|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Departments of Medicine and Haematology, Royal
Infirmary, Glasgow, Scotland.
In clinical trials, the tyrosine kinase inhibitor STI571 has
proven highly effective in reducing leukemic cell burden in chronic myeloid leukemia (CML). The overall sensitivity of CML
CD34+ progenitor cells to STI571 and the degree to which
cell death was dependent on cell cycle status were determined. Stem
cells (Lin Chronic myeloid leukemia (CML) is a clonal
myeloproliferative disease characterized by the t(9;22) chromosome
translocation that, in turn, creates the BCR-ABL
oncogene.1-3 The fusion gene product is a p210 oncoprotein
containing a constitutively active tyrosine kinase that confers certain
growth advantages to the Philadelphia-positive (Ph+) clone
compared with normal hematopoietic cells.4
We have demonstrated recently the existence of a population of
rare, primitive, quiescent stem cells in all chronic-phase CML patient
samples, whether derived from peripheral blood or bone marrow. These
stem cells are predominantly Ph+, express high levels of
CD34+ but lack the markers CD38, CD45RA, or CD71, and can
spontaneously exit G0 to enter a continuously
proliferating state, either in vitro or to produce Ph+
progeny in immunocompromised mice in vivo.5,6
Many cancers are treated with relatively nonselective cytotoxic drugs
that affect normal and malignant cells. Because most available
chemotherapeutic agents show some degree of S-phase specificity, cells
that are not actively dividing may prove resistant to such drugs. This
raises the possibility that the quiescent leukemic cells we have
identified in patients with CML are likely to survive standard
chemotherapy regimens, and it may explain the clinical observation
that, unlike acute myeloid leukemia, CML cannot be eradicated by
chemotherapy alone.7,8
The recent development of a novel, molecularly targeted,
anticancer agent has heralded a major breakthrough in leukemia
therapy.9-11 STI571 (Glivec; Novartis Pharmaceuticals,
Basel, Switzerland) is a signal transduction inhibitor that
acts specifically on the p210BCR-ABL tyrosine
kinase.9,10 In vitro, this agent selectively suppresses the growth of primary CML colony-forming cells and of
BCR-ABL+ cell lines11,12 and can eradicate
BCR-ABL+ tumors in nude mice.13 Phase 1 and 2 studies began in June 1998 and targeted advanced-phase CML,
Ph+ acute leukemia, and chronic-phase CML refractory
to, or intolerant of, interferon. To date, results appear far better
than those achievable using other nontransplantation treatment
modalities, suggesting that STI571 will prove to be a critical advance
in the treatment of patients with CML.14-16
However, a note of caution should be taken from laboratory data
generated by 3 independent groups. These investigators have shown that
resistance to STI571 may be induced in human BCR-ABL+ cell
lines and is frequently mediated by amplification and overexpression of
the BCR-ABL gene, though overexpression of the
MDR gene may also contribute in some
instances.17-19 Similar data are now surfacing for
patients in blast crisis who have relapses while still taking the
drug.20,21 In this study we aimed to determine the
sensitivity of CML CD34+ progenitor cells to STI571 and to
assess to what degree the inhibitory effect of STI571 was dependent on
cell cycle status and whether STI571 had antiproliferative activity on
Ph+ stem cells.
Cell samples
Serum-free culture
Flow cytometry and cell culture As shown in the protocol in Figure 1, CD34+-enriched cells were recovered from liquid nitrogen, washed once in PBS/2%, and stained with 1 µM carboxy-fluorescein diacetate succinimidyl diester (CFSE; Molecular Probes, Eugene, OR) as described in detail previously.5,6,22 Briefly, the labeled cells were then incubated overnight in SFM, with or without GFs. The next day, the cells were washed once in PBS/2% and labeled with anti-CD34-phycoerythrin (PE) (Becton Dickinson, Oxford, United Kingdom) and 1 µg/mL propidium iodide (PI; Sigma). Using a FACSVantage (Becton Dickinson), a homogenous subset of CD34+ CFSE+ PI cells was sorted
using a narrow fluorescence gate (36-40 channels wide using a
1024-channel log amplifier on FL1). These cells were then cultured in 8 experimental conditions for another 3 days in SFM, with and without
GFs, with and without STI571 at 10 µM, and with and without 100 ng/mL
Colcemid (Life Technologies). At the end of this time, all the cells
were harvested, washed in PBS/2%, and stained with anti-CD34-PE and
PI. Cells cultured in the presence of Colcemid were then used to
establish the range of fluorescence exhibited by cells that had not
divided during the 3-day postlabeling incubation. Cells were sorted
into divided and undivided populations for each of the culture
conditions described.
Recovery calculation To measure the overall effect of STI571 on cell survival and to determine whether STI571 had demonstrable antiproliferative activity, the percentage recovery of viable CD34+ input cells was calculated for each division peak for cultures with and without GFs and with and without STI571 (Figure 1). The number of CD34+ cells used to establish each culture was first recorded. After the 3-day culture period, the total number of viable cells harvested from each culture condition was recorded, as were the percentages of total viable cells and of CD34+ cells found in the undivided fraction and in each division peak for all CFSE/CD34 dot-plots from the FACSVantage printout. Percentage recovery of input cells in each peak could then be calculated by dividing the absolute number of viable total cells or CD34+ cells in each peak on day 3, corrected for cell division, by the total number of input CD34+ cells and multiplying by 100%. The difference between plus and minus STI571 was then directly compared for each experiment.Reverse transcription-polymerase chain reaction Sorted cells were resuspended in guanidinium isothiocyanate lysis buffer (5 M GIT, 20 mM 1,4-diothioerythritol (DTT), 25 mM sodium citrate, pH 7.0, 0.05% Sarcosyl) before a 2-step (nested) reverse transcription-polymerase chain reaction (RT-PCR) was performed using an initial oligo (dT)-based primer and poly (A) tailing strategy.23,24 After electrophoresis of the amplified products, BCR-ABL and ABL-specific fragments were detected by Southern blotting using a cDNA probe for BCR-ABL (provided by J. Griffin, Dana Farber Cancer Institute, Boston, MA). Primer sets included, for ABL 1 and ABL 2, 5'TTCAGCGGCCAGTAGCATCTGACTT3' and 5'GGTACCAGGAGTGTTTCTCCAGACTG3' and, for BCR-ABL 1 and BCR-ABL 2, 5'CAGGGTGCACAGCCGCAACGGCAA3' and 5'GTCCAGCGAGAAGGTTTTCCTTGGA3'.Fluorescence in situ hybridization Aliquots of approximately 5000 cells in 50 µL PBS/2% were centrifuged at 4000 rpm for 5 minutes in 0.2 mL tubes. The supernatant was carefully removed without disturbing the cell pellet before resuspension in 50 µL prewarmed (37°C) hypotonic solution (0.075 M potassium chloride). Aliquots were divided between duplicate wells of a previously poly-L-lysine (Sigma) coated multispot microscope slide (Hendley, Essex, United Kingdom). Cells were incubated for 20 minutes at room temperature before excess hypotonic solution was removed gently. Cell fixation was performed by the addition of 20 µL freshly prepared methanol:acetic acid (3:1) to each well and incubated at room temperature for 5 minutes. This fixation step was repeated, with final fixation in a Coplin jar, for a minimum of 5 minutes before air drying of the slide overnight. Slides were wrapped in parafilm and stored at 20°C until FISH was performed with the BCR/ABL1 S-FISH
translocation DNA probe according to the manufacturer's instructions
(Appligene Oncor, Middlesex, United Kingdom). Interphase nuclei were
evaluated using a fluorescence microscope with a triple-band pass
filter for DAPI, fluorescein isothiocyanate, and Texas red.
