| |
|
|
|
|
|
|
|||
|
TRANSPLANTATION
From the Department of Medicine and Immunology, Human
Vaccine Institute, Duke University Medical Center, Durham, NC.
Umbilical cord blood has been increasingly used as a source of
hematopoietic stem cells. A major area of concern for the use of cord
blood transplantation is the delay in myeloid and lymphoid recovery. To
directly compare myeloid and lymphoid recovery using an animal model of
bone marrow and cord blood as sources of stem cells, hematopoietic
engraftment and immune recovery were studied following infusion
of T-cell-depleted adult bone marrow or full-term fetal blood cells,
as a model of cord blood in a murine allogeneic transplantation model
(C57BL/6 [H-2b] Umbilical cord blood has been increasingly utilized
as a source of hematopoietic stem cells for allogeneic transplantation. In humans, immune reconstitution following cord blood transplantation has not yet been systematically studied. Infections have been a leading
cause of morbidity and mortality,1-4 suggesting that mismatched unrelated cord blood may not have the potential to fully
reconstitute immune function, especially in adult recipients. To better
understand the possible defects in immune function, a murine model
system was established in this study. Allogeneic bone marrow or
full-term fetal blood recipients were compared in the 4 major
cell components (T, B, natural killer [NK], and antigen-presenting cells).
The mechanisms underlying impaired immune function can be divided into
the following 3 categories: (1) intrinsic defect of hematopoietic
precursor cells (eg, severe combined immunodeficiency)5; (2) microenvironment abnormality (eg, thymic microenvironment abnormality in DiGeorge syndrome)6; (3) improper
interaction between graft and microenvironment (eg, donor-recipient
histoincompatibility-associated immune dysfunction7 and
graft-versus-host disease [GVHD]-associated lymphoid
hypoplasia8,9). In our present studies, allogeneic T-cell-depleted bone marrow served as a standard and a control for the
microenvironment (host), and syngeneic full-term fetal blood as a
control for full-term fetal blood transplantation (as a source of stem
cells). These controls allowed the measurement of defects that are
specific for recipients of allogeneic major histocompatability complex
(MHC) mismatched full-term fetal blood.
Animals
Harvesting of full-term fetal blood cells
T-cell depletion from bone marrow Bone marrow cells flushed out from femurs, tibias, and humeri were strained through 70 µm cell strainers (Becton Dickinson, Franklin Lakes, NJ). After washing, cells were resuspended in cytotoxicity medium (Cedarlane, Hornby, ON, Canada) at a concentration of 1 × 107/mL. Purified anti-Thy1.2 monoclonal antibody (0.1 µg per 1 × 107 cells) (Pharmingen, San Diego, CA) was added and mixed. After 60 minutes of incubation on ice, the cells were washed once and then suspended in cytotoxicity medium containing 1:10 Low-Tox-M Rabbit Complement (Cedarlane). The cells were incubated at 37°C for 60 minutes and washed twice before use. The final product contained less than 0.08% mature T cells, 0.11% interleukin-2 (IL-2)-producing cells and less than 0.01% interferon- (IFN )-producing cells.
Stem cell transplantation BALB/c recipients, 9 to 12 weeks old at time of transplantation, were lethally irradiated (8.5 Gy), and were injected intraveneously via the tail vein with either: (1) graded doses of T-cell-depleted bone marrow cells from adult C57BL/6 mice, or (2) graded doses of full-term fetal blood cells. For the syngeneic full-term fetal blood control, lethally irradiated (10.5Gy) C57BL/6 mice were infused with 1 × 106 full-term fetal blood cells from C57BL/6 fetuses. All experiments were performed according to Duke University Institutional Animal Care and Use Committee (IACUC) guidelines. Mortality was recorded daily. Recipients were monitored daily for clinical signs of GVHD by the following parameters: body weight and extent of skin changes (hair loss and erythema) scored on a cumulative severity scale from 0 (none) to 8 (maximum): head 1, neck 1, back (1/3,2/3,3/3) 1-3, and front (1/3,2/3,2/3) 1-3 as described.11-14 Skin biopsies (from the ear) for histologic evidence of GVHD were routinely taken on days +30, +70, and +100 after transplantation and when mice were moribund.15Flow cytometric analysis Fifty microliters of blood or 1 × 106 cells were incubated with titrated antibodies for 15 minutes at room temperature in the dark. To lyse red cells in the whole blood samples, the stained adult whole blood was then processed in Multi-Q-Prep (Coulter, Miami, FL); the stained fetal blood was lysed with 1x FACS lysing solution (Becton Dickinson, San Jose, CA) and washed twice before analysis. The stained cells were analyzed using a Coulter EPICS XL-MCL flow cytometer equipped with System II software (Coulter). The antibodies used were fluorescein isothiocyanate (FITC)-conjugated anti-CD11b (M1/70), CD62L (MEL-14), goat anti-hamster IgG, H-2Db (CTDb), phycoerythrin (PE)-conjugated anti-CD3 (145-2C11), Gr-1 (RB6-8C5), V 3 (KJ25), Cy5PE-conjugated streptavidin, anti-CD3 (145-2C11) and
their isotype controls from Pharmingen (San Diego, CA); FITC-conjugated
anti-CD4 (CT-CD4), B220 (RA3-6B2), H-2Db (CTDb), IL-2
(JES6-5H3), interferon gamma (IFN ) (XMG1.2), and PE-conjugated
anti-CD4 (CT-CD4); CD8 (CT-CD8a), B220 (RA3-6B2), NK1.1 (PK136),
tricolor(TC)-conjugated anti-CD4 (CT-CD4), CD8 (CT-CD8 ),
CD45 (YW62.3) and their isotype controls from Caltag (San Francisco,
CA); and red 613-conjugated anti-CD4 (H129.19) from Life Technologies
(Gaithersburg, MD); FITC-conjugated anti-BrdU (B44) (BDIS, San Jose,
CA), and purified anti-CD11c (N418) (Harlan Bioproducts for Science,
Indianapolis, IN).
Mixed lymphocyte reaction measured by [3H]thymidine incorporation Responder spleen cells (2.5 × 105) were plated in flat-bottom 96-well culture plates with 5 × 105 irradiated (20 Gy) spleen stimulator cells in a final volume of 200 µL. After 96 hours of incubation in 37°C and 5% CO2, cultures were pulsed with 1 µCi [3H]thymidine per well and harvested 16 hours later. Triplicate cultures were set up for every cell population tested. Culture medium was RPMI 1640 supplemented with 10% prescreened fetal calf serum, 2 mM L-glutamine, 50 µM 2-mercaptoethanol, 100 U/mL penicillin, 100 µg/mL streptomycin. This medium was used for all subsequent in vitro studies.Cytotoxic T lymphocyte assay Graded numbers of responder cells were plated with 5 × 105 irradiated (20 Gy) stimulator cells. Plates were cultured in 37°C, 5% CO2 incubator for 112 hours. The cells were tested in situ for lysis of 51Cr-labeled 2-day Con A blast cells. After 4 hours of culture, supernatant was removed and counted in a gamma counter. In each experiment, cultures were tested in parallel for lysis of irrelevant targets to ensure antialloantigen-specific killing. The percentage of specific release was calculated as follows: ([experimental release spontaneous
release] / [maximal release spontaneous release]) × 100 = % specific release.
Spontaneous release was obtained by incubating target cells with stimulator cells only. Maximal release was obtained after treatment with 1% Igepal CA-630 (Sigma). Alloantigen-specific cytotoxic antibody assay Target C3H/HeJ spleen cells were prepared at 1 × 106/mL in cytotoxicity medium (Cedarlane). Target cells (25 µL) and test serum samples (25 µL) were added to each well of round-bottom 96-well culture plates. After one hour of incubation at 4°C, wells were washed once and 50 µL per well of complement medium (1:12 dilution) (Cedarlane) was added. After an additional one hour of incubation at 37°C, 5 µL of 1% trypan blue (Life Technologies) per well was added. Three minutes later, we scored live versus dead cells in a hemocytometer. Cytotoxic index was calculated as follows: ([% dead cells {serum + complement}] [% dead cells {complement
alone}] / [100% % dead cells {complement
alone}]) × 100 = cytotoxic index.
