, J. Cools, and J. Schwaller
Targeting PIM Kinases Impairs Survival of Hematopoietic Cells Transformed by Kinase Inhibitor-Sensitive and Kinase Inhibitor-Resistant Forms of Fms-Like Tyrosine Kinase 3 and BCR/ABL.
Cancer Res., April 1, 2006; 66(7): 3828 - 3835.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Amino, Y. Ideyama, M. Yamano, S. Kuromitsu, K. Tajinda, K. Samizu, H. Hisamichi, A. Matsuhisa, K. Shirasuna, M. Kudoh, et al.
YM-359445, an Orally Bioavailable Vascular Endothelial Growth Factor Receptor-2 Tyrosine Kinase Inhibitor, Has Highly Potent Antitumor Activity against Established Tumors
Clin. Cancer Res., March 1, 2006; 12(5): 1630 - 1638.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. S. Radomska, D. S. Basseres, R. Zheng, P. Zhang, T. Dayaram, Y. Yamamoto, D. W. Sternberg, N. Lokker, N. A. Giese, S. K. Bohlander, et al.
Block of C/EBP{alpha} function by phosphorylation in acute myeloid leukemia with FLT3 activating mutations
J. Exp. Med., February 21, 2006; 203(2): 371 - 381.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
D. Small
FLT3 Mutations: Biology and Treatment
Hematology, January 1, 2006; 2006(1): 178 - 184.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. H. Stover, J. Chen, B. H. Lee, J. Cools, E. McDowell, J. Adelsperger, D. Cullen, A. Coburn, S. A. Moore, R. Okabe, et al.
The small molecule tyrosine kinase inhibitor AMN107 inhibits TEL-PDGFR{beta} and FIP1L1-PDGFR{alpha} in vitro and in vivo
Blood, November 1, 2005; 106(9): 3206 - 3213.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Suzuki, H. Kiyoi, K. Ozeki, A. Tomita, S. Yamaji, R. Suzuki, Y. Kodera, S. Miyawaki, N. Asou, K. Kuriyama, et al.
Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia
Blood, October 15, 2005; 106(8): 2854 - 2861.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. Frohling, C. Scholl, D. G. Gilliland, and R. L. Levine
Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications
J. Clin. Oncol., September 10, 2005; 23(26): 6285 - 6295.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Yang, L. Liu, D. Sternberg, L. Tang, I. Galinsky, D. DeAngelo, and R. Stone
The FLT3 Internal Tandem Duplication Mutation Prevents Apoptosis in Interleukin-3-Deprived BaF3 Cells Due to Protein Kinase A and Ribosomal S6 Kinase 1-Mediated BAD Phosphorylation at Serine 112
Cancer Res., August 15, 2005; 65(16): 7338 - 7347.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Choudhary, J. Schwable, C. Brandts, L. Tickenbrock, B. Sargin, T. Kindler, T. Fischer, W. E. Berdel, C. Muller-Tidow, and H. Serve
AML-associated Flt3 kinase domain mutations show signal transduction differences compared with Flt3 ITD mutations
Blood, July 1, 2005; 106(1): 265 - 273.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Grundler, C. Miething, C. Thiede, C. Peschel, and J. Duyster
FLT3-ITD and tyrosine kinase domain mutants induce 2 distinct phenotypes in a murine bone marrow transplantation model
Blood, June 15, 2005; 105(12): 4792 - 4799.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bagrintseva, S. Geisenhof, R. Kern, S. Eichenlaub, C. Reindl, J. W. Ellwart, W. Hiddemann, and K. Spiekermann
FLT3-ITD-TKD dual mutants associated with AML confer resistance to FLT3 PTK inhibitors and cytotoxic agents by overexpression of Bcl-x(L)
Blood, May 1, 2005; 105(9): 3679 - 3685.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Di Croce
Chromatin modifying activity of leukaemia associated fusion proteins
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R77 - R84.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Fukuda, H. E. Broxmeyer, and L. M. Pelus
Flt3 ligand and the Flt3 receptor regulate hematopoietic cell migration by modulating the SDF-1{alpha}(CXCL12)/CXCR4 axis
Blood, April 15, 2005; 105(8): 3117 - 3126.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. F. Landrette, Y.-H. Kuo, K. Hensen, S. B. van Waalwijk van Doorn-Khosrovani, P. N. Perrat, W. J. M. Van de Ven, R. Delwel, and L. H. Castilla
Plag1 and Plagl2 are oncogenes that induce acute myeloid leukemia in cooperation with Cbfb-MYH11
Blood, April 1, 2005; 105(7): 2900 - 2907.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Schwable, C. Choudhary, C. Thiede, L. Tickenbrock, B. Sargin, C. Steur, M. Rehage, A. Rudat, C. Brandts, W. E. Berdel, et al.