Statistics Statistical analyses were performed using the Student t test.
Time course and titration of STI571 CD34+ cells, derived from 5 patients in chronic phase at diagnosis and screened by fluorescence in situ hybridization (FISH) for the presence of BCR-ABL, were established in liquid-phase, serum-free cultures. In the presence of GFs, mean total viable cell number increased by 91-, 538-, and 1167-fold on days 3, 6, and 12, respectively (Figure 2A, Table 2). In the presence of STI571 at 1, 5, and 10 µM, respectively, total cell amplification by day 3 reached only 56-, 35-, and 50-fold; by day 6 it reached 192-, 123-, and 75-fold; and by day 12 it reached 1022-, 860-, and 478-fold. Maximum effect for STI571 was, therefore, observed on day 6, when overall viable cell recoveries were reduced to 36%, 23%, and 14% of control for 1, 5, and 10 µM STI571. However, by day 12, viable cell recoveries had significantly improved to 87% and 74% of control in the presence of 1 and 5 µM, respectively (P = .018; P = .048). An increase in cell recovery was also observed in the presence of 10 µM (41% vs 14%), but this did not reach statistical significance.
To establish the inherent sensitivity of primitive Ph+ progenitor cells, parallel cultures were established in SFM without GFs, conditions under which only immature Ph+ progenitor cells can survive.25-27 In the absence of either GFs or STI571, mean total viable cell number increased by 38-, 30-, and 162-fold on days 3, 6, and 12, respectively (Figure 2, Table 2). The slight dip on day 6 is thought to reflect the death of cells that, though Ph+, are not fully growth factor independent. In the presence of 1, 5, and 10 µM STI571, amplification of viable cells declined to 9-, 7-, and 8-fold by day 3; to 5-, 3-, and 2-fold by day 6; and to 10-, 5-, and 4-fold by day 12. Maximum effect for STI571 was observed on day 12, when overall viable cell recoveries were only 6%, 3%, and 2.5% for 1, 5, and 10 µM STI571, respectively, compared with control. An apparent dose-response relationship was seen between days 6 and 12 with 1, 5, and 10 µM STI571. Between days 6 and 12, Ph+ cells appeared to proliferate once again, even in the presence of 10 µM STI571. Mean absolute number of viable cells increased by 2-fold at 1 µM and by 1.9-fold at both 5 and 10 µM STI571 with respect to a 5.4-fold increase in the absence of STI571 (P = NS). These data confirmed that a subset of Ph+ cells remains insensitive to STI571, whether cultured in the presence or absence of GFs. Quiescent Ph+ CD34+ progenitor cells are insensitive to STI571 From the time-course experiments, a concentration of 10 µM STI571 was selected to achieve maximal STI571 inhibitory effect on Ph+ cells. In the absence of GFs, normal CD34+ cells were unable to divide (Figure 3). In the presence of GFs, STI571 affected neither cell cycle kinetics nor the recovery of viable normal CD34+ cells. Although the addition of STI571 eradicated most dividing CML cells, in the presence or absence of GFs (Figure 4) a significant population of viable CD34+ cells was recovered in the undivided/quiescent peak in all patients. These quiescent cells were part of the leukemic clone, as shown by FISH or RT-PCR (Figure 5).
This response to STI571 was not observed in every patient with CML
studied. In some patients, in the presence of GFs, a proportion of
input cells was able to divide up to 4 times (Figure
6) despite belonging to the
Ph+ clone. Thus, sensitivity to STI571 of dividing
CD34+ cells derived from different patients with newly
diagnosed chronic phase CML is heterogeneous. In every patient,
however, quiescent CD34+ Ph+ cells persisted,
the viability of which had not been compromised by STI571.
Survival of quiescent Ph+ CD34+ cells is not adversely affected by STI571, which may have antiproliferative activity on this population For the 4 patient samples used for these experiments, overall cell expansions obtained on day 3 for the various culture conditions are shown in Table 3. As shown in Table 4, in the presence of GFs, the mean proportion of input cells recovered in the undivided fraction was 17%, which was not significantly reduced by the presence of STI571 (16%). Furthermore, STI571 did not affect cell recovery until cells had executed 3 or more divisions. Overall recovery of input cells was 91% in the presence of GFs and 56% in the presence of GFs plus STI571.
In the absence of GFs, approximately 14% of input cells were recovered
in the undivided fraction and were not apparently affected by STI571
(11% recovery). However, under these conditions, the effect of STI571
on cycling cells was observed as soon as cells entered cell division
(recovery in M2 = 21% Ph+ cells capable of growth factor-independent proliferation retain high levels of CD34 expression In this study, autonomous growth factor-independent proliferation was well demonstrated by the comparison of cell cycle kinetics for CD34+ progenitor cells from CML samples (Figures 4, 6) with that of normal peripheral blood stem cells (Figure 3) cultured without GFs. Cells capable of dividing up to 4 times in GF-free medium retained very high levels of CD34 expression compared with cells undergoing division in the presence of GFs (Figures 4, 6, 7). The difference between the no GF and the GF-supplemented experimental arms was highly significant by division 3 (P = .009).