Bromodeoxyuridine assay for detection of cellular proliferation The assay was performed as described.16 Spleen cells (1.25 × 106 per well) were cultured with either a T-cell mitogen (immobilized anti-CD3; Pharmingen) or B-cell mitogens (anti-IgM, Jackson ImmunoResearch Laboratories, West Grove, PA; lipopolysaccharide [LPS], Sigma Chemical) in flat-bottom 48-well culture plates at 37°C and 5% CO2 for 48 hours. A final concentration of 30 µM of bromodeoxyuridine (BrdU) (Sigma Chemical) was added 24 hours before harvest. After culture, the cells were transferred into 6 mL tubes and washed once. The cells were then resuspended in 0.5 mL of FACS permeabilizing solution (BDIS) for fixation and permeabilization. After 3 hours of incubation at 4°C, cells were washed twice, stained with anti-BrdU antibody (10 µg/mL; BDIS) and anti-surface marker antibodies in the presence of DNAse I (Sigma) at a final concentration of 4 mg/mL for 30 minutes at room temperature. The stained cells were analyzed using a Coulter EPICS XL-MCL flow cytometer equipped with System II software (Coulter). This assay correlates well with proliferation assay measured by [3H]thymidine incorporation (r2 = 0.997 for T-cell response against phytohemagglutinin [PHA]; r2 = 0.990 for B-cell response against anti-IgM; data not shown).Cardiac transplantation The method of Fulmer et al,17 as modified separately by Judd and Trentin18 and Babany et al,19 was used for cardiac transplantation. Briefly, the dorsum of the pinna of an adult mouse was cleaned with 70% ethanol and a pouch 3 to 4 mm in diameter was prepared. The heart of a neonatal mouse (< 48 hours old) was placed in the pouch. Residual fluid was cleared from the pouch with a cotton swab after transplantation. Grafts were examined for contractions with a stereomicroscope at 10-fold magnification. Grafts resumed visual contraction between 6 to 7 days after transplantation. Rejection is defined as the point of cessation of visual cardiac activity. Grafts that were never observed to be contracting were considered surgical failure, and those data were excluded (none in this study). All grafts were monitored daily until day 60 after heart transplantation.Quantification of mouse T-cell receptor signal joint excision circles
(mTREC) are generated by a recombination event between pseudo J alpha
and one of the 2 primary murine delta rec loci during TCR gene
rearrangment in developing thymocytes. This recombination event
generates a novel DNA sequence on an extrachromosomal DNA circle.20 Molecules of mTREC were quantitated by real-time
polymerase chain reaction (PCR) using a standard curve of known number
of molecules of mTREC, and specific primers and fluorescent probes as
described (G.D.S. et al, manuscript in preparation, August 2001).21,22
For determination of molecules of mTREC per splenocyte or
CD4+ or CD8+ splenocytes, single-cell
suspensions of splenocytes were prepared by teasing the tissue through
70-µm cell strainers (Becton Dickinson Labware) using a 1 cc syringe
plunger. Splenocytes were layered over Ficoll and centrifuged to remove
red blood cells, and then separated into CD4+ and
CD8+ populations using magnetic beads (Miltenyi Biotec,
Auburn, CA). Cells were precisely counted using a hemacytometer and
spun down for 2 minutes in a microfuge (12 000 rpm). Cell pellets were
frozen at An mTREC DNA standard for real-time PCR was generated by PCR-cloning a
482-base pair (bp) fragment of mTREC DNA from mouse thymus genomic DNA
into pCR2 (Invitrogen, Carlsbad, CA). The plasmid was grown up in
Escherichia coli and isolated by Maxi Prep (Qiagen, Valencia, CA). The absolute number of molecules of mTREC standard per 1 µg of plasmid DNA was determined and used to prepare stock dilutions
of 107, 106, 105, 104,
103, and 102 molecules of mTREC per 5 µL
(stored at Molecules of mTREC were quantitated by real-time quantitative PCR with the primers CATTGCCTTTGAACCAAGCTG and TTATGCACAGGGTGCAGGTG, and fluorescent probe FAM-CAGGGCAGGTTTTTGTAAAGGTGCTGCTCACTT-QSY (MegaBases, Evanston, IL). PCR reactions contain 0.5 U Platinum taq polymerase (Life Technologies), 3.5 mM MgCl2, 0.2 mM dNTPs, 500 nM each primer, 150 nM probe, and 1 × Blue-636 reference dye (MegaBases). Amplification conditions were 95°C for 5 minutes, then 40 cycles of 95°C for 30 seconds and 60°C for 1 minute. Genomic DNA samples were amplified and quantitated using an ABI Prism 7700 Sequence Detection System (PerkinElmer, Foster City, CA). Fluorescence of each reaction was detected at each cycle and used to determine molecules of mTREC using the standard curve by ABI Prism software. Samples were analyzed in duplicate. Molecules of mTRECs were determined in cell lysates equivalent to 50 000 cells. Statistical analysis Groupwide comparison was done by analysis of variance (ANOVA). Survival data were analyzed by log rank test. All statistical analyses were done using Statview software (SAS Institute, Cary, NC). It is considered not statistically significant if the P value is more than .05.