RGS2 is an important target gene of Flt3-ITD mutations in AML and functions in myeloid differentiation and leukemic transformation
Blood, March 1, 2005; 105(5): 2107 - 2114.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Chen, M. Levis, P. Brown, K.-T. Kim, J. Allebach, and D. Small
FLT3/ITD Mutation Signaling Includes Suppression of SHP-1
J. Biol. Chem., February 18, 2005; 280(7): 5361 - 5369.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. George, P. Bali, S. Annavarapu, A. Scuto, W. Fiskus, F. Guo, C. Sigua, G. Sondarva, L. Moscinski, P. Atadja, et al.
Combination of the histone deacetylase inhibitor LBH589 and the hsp90 inhibitor 17-AAG is highly active against human CML-BC cells and AML cells with activating mutation of FLT-3
Blood, February 15, 2005; 105(4): 1768 - 1776.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. Fiedler, H. Serve, H. Dohner, M. Schwittay, O. G. Ottmann, A.-M. O'Farrell, C. L. Bello, R. Allred, W. C. Manning, J. M. Cherrington, et al.
A phase 1 study of SU11248 in the treatment of patients with refractory or resistant acute myeloid leukemia (AML) or not amenable to conventional therapy for the disease
Blood, February 1, 2005; 105(3): 986 - 993.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Brown, M. Levis, S. Shurtleff, D. Campana, J. Downing, and D. Small
FLT3 inhibition selectively kills childhood acute lymphoblastic leukemia cells with high levels of FLT3 expression
Blood, January 15, 2005; 105(2): 812 - 820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Wadleigh, D. J. DeAngelo, J. D. Griffin, and R. M. Stone
After chronic myelogenous leukemia: tyrosine kinase inhibitors in other hematologic malignancies
Blood, January 1, 2005; 105(1): 22 - 30.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. M. Stone, D. J. DeAngelo, V. Klimek, I. Galinsky, E. Estey, S. D. Nimer, W. Grandin, D. Lebwohl, Y. Wang, P. Cohen, et al.
Patients with acute myeloid leukemia and an activating mutation in FLT3 respond to a small-molecule FLT3 tyrosine kinase inhibitor, PKC412
Blood, January 1, 2005; 105(1): 54 - 60.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Y. Chung, G. Morrone, J. J. Schuringa, B. Wong, D. C. Dorn, and M. A. S. Moore
Enforced expression of an Flt3 internal tandem duplication in human CD34+ cells confers properties of self-renewal and enhanced erythropoiesis
Blood, January 1, 2005; 105(1): 77 - 84.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Koschmieder, B. Gottgens, P. Zhang, J. Iwasaki-Arai, K. Akashi, J. L. Kutok, T. Dayaram, K. Geary, A. R. Green, D. G. Tenen, et al.
Inducible chronic phase of myeloid leukemia with expansion of hematopoietic stem cells in a transgenic model of BCR-ABL leukemogenesis
Blood, January 1, 2005; 105(1): 324 - 334.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Kindler, F. Breitenbuecher, S. Kasper, E. Estey, F. Giles, E. Feldman, G. Ehninger, G. Schiller, V. Klimek, S. D. Nimer, et al.
Identification of a novel activating mutation (Y842C) within the activation loop of FLT3 in patients with acute myeloid leukemia (AML)
Blood, January 1, 2005; 105(1): 335 - 340.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. W. H. Yee, M. Schittenhelm, A.-M. O'Farrell, A. R. Town, L. McGreevey, T. Bainbridge, J. M. Cherrington, and M. C. Heinrich
Synergistic effect of SU11248 with cytarabine or daunorubicin on FLT3 ITD-positive leukemic cells
Blood, December 15, 2004; 104(13): 4202 - 4209.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. J. Lacayo, S. Meshinchi, P. Kinnunen, R. Yu, Y. Wang, C. M. Stuber, L. Douglas, R. Wahab, D. L. Becton, H. Weinstein, et al.