Since the 1980s, when intensive chemotherapy trials were performed in chronic-phase CML and were unable to eradicate the Ph+ clone, the presence of dormant leukemic stem cells has been suspected.7,8 However, alternative mechanisms, including possible antiapoptotic properties of BCR-ABL, have been proposed to explain the relative chemo-resistance of CML.28,29 More recently, the application of novel flow cytometric techniques has enabled us to demonstrate that quiescent leukemic stem cells do indeed exist in the blood and bone marrow of all patients with chronic-phase CML.5,6 With the introduction of STI571 for the treatment of CML, it was critical to establish its effects on the quiescent stem cell pool, an important target cell population for eradication to achieve cure of the disease. Based on the results of the time-course experiments that showed a titration effect from 1 to 10 µM, this study used 10 µM STI571. Although 1 µM STI571 is the widely quoted inhibitory concentration and would approach the achievable drug level in patients' sera, this target concentration has often been determined based on observations of STI571 efficacy in colony-forming assays. In our liquid culture system in which we directly assess overall viability, the IC50 can be expected to be higher (> 1 µM) than that observed in colony-forming assays (0.5 µM).12 In the latter scenario, static effects of STI571 may result in apparent "kill" in that no colonies form; however, viable cells remain unaffected by drug activity. Data from the time-course experiments initially raised the suspicion
that the viability of at least a subset of growth factor-independent, Ph+ primary CML cells was unaffected by STI571. In the
presence of growth factors, cells that survived to day 6 thereafter
expanded by day 12, regardless of STI571 concentration. Deininger et
al12 previously established the ability of STI571 to
inhibit colony formation by CD34+ Ph+ primary
CML cells even in the presence of exogenous growth factors. A similar
trend of cell amplification in the presence of STI571 was observed for
cells cultured in the absence of growth factors. Previous studies
indicate that cells that exhibit such autonomous growth are likely to
be primitive (CD34+ lineage The next series of experiments revealed that quiescent CD34+ Ph+ cells were highly insensitive to STI571, with recoveries of cells maintained alive and in G0 equivalent in the presence versus the absence of 10 µM STI571. Furthermore, there was evidence that the response to STI571 was heterogeneous between samples, with the proliferating fraction in some samples completely eradicated by STI571 (eg, CML 7) and in others showing significant cell survival even to division 4 (eg, CML 2). In the absence of added growth factors, compared with the growth factor-supplemented arm, the proportion of input cells recovered per division peak declined as soon as the cells entered the first cell cycle. This implied that the GFs contributed an antiapoptotic effect in the presence of STI571. As stated above, the proportion of input cells that remained quiescent and viable was not influenced by the addition of STI571. The obvious interpretation of this result was that the quiescent fraction exhibited an inherent insensitivity to STI571. Such insensitivity, however, is distinct from acquired resistance, as has been described in cell lines chronically exposed to the drug whereby resistance is mediated by such mechanisms as gene amplification,17,18,30 increased BCR-ABL protein without gene amplification,18 or reduced STI571 uptake through P-glycoprotein overexpression.19 Progressive gene amplification and a single amino acid substitution has been found to confer resistance to STI571 in cells from patients with advanced-stage disease who undergo relapse after an initial response.30 Our analysis by FISH did not reveal gene amplification in the cells used in our study; nevertheless, drug efflux remains a potential explanation for quiescent stem cell insensitivity to STI571. In addition to the inherent insensitivity of quiescent CD34+ Ph+ cells to STI571, it is possible that a second mechanism was operating. For example, maintenance of viable cells in an undivided state might have reflected ongoing STI571-induced apoptosis in combination with an antiproliferative effect of STI571 in preventing cells from entering cell division. Although antiproliferative activity could only be shown definitively for CML 7, it is likely to have played a part in the retention of cells in a quiescent state in all samples. Although it would have been desirable to definitively distinguish between the relative contributions of induction of apoptosis and antiproliferation to the overall effect of STI571, it was not practicable to do so in our current experimental set-up; thus, we can only conclude that both mechanisms were in operation. Indeed, the antiproliferative effect of STI571 had not been anticipated, but such antiproliferative activity would be in agreement with a recent report by Gesbert et al31 demonstrating that BCR-ABL+ cells exposed to STI571 resulted in recovery of the reversible, BCR-ABL+-induced down-regulation of p27, a key cell cycle regulator. For Ph+ CD34+ cells cultured without growth
factors, cells that survived and proliferated up to 4 times retained
high levels of CD34 expression compared with cells undergoing division
in the presence of growth factors. This implied either that as cells began to differentiate and lose CD34 expression, they were lost from
the cultures, presumably through cell death, or that the absence of
exogenous growth factors prompted self-renewal divisions with retention
of CD34 expression. This finding may be explained by the
differentiation-controlled autocrine expression of IL-3, which has been
demonstrated previously.25 In those studies the level of
autocrine IL-3 clearly fell as cells differentiated from the primitive
(CD34+CD45RA/71 As clinical trials with STI571 progress, it is anticipated that many patients will enter cytogenetic and possibly even molecular remission. However, to date, little is known regarding the efficacy of the drug in the longer term and whether surrogate markers of response, such as cytogenetic remission, will translate to prolonged survival. Moreover, our data suggest that quiescent hematopoietic stem cells are likely to survive STI571 monotherapy. It will be important to determine whether residual populations of quiescent Ph+ cells exist in treated patients. If so, adjuvant therapies are likely to prove important, either combining STI571 with other molecularly targeted therapy,32-34 with chemotherapy agents, or with immunotherapy.35 Recent in vitro studies, performed on primary CML cells or Ph+ cell lines, have demonstrated either additive or synergistic responses for a number of agents used in conjunction with STI571,36-38 and phase 1 combination clinical trials are actively pursued in a number of centers.
We thank the United Kingdom hematologists who contributed to our bank of CML samples. We thank Dr Allen Eaves and StemCell Technologies and Dr Connie Eaves and the Terry Fox Laboratories for their support. We also thank Novartis Pharmaceuticals for the generous gift of reagents and Professor Ian Franklin and Dr John Campbell for critically reviewing the manuscript.
Submitted May 7, 2001; accepted September 5, 2001.
Supported by The Sylvia Aitken Trust (S.M.G.) and by the UK Leukaemia Research Fund (H.G.J, T.L.H.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Susan M. Graham, Academic Transfusion Medicine Unit, Department of Medicine, Royal Infirmary, 10 Alexandra Parade, Glasgow G31 2ER, Scotland; e-mail: smg16a{at}clinmed.gla.ac.uk.
1. Rowley JD. A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature. 1973;243:290-293[CrossRef][Medline] [Order article via Infotrieve]. 2. Shtivelman E, Lifshitz B, Gale RP, Canaani E. Fused transcript of abl and bcr genes in chronic myelogenous leukaemia. Nature. 1985;315:550-554[CrossRef][Medline] [Order article via Infotrieve].
3.
Ben-Neriah Y, Daley GQ, Mes-Masson AM, Witte ON, Baltimore D.
The chronic myelogenous leukemia-specific P210 protein is the product of the bcr/abl hybrid gene.