Engraftment As demonstrated in Figure 1, all BALB/c mice that received lethal doses of radiation (8.5 Gy) died from bone marrow failure within 3 weeks after radiation (Figure 1B). Administration of 1 × 106 allogeneic full-term fetal blood cells from a 20-day-old C57BL/6 fetus rescued 13% of lethally irradiated BALB/c mice (Figure 1B; P < .05 compared with radiation-only control) that survived more than 100 days and remained healthy up to 200 days after transplantation. By increasing the cell numbers infused, there was not a statistical increase in the surviving rates (23% for 2.5 × 106, 18% for 5 × 106 on day +100, not significant between full-term fetal blood groups). The majority (> 70%) of the full-term fetal blood recipients died within the first 3 weeks. In contrast, allogeneic T-cell-depleted bone marrow cells protected the mice from lethal radiation in a dose-dependent manner (Figure 1A; 64% for 1 × 106, 79% for 2.5 × 106, 100% for 5 × 106 with the observation period of 100 days). A quantity of 1 × 106 syngeneic full-term fetal blood cells was also enough to rescue the recipients from lethal radiation (Figure 1B). These data suggest that allogeneic full-term fetal blood had a lower rate of engraftment compared with allogeneic T-cell-depleted bone marrow based on probability of survival. We next investigated the engraftment kinetics of full-term fetal blood stem cells compared with T-cell-depleted adult bone marrow stem cells in the allogeneic setting.
It is well known that T-cell depletion results in mixed chimerism in
animal models when insufficient stem cells are infused. The level of
mixed chimerism is related to the T-cell dose of the graft as well as
to the total numbers of stem cells.23 We therefore tested
the chimerism status of allogeneic fetal blood and bone marrow
recipients. Figure 2A depicts one
representative flow cytometric chimeric analysis. Full donor chimerism
(> 95% H-2Db+ cells) was demonstrated in all allogeneic
full-term fetal blood recipients, demonstrating the robust engraftment
potential of these cells. The full-term fetal blood recipients that
could survive the period of aplasia (see below) demonstrated superior
engraftment as measured by their conversion to full donor chimerism. In
contrast, the recipients of several doses
(1 × 106-5 × 106) of T-cell-depleted
bone marrow cells (Figure 2B) became mixed chimeras (a minimum of
1 × 107 T-cell-depleted bone marrow cells are needed
for inducing full donor chimerism in this model). It is important
to note that GVHD was not observed in either treatment group (data
not shown).
Many of the animals in the allogeneic full-term fetal blood group died
from bleeding problems compared with the T-cell-depleted bone marrow
group. We therefore monitored the engraftment of these animals by
following the peripheral blood counts of both groups. The data (Figure
3 and Figure
4) demonstrated that the animals were
dying because the allogeneic full-term fetal blood recipients became
profoundly thrombocytopenic, anemic, and neutropenic compared with the
bone marrow transplant controls. All animals had nadirs of all 3 lineages but whereas the T-cell-depleted bone marrow recipients
recovered between 1 and 2 weeks, hematopoietic recovery in the
full-term fetal blood recipients took significantly longer (Figure 3).
Absolute number of lymphocytes and lymphocyte subsets Phenotypic analyses of peripheral blood from long-term survivors (200 days after stem cell transplantation) were performed. Table 2 indicates that T cells (CD3+, CD3+4+, CD3+8+, CD4+62L+, and CD8+62L+) and B cells (B220+) were lower in allogeneic full-term fetal blood recipients compared with T-cell-depleted bone marrow recipients although the differences in CD3+8+ and CD8+62L+ cells were not statistically significant. There was no difference in the frequency of NK cells (NK1.1+CD3 )
compared with allogeneic T-cell-depleted bone marrow recipients, but
the absolute numbers were lower.
Measurement of in vivo responses: host-specific tolerance To determine host antigen-specific alloreactive T-cell responses, hearts from C3H/HeJ (third party) and BALB/c (recipient) newborn mice were transplanted into left and right pouches, respectively, created in the pinnae of ears of transplant recipients between day 118 and day 145 after stem cell transplantation. Similar to age-compatible BALB/c mice and T-cell-depleted bone marrow recipients, allogeneic full-term fetal blood recipients accepted hearts of recipient origin for at least 60 days after heart transplantation (Figure 5A; P < .01 compared with C57BL/6). All age-compatible C57BL/6 mice (positive control) rejected hearts of recipient origin between day 9 and day 11 after heart transplantation (Figure 5A).