Gene expression profiles at diagnosis in de novo childhood AML patients identify FLT3 mutations with good clinical outcomes
Blood, November 1, 2004; 104(9): 2646 - 2654.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. Clark, J. Cools, D. P. Curley, J.-C. Yu, N. A. Lokker, N. A. Giese, and D. G. Gilliland
Variable sensitivity of FLT3 activation loop mutations to the small molecule tyrosine kinase inhibitor MLN518
Blood, November 1, 2004; 104(9): 2867 - 2872.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. J. Griswold, L. J. Shen, P. La Rosee, S. Demehri, M. C. Heinrich, R. M. Braziel, L. McGreevey, A. D. Haley, N. Giese, B. J. Druker, et al.
Effects of MLN518, a dual FLT3 and KIT inhibitor, on normal and malignant hematopoiesis
Blood, November 1, 2004; 104(9): 2912 - 2918.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Jiang, J. G. Paez, J. C. Lee, R. Bo, R. M. Stone, D. J. DeAngelo, I. Galinsky, B. M. Wolpin, A. Jonasova, P. Herman, et al.
Identifying and characterizing a novel activating mutation of the FLT3 tyrosine kinase in AML
Blood, September 15, 2004; 104(6): 1855 - 1858.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
Y. Li, H. Li, M.-N. Wang, D. Lu, R. Bassi, Y. Wu, H. Zhang, P. Balderes, D. L. Ludwig, B. Pytowski, et al.
Suppression of leukemia expressing wild-type or ITD-mutant FLT3 receptor by a fully human anti-FLT3 neutralizing antibody
Blood, August 15, 2004; 104(4): 1137 - 1144.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. Bali, P. George, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, A. Scuto, S. Annavarapu, W. Fiskus, et al.
Superior Activity of the Combination of Histone Deacetylase Inhibitor LAQ824 and the FLT-3 Kinase Inhibitor PKC412 against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3
Clin. Cancer Res., August 1, 2004; 10(15): 4991 - 4997.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Loh and K. M. Shannon
A "Ras-in-ALL" model of signaling?
Blood, July 15, 2004; 104(2): 297 - 298.
[Full Text] [PDF]


Home page
BloodHome page
L. C. Platanias
SMRT interactions, repression, and Flt3-ITD
Blood, June 15, 2004; 103(12): 4382 - 4382.
[Full Text] [PDF]


Home page
BloodHome page
S. Takahashi, M. J. McConnell, H. Harigae, M. Kaku, T. Sasaki, A. M. Melnick, and J. D. Licht
The Flt3 internal tandem duplication mutant inhibits the function of transcriptional repressors by blocking interactions with SMRT
Blood, June 15, 2004; 103(12): 4650 - 4658.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. T. Le, N. Kong, Y. Zhu, J. O. Lauchle, A. Aiyigari, B. S. Braun, E. Wang, S. C. Kogan, M. M. Le Beau, L. Parada, et al.
Somatic inactivation of Nf1 in hematopoietic cells results in a progressive myeloproliferative disorder
Blood, June 1, 2004; 103(11): 4243 - 4250.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. George, P. Bali, P. Cohen, J. Tao, F. Guo, C. Sigua, A. Vishvanath, W. Fiskus, A. Scuto, S. Annavarapu, et al.