Science.
1986;233:212-214
4.
Daley GQ, Baltimore D.
Transformation of an interleukin 3-dependent hematopoietic cell line by the chronic myelogenous leukemia-specific P210 bcr-abl protein.
Proc Natl Acad Sci U S A.
1988;85:9312-9316
5.
Holyoake T, Jiang X, Eaves C, Eaves A.
Isolation of a highly quiescent subpopulation of primitive leukemic cells in chronic myeloid leukemia.
Blood.
1999;94:2056-2064
6.
Holyoake TL, Jiang X, Jorgensen HG, et al.
Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3.
Blood.
2001;97:720-728 7. Kantarjian HM, Vellekoop L, McCredie KB, et al. Intensive combination chemotherapy (ROAP 10) and splenectomy in the management of chronic myelogenous leukemia. J Clin Oncol. 1985;3:192-200[Abstract].
8.
Goto T, Nishikori M, Arlin Z, et al.
Growth characteristics of leukemic and normal hematopoietic cells in Ph1+ chronic myelogenous leukemia and effects of intensive treatment.
Blood.
1982;59:793-808
9.
Buchdunger E, Zimmermann J, Mett H, et al.
Selective inhibition of the platelet-derived growth factor signal transduction pathway by a protein-tyrosine kinase inhibitor of the 2-phenylaminopyrimidine class.
Proc Natl Acad Sci U S A.
1995;92:2558-2562
10.
Buchdunger E, Zimmermann J, Mett H, et al.
Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative.
Cancer Res.
1996;56:100-104 11. Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2:561-566[CrossRef][Medline] [Order article via Infotrieve].
12.
Deininger MWN, Goldman JM, Lydon N, Melo JV.
The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells.
Blood.
1997;90:3691-3698
13.
Le Coutre P, Mologni L, Cleris L, et al.
In vivo eradication of human BCR/ABL-positive cells with an ABL kinase inhibitor.
J Natl Cancer Inst.
1999;91:163-168 14. Druker BJ, Lydon NB. Lessons learned from the development of an Abl tyrosine kinase inhibitor for chronic myelogenous leukemia. J Clin Invest. 2000;105:3-7[Medline] [Order article via Infotrieve].
15.
Druker BJ, Sawyers CL, Kantarjian H, et al.
Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome.
N Engl J Med.
2001;344:1038-1042
16.
Druker BJ, Talpaz M, Resta DJ, et al.
Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia.
N Engl J Med.
2001;344:1031-1037
17.
Le Coutre P, Tassi E, Varella-Garcia M, et al.
Induction of resistance to the Abelson inhibitor STI571 in human leukemic cells through gene amplification.
Blood.
2000;95:1758-1766
18.
Weisberg E, Griffin JD.
Mechanism of resistance to the ABL tyrosine kinase inhibitor STI571 in BCR/ABL-transformed hematopoietic cell lines.
Blood.
2000;95:3498-3505
19.
Mahon FX, Deininger MWN, Schultheis B, et al.
Selection and characterization of BCR-ABL positive cell lines with differential sensitivity to the tyrosine kinase inhibitor STI571: diverse mechanisms of resistance.
Blood.
2000;96:1070-1079 20. Mohammed M, Shin S, Deng S, et al. BCR/ABL gene amplification: a possible mechanism of drug resistance in patients treated with an ABL-specific kinase inhibitor [abstract]. Blood. 2000;96:1486. 21. Gorre ME, Banks K, Hsu NC, et al. Relapse in Ph+ leukemia patients treated with an ABL-specific kinase inhibitor is associated with reactivation of bcr-abl [abstract]. Blood. 2000;96:2024.
22.
Nordon RE, Ginsberg SS, Eaves CJ.
High-resolution cell division tracking demonstrates the Flt3-ligand dependence of human marrow CD34+CD38
23.
Maguer-Satta V, Petzer AL, Eaves AC, Eaves CJ.
BCR-ABL expression in different subpopulations of functionally characterized Ph+ CD34+ cells from patients with chronic myeloid leukemia.
Blood.
1996;88:1796-1804
24.
Sauvageau G, Lansdorp PM, Eaves CJ, et al.
Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells.
Proc Natl Acad Sci U S A.
1994;91:12223-12227
25.
Jiang X, Lopez A, Holyoake T, Eaves A, Eaves C.
Autocrine production and action of IL-3 and granulocyte colony-stimulating factor in chronic myeloid leukaemia.
Proc Natl Acad Sci U S A.
1999;96:12804-12809 26. Maguer-Satta V, Burl S, Liu L, et al. BCR-ABL accelerates C2-ceramide-induced apoptosis. Oncogene. 1998;16:237-248[CrossRef][Medline] [Order article via Infotrieve]. 27. Jiang X, Fujisaki T, Nicolini F, et al. Autonomous multi-lineage differentiation in vitro of primitive CD34+ cells from patients with chronic myeloid leukemia. Leukemia. 2000;14:1112-1121[CrossRef][Medline] [Order article via Infotrieve].
28.
Bedi A, Zehnbauer BA, Barber J, Sharkis S, Jones R.
Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia.
Blood.
1994;83:2038-2044
29.
Bedi A, Barber J, Bedi G, et al.
BCR-ABL-mediated inhibition of apoptosis with delay of G2/M transition after DNA damage: a mechanism of resistance to multiple anticancer agents.
Blood.
1995;86:1148-1158
30.
Gorre ME, Mohammed M, Ellwood K, et al.
Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification.
Science.
2001;293:876-880
31.
Gesbert F, Sellers WR, Signoretti S, Loda M, Griffin JD.
BCR/ABL regulates expression of the cyclin-dependent kinase inhibitor p27Kip1 through the phosphatidylinositol 3-kinase/AKT pathway.
J Biol Chem.
2000;275:39223-39230
32.
Sun X, Layton JE, Elefanty A, Lieschke GJ.
Comparison of effects of the tyrosine kinase inhibitors AG957, AG490, and STI571 on BCR-ABLexpressing cells, demonstrating synergy between AG490 and STI571.
Blood.
2001;97:2008-2015
33.
Reichert A, Heisterkamp N, Daley GQ, Groffen J.
Treatment of Bcr/Abl-positive acute lymphoblastic leukemia in P190 transgenic mice with the farnesyl transferase inhibitor SCH66336.
Blood.
2001;97:1399-1403
34.
Peters DG, Hoover RR, Gerlach MJ, et al.
Activity of the farnesyl protein transferase inhibitor SCH66336 against BCR/ABL-induced murine leukemia and primary cells from patients with chronic myeloid leukemia.
Blood.