Age-matched normal BALB/c, normal C57BL/6, and syngeneic full-term
fetal blood control (C57BL/6 Decreased immune responses against alloantigens in vitro Mice were challenged with third-party hearts (C3H/HeJ, H-2k) in vivo between day 118 and day 145 after stem cell transplantation. Forty-five to 85 days after the challenge, splenocyte and serum samples were taken for the following assays: proliferation, T-cell cytotoxicity, and cytotoxic antibody assays. Spleen cells were isolated and cultured with irradiated C3H/HeJ spleen cells for 112 hours for proliferation assays. As shown in Figure 6A, allogeneic full-term fetal blood recipients had lower proliferative responses against third-party alloantigens compared with allogeneic T-cell-depleted bone marrow recipients (P < .05) or normal C57BL/6 mice (P < .01) respectively. In contrast, syngeneic full-term fetal blood recipients had increased proliferative responses (P < .0001).
For the cytotoxicity assays, spleen cells were isolated and cultured with irradiated C3H/HeJ spleen cells for 112 hours. Effector cells were assayed for cytotoxicity in standard 51Cr release assay using 2-day Con A-activated C3H/HeJ spleen cells. As shown in Figure 6B, third-party alloantigen-specific cytotoxic T lymphocytes were elicited from normal C57BL/6, syngeneic full-term fetal blood and allogeneic T-cell-depleted bone marrow recipients, but not from allogeneic full-term fetal blood recipients (P < .01 in the ratio of 50:1 compared with other groups). We next evaluated whether cytotoxic antibodies specific to C3H/HeJ were generated after in vivo C3H/HeJ challenge in a microcytotoxicity assay. As shown in Figure 6C, high titers of cytotoxic antibody were generated in normal C57BL/6 mice and syngeneic full-term fetal blood recipients, but not in allogeneic T-cell-depleted bone marrow or allogeneic full-term fetal blood recipients (P < .01, compared with normal C57BL/6). Impaired B-cell proliferative responses against mitogen B-cell proliferative responses were determined by BrdU incorporation assay. At a per-cell level, B cells in allogeneic full-term fetal blood recipients did not proliferate as well as those found in allogeneic T-cell-depleted bone marrow recipients, syngeneic full-term fetal blood recipients, and normal C57BL/6 mice (Table 3, P < .05). In contrast, the proliferation responses of B cells from both allogeneic T-cell-depleted bone marrow and syngeneic full-term fetal blood recipients against either anti-IgM antibody or LPS were comparable with that from normal C57BL/6 mice (Table 3), demonstrating that B-cell proliferative defects were limited to allogeneic full-term fetal blood recipients.
Antigen-presenting cells To evaluate the role of antigen-presenting cells on the impaired immune function found in allogeneic full-term fetal blood recipients, we measured the frequency of splenic dendritic cells24,25 (CD11c+CD3 CD4 B220 Gr-1 ),
which are the most potent antigen-presenting cells.26 We also studied the ability of spleen cells to stimulate allogeneic T
cells from normal BALB/c mice in mixed lymphocyte reaction
(MLR). The frequency (data not shown) and the ability to
present alloantigens (Figure 7B) of
splenic dendritic cells were normal in allogeneic full-term fetal blood
recipients. However, the absolute numbers of splenic dendritic cells
were significantly lower in allogeneic full-term fetal blood recipients
compared with T-cell-depleted bone marrow recipients (Figure
7A, P < .01).
Measurement of T-cell receptor excision circle bearing recent thymic emigrants Proper thymic function is an important component of immune recovery following stem cell transplantation.27 The T-cell receptor excision circle (TREC) assay is a powerful method to follow the emergence of T cells in humans undergoing stem cell transplantation.21,27 When T-cell precursors rearrange the TCR chain locus the TCR locus is excised and forms a circular
episome. These signal joint TRECs (sjTRECs) are detected in T cells
that are recent thymic emigrants or long-lived naïve cells. T
cells that have divided in the periphery dilute out their no-replicated
TRECs. Recently, the sjTREC assay in mice has been established by
Sempowski et al (unpublished data, August 2001) and we have
utilized this assay to test the T-cell recovery in the various groups
of controls and experimental animals. This ability to quantitate mouse
thymic emigrants is critical to follow T-cell immune reconstitution
strategies. As can be appreciated from Table
4, allogeneic full-term fetal blood
recipients that have survived more than 100 days have a clear delay in
reconstitution of mTREC-positive T cells compared with T-cell-depleted
bone marrow-engrafted animals. These data are in agreement with the
phenotypic data presented in Table 2.