Cotreatment with 17-Allylamino-Demethoxygeldanamycin and FLT-3 Kinase Inhibitor PKC412 Is Highly Effective against Human Acute Myelogenous Leukemia Cells with Mutant FLT-3
Cancer Res., May 15, 2004; 64(10): 3645 - 3652.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. D. Smith, M. Levis, M. Beran, F. Giles, H. Kantarjian, K. Berg, K. M. Murphy, T. Dauses, J. Allebach, and D. Small
Single-agent CEP-701, a novel FLT3 inhibitor, shows biologic and clinical activity in patients with relapsed or refractory acute myeloid leukemia
Blood, May 15, 2004; 103(10): 3669 - 3676.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Bagrintseva, R. Schwab, T. M. Kohl, S. Schnittger, S. Eichenlaub, J. W. Ellwart, W. Hiddemann, and K. Spiekermann
Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells
Blood, March 15, 2004; 103(6): 2266 - 2275.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Zheng, A. D. Friedman, M. Levis, L. Li, E. G. Weir, and D. Small
Internal tandem duplication mutation of FLT3 blocks myeloid differentiation through suppression of C/EBP{alpha} expression
Blood, March 1, 2004; 103(5): 1883 - 1890.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Taketani, T. Taki, K. Sugita, Y. Furuichi, E. Ishii, R. Hanada, M. Tsuchida, K. Sugita, K. Ida, and Y. Hayashi
FLT3 mutations in the activation loop of tyrosine kinase domain are frequently found in infant ALL with MLL rearrangements and pediatric ALL with hyperdiploidy
Blood, February 1, 2004; 103(3): 1085 - 1088.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. S. Braun, D. A. Tuveson, N. Kong, D. T. Le, S. C. Kogan, J. Rozmus, M. M. Le Beau, T. E. Jacks, and K. M. Shannon
Somatic activation of oncogenic Kras in hematopoietic cells initiates a rapidly fatal myeloproliferative disorder
PNAS, January 13, 2004; 101(2): 597 - 602.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
D. G. Gilliland, C. T. Jordan, and C. A. Felix
The Molecular Basis of Leukemia
Hematology, January 1, 2004; 2004(1): 80 - 97.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A.-M. O'Farrell, J. M. Foran, W. Fiedler, H. Serve, R. L. Paquette, M. A. Cooper, H. A. Yuen, S. G. Louie, H. Kim, S. Nicholas, et al.
An Innovative Phase I Clinical Study Demonstrates Inhibition of FLT3 Phosphorylation by SU11248 in Acute Myeloid Leukemia Patients
Clin. Cancer Res., November 15, 2003; 9(15): 5465 - 5476.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. M. Zwaan, S. Meshinchi, J. P. Radich, A. J. P. Veerman, D. R. Huismans, L. Munske, M. Podleschny, K. Hahlen, R. Pieters, M. Zimmermann, et al.
FLT3 internal tandem duplication in 234 children with acute myeloid leukemia: prognostic significance and relation to cellular drug resistance
Blood, October 1, 2003; 102(7): 2387 - 2394.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Wong, J. McLaughlin, D. Cheng, K. Shannon, L. Robb, and O. N. Witte
IL-3 receptor signaling is dispensable for BCR-ABL-induced myeloproliferative disease
PNAS, September 30, 2003; 100(20): 11630 - 11635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Murata, H. Kumagai, T. Kawashima, K. Tamitsu, M. Irie, H. Nakajima, S. Suzu, M. Shibuya, S. Kamihira, T. Nosaka, et al.
Selective Cytotoxic Mechanism of GTP-14564, a Novel Tyrosine Kinase Inhibitor in Leukemia Cells Expressing a Constitutively Active Fms-like Tyrosine Kinase 3 (FLT3)
J. Biol. Chem., August 29, 2003; 278(35): 32892 - 32898.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. M. Le Beau, E. M. Davis, B. Patel, V. T. Phan, J. Sohal, and S. C. Kogan
Recurring chromosomal abnormalities in leukemia in PML-RARA transgenic mice identify cooperating events and genetic pathways to acute promyelocytic leukemia
Blood, August 1, 2003; 102(3): 1072 - 1074.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Karsunky, M. Merad, A. Cozzio, I. L. Weissman, and M. G. Manz
Flt3 Ligand Regulates Dendritic Cell Development from Flt3+ Lymphoid and Myeloid-committed Progenitors to Flt3+ Dendritic Cells In Vivo
J. Exp. Med., July 21, 2003; 198(2): 305 - 313.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Grundler, C. Thiede, C. Miething, C. Steudel, C. Peschel, and J. Duyster
Sensitivity toward tyrosine kinase inhibitors varies between different activating mutations of the FLT3 receptor
Blood, July 15, 2003; 102(2): 646 - 651.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Spiekermann, K. Bagrintseva, R. Schwab, K. Schmieja, and W. Hiddemann
Overexpression and Constitutive Activation of FLT3 Induces STAT5 Activation in Primary Acute Myeloid Leukemia Blast Cells
Clin. Cancer Res., June 1, 2003; 9(6): 2140 - 2150.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A.-M. O'Farrell, T. J. Abrams, H. A. Yuen, T. J. Ngai, S. G. Louie, K. W. H. Yee, L. M. Wong, W. Hong, L. B. Lee, A. Town, et al.