2001;97:1404-1412
35.
Campbell JDM, Cook G, Holyoake TL.
Evolution of bone marrow transplantation 36. Topaly J, Zeller WJ, Fruehauf S. Synergistic activity of the new ABL-specific tyrosine kinase inhibitor STI571 and chemotherapeutic drugs on BCR-ABL-positive chronic myelogenous leukemia cells. Leukemia. 2001;3:342-347.
37.
Thiesing JT, Ohno-Jones S, Kolibaba KS, Druker BJ.
Efficacy of STI571, an abl tyrosine kinase inhibitor, in conjunction with other antileukemic agents against bcr-abl-positive cells.
Blood.
2000;96:3195-3199
38.
Kano Y, Akutsu M, Tsunoda S, et al.
In vitro cytotoxic effects of a tyrosine kinase inhibitor STI571 in combination with commonly used antileukemic agents.
Blood.
2001;97:1999-2007
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  F. Pellicano, M. Copland, H. G. Jorgensen, J. Mountford, B. Leber, and T. L. Holyoake BMS-214662 induces mitochondrial apoptosis in chronic myeloid leukemia (CML) stem/progenitor cells, including CD34+38- cells, through activation of protein kinase C{beta} Blood, November 5, 2009; 114(19): 4186 - 4196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Chapuy, M. Panse, U. Radunski, R. Koch, D. Wenzel, N. Inagaki, D. Haase, L. Truemper, and G. G. Wulf ABC transporter A3 facilitates lysosomal sequestration of imatinib and modulates susceptibility of chronic myeloid leukemia cell lines to this drug Haematologica, November 1, 2009; 94(11): 1528 - 1536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Mattarucchi, O. Spinelli, A. Rambaldi, F. Pasquali, F. Lo Curto, L. Campiotti, and G. Porta Molecular Monitoring of Residual Disease in Chronic Myeloid Leukemia by Genomic DNA Compared with Conventional mRNA Analysis J. Mol. Diagn., September 1, 2009; 11(5): 482 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. H. Mak, W. D. Schober, W. Chen, M. Konopleva, J. Cortes, H. M. Kantarjian, M. Andreeff, and B. Z. Carter Triptolide induces cell death independent of cellular responses to imatinib in blast crisis chronic myelogenous leukemia cells including quiescent CD34+ primitive progenitor cells Mol. Cancer Ther., September 1, 2009; 8(9): 2509 - 2516. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Jedidi, C. Marty, C. Oligo, L. Jeanson-Leh, J.-A. Ribeil, N. Casadevall, A. Galy, W. Vainchenker, and J.-L. Villeval Selective reduction of JAK2V617F-dependent cell growth by siRNA/shRNA and its reversal by cytokines Blood, August 27, 2009; 114(9): 1842 - 1851. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. R. Hercus, D. Thomas, M. A. Guthridge, P. G. Ekert, J. King-Scott, M. W. Parker, and A. F. Lopez The granulocyte-macrophage colony-stimulating factor receptor: linking its structure to cell signaling and its role in disease Blood, August 13, 2009; 114(7): 1289 - 1298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Quintas-Cardama and J. Cortes Molecular biology of bcr-abl1-positive chronic myeloid leukemia Blood, February 19, 2009; 113(8): 1619 - 1630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. M. Yong, K. Keyvanfar, N. Hensel, R. Eniafe, B. N. Savani, M. Berg, A. Lundqvist, S. Adams, E. M. Sloand, J. M. Goldman, et al. Primitive quiescent CD34+ cells in chronic myeloid leukemia are targeted by in vitro expanded natural killer cells, which are functionally enhanced by bortezomib Blood, January 22, 2009; 113(4): 875 - 882. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Bixby and M. Talpaz Imatinib As Frontline Therapy for Patients with Newly Diagnosed Chronic-phase Chronic Myeloid Leukemia ASCO Educational Book, January 1, 2009; 2009(1): 395 - 401. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Konig, M. Copland, S. Chu, R. Jove, T. L. Holyoake, and R. Bhatia Effects of Dasatinib on Src Kinase Activity and Downstream Intracellular Signaling in Primitive Chronic Myelogenous Leukemia Hematopoietic Cells Cancer Res., December 1, 2008; 68(23): 9624 - 9633. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. Zhou, Y. Zhao, A. Ringrose, D. DeGeer, E. Kennah, A. E.-J. Lin, G. Sheng, X.-J. Li, A. Turhan, and X. Jiang AHI-1 interacts with BCR-ABL and modulates BCR-ABL transforming activity and imatinib response of CML stem/progenitor cells J. Exp. Med., October 27, 2008; 205(11): 2657 - 2671. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Michor Mathematical Models of Cancer Stem Cells J. Clin. Oncol., June 10, 2008; 26(17): 2854 - 2861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Gontarewicz, S. Balabanov, G. Keller, R. Colombo, A. Graziano, E. Pesenti, D. Benten, C. Bokemeyer, W. Fiedler, J. Moll, et al. Simultaneous targeting of Aurora kinases and Bcr-Abl kinase by the small molecule inhibitor PHA-739358 is effective against imatinib-resistant BCR-ABL mutations including T315I Blood, April 15, 2008; 111(8): 4355 - 4364. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kumar, E. T. Petri, B. Halmos, and T. J. Boggon Structure and Clinical Relevance of the Epidermal Growth Factor Receptor in Human Cancer J. Clin. Oncol., April 1, 2008; 26(10): 1742 - 1751. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wu, F. Meng, H. Lu, L. Kong, W. Bornmann, Z. Peng, M. Talpaz, and N. J. Donato Lyn regulates BCR-ABL and Gab2 tyrosine phosphorylation and c-Cbl protein stability in imatinib-resistant chronic myelogenous leukemia cells Blood, April 1, 2008; 111(7): 3821 - 3829. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Copland, F. Pellicano, L. Richmond, E. K. Allan, A. Hamilton, F. Y. Lee, R. Weinmann, and T. L. Holyoake BMS-214662 potently induces apoptosis of chronic myeloid leukemia stem and progenitor cells and synergizes with tyrosine kinase inhibitors Blood, March 1, 2008; 111(5): 2843 - 2853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Konig, T. L. Holyoake, and R. Bhatia Effective and selective inhibition of chronic myeloid leukemia primitive hematopoietic progenitors by the dual Src/Abl kinase inhibitor SKI-606 Blood, February 15, 2008; 111(4): 2329 - 2338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. V. Melo and C. Chuah Novel Agents in CML Therapy: Tyrosine Kinase Inhibitors and Beyond Hematology, January 1, 2008; 2008(1): 427 - 435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W.N. Deininger Imatinib Resistance and the Difficulty of Eradicating Leukemia Stem Cells ASCO Educational Book, January 1, 2008; 2008(1): 318 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. McLaughlin, D. Cheng, O. Singer, R. U. Lukacs, C. G. Radu, I. M. Verma, and O. N. Witte Sustained suppression of Bcr-Abl-driven lymphoid leukemia by microRNA mimics PNAS, December 18, 2007; 104(51): 20501 - 20506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Guzman, X. Li, C. A. Corbett, R. M. Rossi, T. Bushnell, J. L. Liesveld, J. Hebert, F. Young, and C. T. Jordan Rapid and selective death of leukemia stem and progenitor cells induced by the compound 4-benzyl, 2-methyl, 1,2,4-thiadiazolidine, 3,5 dione (TDZD-8) Blood, December 15, 2007; 110(13): 4436 - 4444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Guzman, R. M. Rossi, S. Neelakantan, X. Li, C. A. Corbett, D. C. Hassane, M. W. Becker, J. M. Bennett, E. Sullivan, J. L. Lachowicz, et al. An orally bioavailable parthenolide analog selectively eradicates acute myelogenous leukemia stem and progenitor cells Blood, December 15, 2007; 110(13): 4427 - 4435. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Branford, J. F. Seymour, A. Grigg, C. Arthur, Z. Rudzki, K. Lynch, and T. Hughes BCR-ABL Messenger RNA Levels Continue to Decline in Patients with Chronic Phase Chronic Myeloid Leukemia Treated with Imatinib for More Than 5 Years and Approximately Half of All First-Line Treated Patients Have Stable Undetectable BCR-ABL Using Strict Sensitivity Criteria Clin. Cancer Res., December 1, 2007; 13(23): 7080 - 7085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Klion, J. Robyn, I. Maric, W. Fu, L. Schmid, S. Lemery, P. Noel, M. A. Law, M. Hartsell, C. Talar-Williams, et al. Relapse following discontinuation of imatinib mesylate therapy for FIP1L1/PDGFRA-positive chronic eosinophilic leukemia: implications for optimal dosing Blood, November 15, 2007; 110(10): 3552 - 3556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Goldman How I treat chronic myeloid leukemia in the imatinib era Blood, October 15, 2007; 110(8): 2828 - 2837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Jiang Toward distinguishing LSCs from HSCs Blood, October 1, 2007; 110(7): 2222 - 2223. [Full Text] [PDF]
|
|
|
|
|
|
T. O'Hare, C. A. Eide, and M. W. N. Deininger Bcr-Abl kinase domain mutations, drug resistance, and the road to a cure for chronic myeloid leukemia Blood, October 1, 2007; 110(7): 2242 - 2249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Neering, T. Bushnell, S. Sozer, J. Ashton, R. M. Rossi, P.-Y. Wang, D. R. Bell, D. Heinrich, A. Bottaro, and C. T. Jordan Leukemia stem cells in a genetically defined murine model of blast-crisis CML Blood, October 1, 2007; 110(7): 2578 - 2585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Reiter, D. Grimwade, and N. C.P. Cross Diagnostic and therapeutic management of eosinophilia-associated chronic myeloproliferative disorders Haematologica, September 1, 2007; 92(9): 1153 - 1158. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rahmani, T. K. Nguyen, P. Dent, and S. Grant The Multikinase Inhibitor Sorafenib Induces Apoptosis in Highly Imatinib Mesylate-Resistant Bcr/Abl+ Human Leukemia Cells in Association with Signal Transducer and Activator of Transcription 5 Inhibition and Myeloid Cell Leukemia-1 Down-Regulation Mol. Pharmacol., September 1, 2007; 72(3): 788 - 795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells Blood, July 15, 2007; 110(2): 678 - 685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Jovanovic, J. Score, K. Waghorn, D. Cilloni, E. Gottardi, G. Metzgeroth, P. Erben, H. Popp, C. Walz, A. Hochhaus, et al. Low-dose imatinib mesylate leads to rapid induction of major molecular responses and achievement of complete molecular remission in FIP1L1-PDGFRA positive chronic eosinophilic leukemia Blood, June 1, 2007; 109(11): 4635 - 4640. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Jiang, K. M. Saw, A. Eaves, and C. Eaves Instability of BCR-ABL Gene in Primary and Cultured Chronic Myeloid Leukemia Stem Cells J Natl Cancer Inst, May 2, 2007; 99(9): 680 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. G. Jorgensen, E. K. Allan, N. E. Jordanides, J. C. Mountford, and T. L. Holyoake Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells Blood, May 1, 2007; 109(9): 4016 - 4019. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Van Etten Oncogenic signaling: new insights and controversies from chronic myeloid leukemia J. Exp. Med., March 19, 2007; 204(3): 461 - 465. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Miething, R. Grundler, C. Mugler, S. Brero, J. Hoepfl, J. Geigl, M. R. Speicher, O. Ottmann, C. Peschel, and J. Duyster Retroviral insertional mutagenesis identifies RUNX genes involved in chronic myeloid leukemia disease persistence under imatinib treatment PNAS, March 13, 2007; 104(11): 4594 - 4599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wang, D. Cai, C. Brendel, C. Barett, P. Erben, P. W. Manley, A. Hochhaus, A. Neubauer, and A. Burchert Adaptive secretion of granulocyte-macrophage colony-stimulating factor (GM-CSF) mediates imatinib and nilotinib resistance in BCR/ABL+ progenitors via JAK-2/STAT-5 pathway activation Blood, March 1, 2007; 109(5): 2147 - 2155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Holtz, S. J. Forman, and R. Bhatia Growth Factor Stimulation Reduces Residual Quiescent Chronic Myelogenous Leukemia Progenitors Remaining after Imatinib Treatment Cancer Res., February 1, 2007; 67(3): 1113 - 1120. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Druker, F. Guilhot, S. G. O'Brien, I. Gathmann, H. Kantarjian, N. Gattermann, M. W.N. Deininger, R. T. Silver, J. M. Goldman, R. M. Stone, et al. Five-Year Follow-up of Patients Receiving Imatinib for Chronic Myeloid Leukemia N. Engl. J. Med., December 7, 2006; 355(23): 2408 - 2417. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. S. Krause, K. Lazarides, U. H. von Andrian, and R. A. Van Etten CD44 Is Selectively Required for the Homing and Engraftment of BCR-ABL-Expressing Leukemic Stem Cells. Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 743 - 743. [Abstract] [PDF]
|
|
|
|
|
|