In this study, we have compared the outcomes following transplantation of allogeneic T-cell-depleted adult bone marrow with full-term fetal blood. Studies of the clinical outcome following cord blood transplantation (CBT) in humans have demonstrated that myeloid engraftment and immune reconstitution is impaired.1,4 Since full-term fetal/cord blood in mice is not comparable with that found in humans because murine full-term fetal cord blood contains essentially no T cells (Table 1), we have compared murine full-term fetal blood with murine T-cell-depleted adult bone marrow cells. In these 2 clinical situations where T cells are not present, engraftment of myeloid and lymphoid cells can be observed and studied free from the confounding effects of GVHD. The results demonstrate several interesting observations. First, in terms of hematopoietic engraftment, full-term fetal blood transplantation was not consistently able to protect the recipients from lethal irradiation when transplanted across a major histocompatibility complex (MHC) barrier (Figure 1). In full-term fetal blood, there is the suggestion of a relative paucity of radioprotective cells because when these cells are transplanted across an MHC barrier, the majority of recipients die from marrow aplasia (Figure 3 and Figure 4). On the other hand, syngeneic fetal cells protect the host quite well (Figure 1). However, if the allogeneic recipient survives the prolonged period of aplasia, the engrafting cells are quite potent in that the recipients become fully donor chimeric rather than mixed chimeras (Figure 2). The results suggest that the murine full-term fetal blood cells have efficient long-term engrafting potential if the animal can be supported through the first several weeks following transplantation. We also found a clear difference in the immune response between the ability of T-cell-depleted adult bone marrow compared with full-term fetal blood in both in vivo (Figure 5) and in vitro (Figure 6) responses. The impaired immune function in MHC mismatched adult murine recipients of full-term fetal blood was directly demonstrated in vivo through third-party heart transplantation (Figure 5). Abnormal immune responses can be due to decreased numbers of total
immunocompetent cells (quantitative defect). Phenotypic analysis of
lymphocytes and lymphocyte subsets (Table 2) demonstrated that absolute
numbers of lymphocyte subsets in allogeneic T-cell-depleted bone
marrow recipients had recovered to the same level as those of normal
C57BL/6 mice whereas allogeneic full-term fetal blood recipients had
decreased numbers of total peripheral blood T, B, and splenic dendritic
cells (Figure 7A) as well as CD4+62L+ T cells
(including all naïve and some "revertant"
antigen-experienced CD4+ T cells). These data suggested
that homeostasis of peripheral lymphocytes is normal in allogeneic
T-cell-depleted bone marrow recipients but is not adequately
maintained in recipients of allogeneic full-term fetal blood. The
changes in immune recovery between T-cell-depleted bone marrow and
full-term fetal blood may reflect the maturation status of the donor
cells, numbers of lymphoid progenitors found in the graft, or the lack
of proper niches for the full-term fetal blood cells to develop
properly. However, at a per-cell level, T cells from allogeneic
full-term fetal blood recipients proliferate and produce cytokines
(IFN GVHD, which has been demonstrated by many investigators to interfere with the immune function,8,9,28 might possibly contribute to the impaired immune function observed in allogeneic fetal blood recipients. However, neither clinical nor histologic evidence of GVHD was found (data not shown). Donor-recipient histoincompatibility7 may explain the impaired immune function in both recipients of allogeneic full-term fetal blood and allogeneic T-cell-depleted bone marrow. It is unclear, however, why there is a more profound immune deficiency found in allogeneic full-term fetal blood recipients compared with that in allogeneic T-cell-depleted bone marrow recipients. Analysis of recent thymic emigrants from T-cell-depleted bone marrow compared with full-term fetal blood (Table 4) demonstrates that there are fewer mTRECs per 100 000 CD4+ or CD8+ cells in the spleen of allogeneic full-term fetal blood recipients. Decreased thymic output in allogeneic full-term fetal blood recipients may have resulted from fewer lymphoid precursors in fetal blood. The differences we have observed between T-cell-depleted bone marrow and full-term fetal blood may possibly reflect the contribution of very small numbers of mature T cells that are still present in T-cell-depleted grafts compared with fetal blood, which is devoid of any mature T cells. However, this assumption is not supported by the observation of higher mTREC-positive T cells in T-cell-depleted bone marrow recipients (Table 4). Generation of specific antibody responses requires activation of B cells and T-cell help. B cells from allogeneic T-cell-depleted bone marrow and syngeneic full-term fetal blood recipients are normal in proliferation since they have comparable ability to proliferate with normal C57BL/6 mice (Table 3). In contrast, B cells from allogeneic full-term fetal blood recipients did not proliferate as well as those from other groups (Table 3), suggesting defective differentiation of B cells in allogeneic full-term fetal blood recipients, which may contribute to poor antibody production in these animals. In both allogeneic full-term fetal blood and allogeneic T-cell-depleted bone marrow recipients, normal or close-to-normal B-cell proliferation (Table 3), although unable to generate alloantigen-specific antibody in vivo (Figure 6C), suggests either a lack of T-cell help or inability to produce antibody by activated B cells. Global impaired immune function may also be due to defective antigen-presenting cells (Figure 7A).29 However, a normal frequency of splenic dendritic cells (data not shown), which are the most potent antigen-presenting cells,26 along with the ability to initiate alloresponse (Figure 7B), imply that antigen-presenting cells from allogeneic full-term fetal blood recipients do not have an intrinsic defect. Taken together, the mechanisms underlying the impaired immune function in allogeneic full-term fetal blood recipients include decreased absolute immunocompetent cells, indirect evidence of disturbance of T-cell homeostasis, reduced thymic output, and defects in B-cell antibody production. When combined, these differences contribute to the observed immune defects following allogeneic full-term fetal/cord blood engraftment. Understanding these differences will contribute to our understanding of CBT in our patients.