SU11248 is a novel FLT3 tyrosine kinase inhibitor with potent activity in vitro and in vivo
Blood, May 1, 2003; 101(9): 3597 - 3605.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Mizuki, J. Schwable, C. Steur, C. Choudhary, S. Agrawal, B. Sargin, B. Steffen, I. Matsumura, Y. Kanakura, F. D. Bohmer, et al.
Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations
Blood, April 15, 2003; 101(8): 3164 - 3173.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Sohal, V. T. Phan, P. V. Chan, E. M. Davis, B. Patel, L. M. Kelly, T. J. Abrams, A. M. O'Farrell, D. G. Gilliland, M. M. Le Beau, et al.
A model of APL with FLT3 mutation is responsive to retinoic acid and a receptor tyrosine kinase inhibitor, SU11657
Blood, April 15, 2003; 101(8): 3188 - 3197.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Spiekermann, R. J. Dirschinger, R. Schwab, K. Bagrintseva, F. Faber, C. Buske, S. Schnittger, L. M. Kelly, D. G. Gilliland, and W. Hiddemann
The protein tyrosine kinase inhibitor SU5614 inhibits FLT3 and induces growth arrest and apoptosis in AML-derived cell lines expressing a constitutively activated FLT3
Blood, February 15, 2003; 101(4): 1494 - 1504.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Ravandi, M. Talpaz, and Z. Estrov
Modulation of Cellular Signaling Pathways: Prospects for Targeted Therapy in Hematological Malignancies
Clin. Cancer Res., February 1, 2003; 9(2): 535 - 550.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
B. Lowenberg, J. D. Griffin, and M. S. Tallman
Acute Myeloid Leukemia and Acute Promyelocytic Leukemia
Hematology, January 1, 2003; 2003(1): 82 - 101.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Qian, A. A. Fernald, L. A. Godley, R. A. Larson, and M. M. Le Beau
Expression profiling of CD34+ hematopoietic stem/ progenitor cells reveals distinct subtypes of therapy-related acute myeloid leukemia
PNAS, November 12, 2002; 99(23): 14925 - 14930.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Spiekermann, K. Bagrintseva, C. Schoch, T. Haferlach, W. Hiddemann, and S. Schnittger
A new and recurrent activating length mutation in exon 20 of the FLT3 gene in acute myeloid leukemia
Blood, October 16, 2002; 100(9): 3423 - 3425.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. W. H. Yee, A. M. O'Farrell, B. D. Smolich, J. M. Cherrington, G. McMahon, C. L. Wait, L. S. McGreevey, D. J. Griffith, and M. C. Heinrich
SU5416 and SU5614 inhibit kinase activity of wild-type and mutant FLT3 receptor tyrosine kinase
Blood, September 26, 2002; 100(8): 2941 - 2949.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. G. Gilliland and J. D. Griffin
The roles of FLT3 in hematopoiesis and leukemia
Blood, August 13, 2002; 100(5): 1532 - 1542.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. M. Abu-Duhier, A. C. Goodeve, G. A. Wilson, R. S. Carr, I. R. Peake, and J. T. Reilly
FLT3 internal tandem duplication mutations are rare in agnogenic myeloid metaplasia
Blood, June 17, 2002; 100(1): 364 - 364.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. G. B. Leonard, L. B. Travis, K. Addya, G. M. Dores, E. J. Holowaty, K. Bergfeldt, D. Malkin, B. A. Kohler, C. F. Lynch, T. Wiklund, et al.
p53 Mutations in Leukemia and Myelodysplastic Syndrome after Ovarian Cancer
Clin. Cancer Res., May 1, 2002; 8(5): 973 - 985.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelly, L. M.
Right arrow Articles by Gilliland, D. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelly, L. M.
Right arrow Articles by Gilliland, D. G.
Related Collections
Right arrow Neoplasia
Right arrowRelated Letter in Blood Online
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020