Y. Hu, S. Swerdlow, T. M. Duffy, R. Weinmann, F. Y. Lee, and S. Li Targeting multiple kinase pathways in leukemic progenitors and stem cells is essential for improved treatment of Ph+ leukemia in mice PNAS, November 7, 2006; 103(45): 16870 - 16875. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. La Rosee, T. Jia, S. Demehri, N. Hartel, P. de Vries, L. Bonham, D. Hollenback, J. W. Singer, J. V. Melo, B. J. Druker, et al. Antileukemic Activity of Lysophosphatidic Acid Acyltransferase-{beta} Inhibitor CT32228 in Chronic Myelogenous Leukemia Sensitive and Resistant to Imatinib. Clin. Cancer Res., November 1, 2006; 12(21): 6540 - 6546. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. T. Jordan, M. L. Guzman, and M. Noble Cancer stem cells. N. Engl. J. Med., September 21, 2006; 355(12): 1253 - 1261. [Full Text] [PDF]
|
|
|
|
|
|
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al. Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet Blood, September 15, 2006; 108(6): 1809 - 1820. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. E. Jordanides, H. G. Jorgensen, T. L. Holyoake, and J. C. Mountford Functional ABCG2 is overexpressed on primary CML CD34+ cells and is inhibited by imatinib mesylate Blood, August 15, 2006; 108(4): 1370 - 1373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Nakanishi, K. Shiozawa, B. A. Hassel, and D. D. Ross Complex interaction of BCRP/ABCG2 and imatinib in BCR-ABL-expressing cells: BCRP-mediated resistance to imatinib is attenuated by imatinib-induced reduction of BCRP expression Blood, July 15, 2006; 108(2): 678 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Quintas-Cardama and J. E. Cortes Chronic Myeloid Leukemia: Diagnosis and Treatment Mayo Clin. Proc., July 1, 2006; 81(7): 973 - 988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Koptyra, R. Falinski, M. O. Nowicki, T. Stoklosa, I. Majsterek, M. Nieborowska-Skorska, J. Blasiak, and T. Skorski BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance Blood, July 1, 2006; 108(1): 319 - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Talpaz, N. P. Shah, H. Kantarjian, N. Donato, J. Nicoll, R. Paquette, J. Cortes, S. O'Brien, C. Nicaise, E. Bleickardt, et al. Dasatinib in imatinib-resistant Philadelphia chromosome-positive leukemias. N. Engl. J. Med., June 15, 2006; 354(24): 2531 - 2541. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Copland, A. Hamilton, L. J. Elrick, J. W. Baird, E. K. Allan, N. Jordanides, M. Barow, J. C. Mountford, and T. L. Holyoake Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction Blood, June 1, 2006; 107(11): 4532 - 4539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Scherr, A. Chaturvedi, K. Battmer, I. Dallmann, B. Schultheis, A. Ganser, and M. Eder Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML) Blood, April 15, 2006; 107(8): 3279 - 3287. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Mauro and R. T. Maziarz Stem Cell Transplantation in Patients With Chronic Myelogenous Leukemia: When Should It Be Used? Mayo Clin. Proc., March 1, 2006; 81(3): 404 - 416. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. G. Jorgensen, M. Copland, E. K. Allan, X. Jiang, A. Eaves, C. Eaves, and T. L. Holyoake Intermittent Exposure of Primitive Quiescent Chronic Myeloid Leukemia Cells to Granulocyte-Colony Stimulating Factor In vitro Promotes their Elimination by Imatinib Mesylate Clin. Cancer Res., January 15, 2006; 12(2): 626 - 633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Huff, W. Matsui, B. D. Smith, and R. J. Jones The paradox of response and survival in cancer therapeutics Blood, January 15, 2006; 107(2): 431 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Jabbour, H. Kantarjian, S. O'Brien, M. B. Rios, L. Abruzzo, S. Verstovsek, G. Garcia-Manero, and J. Cortes Sudden blastic transformation in patients with chronic myeloid leukemia treated with imatinib mesylate Blood, January 15, 2006; 107(2): 480 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. M. Yong, R. M. Szydlo, J. M. Goldman, J. F. Apperley, and J. V. Melo Molecular profiling of CD34+ cells identifies low expression of CD7, along with high expression of proteinase 3 or elastase, as predictors of longer survival in patients with CML Blood, January 1, 2006; 107(1): 205 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Guilhot Mutation detection in CML: is it a useful tool? Blood, September 15, 2005; 106(6): 1897 - 1897. [Full Text] [PDF]
|
|
|
|
|
|
J. Cortes and H. Kantarjian New Targeted Approaches in Chronic Myeloid Leukemia J. Clin. Oncol., September 10, 2005; 23(26): 6316 - 6324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Krause and R. A. Van Etten Tyrosine Kinases as Targets for Cancer Therapy N. Engl. J. Med., July 14, 2005; 353(2): 172 - 187. [Full Text] [PDF]
|
|
|
|
|
|
M. W. N. Deininger and T. L. Holyoake Can we afford to let sleeping dogs lie? Blood, March 1, 2005; 105(5): 1840 - 1841. [Full Text] [PDF]
|
|
|
|
|
|
L. J. Elrick, H. G. Jorgensen, J. C. Mountford, and T. L. Holyoake Punish the parent not the progeny Blood, March 1, 2005; 105(5): 1862 - 1866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chu, H. Xu, N. P. Shah, D. S. Snyder, S. J. Forman, C. L. Sawyers, and R. Bhatia Detection of BCR-ABL kinase mutations in CD34+ cells from chronic myelogenous leukemia patients in complete cytogenetic remission on imatinib mesylate treatment Blood, March 1, 2005; 105(5): 2093 - 2098. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D.A. LAWSON, L. XIN, R. LUKACS, Q. XU, D. CHENG, and O.N. WITTE Prostate Stem Cells and Prostate Cancer Cold Spring Harb Symp Quant Biol, January 1, 2005; 70(0): 187 - 196. [Abstract] [PDF]
|
|
|
|
|
|