We would like to thank Dr Richard J. Rahija for assistance in collecting murine fetal blood, Dr Thaddeus V. Samulski for animal radiation, and Ms Julie Wilkinson for helpful discussion on flow cytometric techniques.
Submitted May 25, 2001; accepted August 30, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Nelson J. Chao, Bone Marrow Transplantation Program, Duke University Medical Center, 2400 Pratt St, Suite 1100, Durham, NC 27705; e-mail: chao0002{at}mc.duke.edu.
1.
Rubinstein P, Carrier C, Scaradavou A, et al.
Outcomes among 562 recipients of placental-blood transplants from unrelated donors [see comments].
N Engl J Med.
1998;339:1565-1577 2. Long G, Madan B, Kurtzberg J, et al. Unrelated umbilical cord blood transplants in adult patients with hematologic malignancies or genetic disorders [abstract]. Blood. 1999;94:570a.
3.
Kurtzberg J, Laughlin M, Graham ML, et al.
Placental blood as a source of hematopoietic stem cells for transplantation into unrelated recipients [see comments].
N Engl J Med.
1996;335:157-166
4.
Laughlin MJ, Barker J, Bambach B, et al.
Hematopoietic engraftment and survival in adult recipients of umbilical-cord blood from unrelated donors.
N Engl J Med.
2001;344:1815-1822 5. Janeway CA, Travers P, Walport M. Immunobiology. London, UK/New York, NY: Current Biology Limited/Garland Publishing; 1997.
6.
Markert ML, Boeck A, Hale LP, et al.
Transplantation of thymus tissue in complete DiGeorge syndrome [see comments].
N Engl J Med.
1999;341:1180-1189
7.
Urso P, Gengozian N.
T cell deficiency in mouse allogeneic radiation chimeras.
J Immunol.
1973;111:712-719 8. Hakim FT, Mackall CL. The immune system: effector and target of graft-versus-host disease. In: Ferrara JLM,Deeg HJ,Burakoff SJ, eds. Graft-vs-host disease New York, NY: Marcel Dekker; 1996:257-289.
9.
Dulude G, Roy DC, Perreault C.
The effect of graft-versus-host disease on T cell production and homeostasis.
J Exp Med.
1999;189:1329-1342 10. Kovacs MS, Lowe L, Kuehn MR. Use of superovulated mice as embryo donors for ES cell injection chimeras. Lab Anim Sci. 1993;43:91-93[Medline] [Order article via Infotrieve]. 11. Schlegel PG, Vaysburd M, Chen Y, Butcher EC, Chao NJ. Inhibition of T cell costimulation by VCAM-1 prevents murine graft-versus-host disease across minor histocompatibility barriers. J Immunol. 1995;155:3856-3865[Abstract]. 12. Claman HN, Jaffee BD, Huff JC, Clark RA. Chronic graft-versus-host disease as a model for scleroderma, II: mast cell depletion with deposition of immunoglobulins in the skin and fibrosis. Cell Immunol. 1985;94:73-84[CrossRef][Medline] [Order article via Infotrieve].
13.
Korngold R, Sprent J.
Variable capacity of L3T4+ T cells to cause lethal graft-versus-host disease across minor histocompatibility barriers in mice.
J Exp Med.
1987;165:1552-1564 14. Hamilton BL. L3T4-positive T cells participate in the induction of graft-vs-host disease in response to minor histocompatibility antigens. J Immunol. 1987;139:2511-2515[Abstract].
15.
Piguet PF, Grau GE, Allet B, Vassalli P.
Tumor necrosis factor/cachectin is an effector of skin and gut lesions of the acute phase of graft-vs.-host disease.
J Exp Med.
1987;166:1280-1289 16. Mehta BA, Maino VC. Simultaneous detection of DNA synthesis and cytokine production in staphylococcal enterotoxin B activated CD4+ T lymphocytes by flow cytometry. J Immunol Methods. 1997;208:49-59[CrossRef][Medline] [Order article via Infotrieve]. 17. Fulmer RI, Cramer AT, Liebelt RA, Liebelt AG. Transplantation of cardiac tissue into the mouse ear. Am J Anat. 1963;113:273-286[CrossRef][Medline] [Order article via Infotrieve]. 18. Judd KP, Trentin JJ. Cardiac transplantation in mice, I: factors influencing the take and survival of heterotopic grafts. Transplantation. 1971;11:298-302[Medline] [Order article via Infotrieve].
19.
Babany G, Morris RE, Babany I, Kates RE.
Evaluation of the in vivo dose-response relationship of immunosuppressive drugs using a mouse heart transplant model: application to cyclosporine.
J Pharmacol Exp Ther.
1988;244:259-262 20. Takeshita S, Toda M, Yamagishi H. Excision products of the T cell receptor gene support a progressive rearrangement model of the alpha/delta locus. EMBO J. 1989;8:3261-3270[Medline] [Order article via Infotrieve]. 21. Douek DC, McFarland RD, Keiser PH, et al. Changes in thymic function with age and during the treatment of HIV infection. Nature. 1998;396:690-695[CrossRef][Medline] [Order article via Infotrieve].
22.
Sempowski GD, Thomasch JR, Gooding ME, et al.
Effect of thymectomy on human peripheral blood T cell pools in myasthenia gravis.
J Immunol.
2001;166:2808-2817 23. Bachar-Lustig E, Rachamim N, Li HW, Lan F, Reisner Y. Megadose of T cell-depleted bone marrow overcomes MHC barriers in sublethally irradiated mice. Nat Med. 1995;1:1268-1273[CrossRef][Medline] [Order article via Infotrieve]. 24. Ardavin C. Thymic dendritic cells [see comments]. Immunol Today. 1997;18:350-361[CrossRef][Medline] [Order article via Infotrieve].
25.
Anjuere F, Martin P, Ferrero I, et al.
Definition of dendritic cell subpopulations present in the spleen, Peyer's patches, lymph nodes, and skin of the mouse.
Blood.
1999;93:590-598 26. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[CrossRef][Medline] [Order article via Infotrieve].
27.
Patel DD, Gooding ME, Parrott RE, Curtis KM, Haynes BF, Buckley RH.
Thymic function after hematopoietic stem-cell transplantation for the treatment of severe combined immunodeficiency.
N Engl J Med.
2000;342:1325-1332 28. Parkman R, Weinberg KI. Immunological reconstitution following bone marrow transplantation. Immunol Rev. 1997;157:73-78[CrossRef][Medline] [Order article via Infotrieve].
29.
Murata K, Ishii N, Takano H, et al.
Impairment of antigen-presenting cell function in mice lacking expression of OX40 ligand.
J Exp Med.
2000;191:365-374
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. B. Salter, S. K. Meadows, G. G. Muramoto, H. Himburg, P. Doan, P. Daher, L. Russell, B. Chen, N. J. Chao, and J. P. Chute Endothelial progenitor cell infusion induces hematopoietic stem cell reconstitution in vivo Blood, February 26, 2009; 113(9): 2104 - 2107. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Narimatsu, S. Miyakoshi, T. Yamaguchi, M. Kami, T. Matsumura, K. Yuji, N. Murashige, E. Kusumi, Y. Kodama, T. Komatsu, et al. Chronic graft-versus-host disease following umbilical cord blood transplantation: retrospective survey involving 1072 patients in Japan Blood, September 15, 2008; 112(6): 2579 - 2582. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Chen, X. Cui, G. D. Sempowski, J. Domen, and N. J. Chao Hematopoietic stem cell dose correlates with the speed of immune reconstitution after stem cell transplantation Blood, June 1, 2004; 103(11): 4344 - 4352. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Chen, X. Cui, G. D. Sempowski, C. Liu, and N. J. Chao Transfer of allogeneic CD62L- memory T cells without graft-versus-host disease Blood, February 15, 2004; 103(4): 1534 - 1541. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||