M. W.N. Deininger Management of Early Stage Disease Hematology, January 1, 2005; 2005(1): 174 - 182. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Ilaria Jr. Pathobiology of Lymphoid and Myeloid Blast Crisis and Management Issues Hematology, January 1, 2005; 2005(1): 188 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yin, Y.-L. Wu, H.-P. Sun, G.-L. Sun, Y.-Z. Du, K.-K. Wang, J. Zhang, G.-Q. Chen, S.-J. Chen, and Z. Chen Combined effects of As4S4 and imatinib on chronic myeloid leukemia cells and BCR-ABL oncoprotein Blood, December 15, 2004; 104(13): 4219 - 4225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wong, J. McLaughlin, D. Cheng, C. Zhang, K. M. Shokat, and O. N. Witte Sole BCR-ABL inhibition is insufficient to eliminate all myeloproliferative disorder cell populations PNAS, December 14, 2004; 101(50): 17456 - 17461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. H.M. Jamieson, L. E. Ailles, S. J. Dylla, M. Muijtjens, C. Jones, J. L. Zehnder, J. Gotlib, K. Li, M. G. Manz, A. Keating, et al. Granulocyte-Macrophage Progenitors as Candidate Leukemic Stem Cells in Blast-Crisis CML N. Engl. J. Med., August 12, 2004; 351(7): 657 - 667. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Jiang, Y. Zhao, W.-Y. Chan, S. Vercauteren, E. Pang, S. Kennedy, F. Nicolini, A. Eaves, and C. Eaves Deregulated expression in Ph+ human leukemias of AHI-1, a gene activated by insertional mutagenesis in mouse models of leukemia Blood, May 15, 2004; 103(10): 3897 - 3904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Jones, W. H. Matsui, and B. D. Smith Cancer Stem Cells: Are We Missing the Target? J Natl Cancer Inst, April 21, 2004; 96(8): 583 - 585. [Full Text] [PDF]
|
|
|
|
|
|
S. Chu, M. Holtz, M. Gupta, and R. Bhatia BCR/ABL kinase inhibition by imatinib mesylate enhances MAP kinase activity in chronic myelogenous leukemia CD34+ cells Blood, April 15, 2004; 103(8): 3167 - 3174. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bartolovic, S. Balabanov, U. Hartmann, M. Komor, A. M. Boehmler, H.-J. Buhring, R. Mohle, D. Hoelzer, L. Kanz, W.-K. Hofmann, et al. Inhibitory effect of imatinib on normal progenitor cells in vitro Blood, January 15, 2004; 103(2): 523 - 529. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Appel, A. M. Boehmler, F. Grunebach, M. R. Muller, A. Rupf, M. M. Weck, U. Hartmann, V. L. Reichardt, L. Kanz, T. H. Brummendorf, et al. Imatinib mesylate affects the development and function of dendritic cells generated from CD34+ peripheral blood progenitor cells Blood, January 15, 2004; 103(2): 538 - 544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Gilliland, C. T. Jordan, and C. A. Felix The Molecular Basis of Leukemia Hematology, January 1, 2004; 2004(1): 80 - 97. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. La Rosee, K. Johnson, A. S. Corbin, E. P. Stoffregen, E. M. Moseson, S. Willis, M. M. Mauro, J. V. Melo, M. W. Deininger, and B. J. Druker In vitro efficacy of combined treatment depends on the underlying mechanism of resistance in imatinib-resistant Bcr-Abl-positive cell lines Blood, January 1, 2004; 103(1): 208 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gardembas, P. Rousselot, M. Tulliez, M. Vigier, A. Buzyn, F. Rigal-Huguet, L. Legros, M. Michallet, C. Berthou, N. Cheron, et al. Results of a prospective phase 2 study combining imatinib mesylate and cytarabine for the treatment of Philadelphia-positive patients with chronic myelogenous leukemia in chronic phase Blood, December 15, 2003; 102(13): 4298 - 4305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Kirschner and K. Baltensperger Erythropoietin Promotes Resistance Against the Abl Tyrosine Kinase Inhibitor Imatinib (STI571) in K562 Human Leukemia Cells Mol. Cancer Res., November 1, 2003; 1(13): 970 - 980. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Goldman and J. V. Melo Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment N. Engl. J. Med., October 9, 2003; 349(15): 1451 - 1464. [Full Text] [PDF]
|
|
|
|
 |
|
 M. W. N. Deininger and B. J. Druker Specific Targeted Therapy of Chronic Myelogenous Leukemia with Imatinib Pharmacol. Rev., September 1, 2003; 55(3): 401 - 423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Gambacorti-Passerini, R. Piazza, M. D'Incalci, A. Corbin, P. La Rosee, E. Stoffregen, B. Druker, and M. Deininger Bcr-Abl mutations, resistance to imatinib, and imatinib plasma levels Blood, September 1, 2003; 102(5): 1933 - 1935. [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Antin A 41-Year-Old Woman With Chronic Myelogenous Leukemia JAMA, August 27, 2003; 290(8): 1083 - 1090. [Full Text] [PDF]
|
|
|
|
|
|
R. Bhatia, M. Holtz, N. Niu, R. Gray, D. S. Snyder, C. L. Sawyers, D. A. Arber, M. L. Slovak, and S. J. Forman Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment Blood, June 15, 2003; 101(12): 4701 - 4707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F.-X. Mahon, F. Belloc, V. Lagarde, C. Chollet, F. Moreau-Gaudry, J. Reiffers, J. M. Goldman, and J. V. Melo MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models Blood, March 15, 2003; 101(6): 2368 - 2373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Druker Overcoming Resistance to Imatinib by Combining Targeted Agents Mol. Cancer Ther., March 1, 2003; 2(3): 225 - 226. [Full Text] [PDF]
|
|
|
|
|
|
C. Gambacorti-Passerini, M. Zucchetti, D. Russo, R. Frapolli, M. Verga, S. Bungaro, L. Tornaghi, F. Rossi, P. Pioltelli, E. Pogliani, et al. {alpha}1 Acid Glycoprotein Binds to Imatinib (STI571) and Substantially Alters Its Pharmacokinetics in Chronic Myeloid Leukemia Patients Clin. Cancer Res., February 1, 2003; 9(2): 625 - 632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Burchert, S. Wolfl, M. Schmidt, C. Brendel, B. Denecke, D. Cai, L. Odyvanova, T. Lahaye, M. C. Muller, T. Berg, et al. Interferon-alpha , but not the ABL-kinase inhibitor imatinib (STI571), induces expression of myeloblastin and a specific T-cell response in chronic myeloid leukemia Blood, January 1, 2003; 101(1): 259 - 264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Druker, S. G. O'Brien, J. Cortes, and J. Radich Chronic Myelogenous Leukemia Hematology, January 1, 2002; 2002(1): 111 - 135. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
CML 7, example 1.
These dot-plots show representative results for a CML sample that
proved to be highly sensitive to STI571. As shown in the upper left
dot-plot, in the presence of added growth factors, the
CD34+ cells were stimulated to proliferate up to 6 times,
with associated loss of CD34 expression induced by differentiation. The
addition of STI571 (upper right) eradicated almost all the dividing
cells, leaving behind only the nonproliferating quiescent fraction. In
the absence of growth factors (lower left), the CD34+ cells
demonstrated autonomous growth (compared with the normal control in
Figure 
