Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morison, I. M.
Right arrow Articles by Reeve, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morison, I. M.
Right arrow Articles by Reeve, A. E.
Related Collections
Right arrow Neoplasia
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 January 2002, Vol. 99, No. 1, pp. 375-377

BRIEF REPORT

Preferential loss of maternal 9p alleles in childhood acute lymphoblastic leukemia

Ian M. Morison, Lana M. Ellis, Lochie R. Teague, and Anthony E. Reeve

From the Cancer Genetics Laboratory, Department of Biochemistry, University of Otago, Dunedin, New Zealand; and Paediatric Haematology/Oncology, Starship Children's Health, Auckland, New Zealand.


    Abstract
Top
Abstract
Introduction
Study design
Results and discussion
References

Germ-line events, such as paternal mutation or genomic imprinting, contribute to the early onset of childhood cancers such as retinoblastoma, Wilms tumors, and neuroblastoma. Given the high frequency of deletion involving chromosome 9p in childhood acute lymphoblastic leukemia (ALL), this study investigated whether 9p deletion might reflect preexisting germ-line gene inactivation. To do this the parental origin of deletion was determined in 10 cases of ALL with 9p21 loss of heterozygosity. Of these cases, 9 showed loss of the maternally derived allele, suggesting that a germ-line event involving a 9p gene may play a role in the onset of childhood ALL. (Blood. 2002;99:375-377)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Study design
Results and discussion
References

The young age of onset of childhood cancers can often be attributed to a constitutional genetic predisposition. In some cases the predisposition results from the inheritance of a familial mutation, whereas in other cases it reflects the occurrence of de novo germ-line mutation, as observed in some cases of retinoblastoma,1 or the involvement of an imprinted gene, as seen in Wilms tumors and some neuroblastomas.2 Although childhood acute lymphoblastic leukemia (ALL) is seldom familial, we hypothesized that a constitutional predisposition might explain its early age of onset. The chromosome 9p21 region, which contains CDKN2A and CDKN2B, is a candidate region for a predisposing genetic event because deletion of this area is the most common known molecular abnormality in childhood ALL, occurring in 35% to 60% of cases.3,4 To determine whether constitutional modification of a chromosome 9p21 gene might be involved in childhood ALL, we determined the parental origin of the deleted 9p21 allele in a series of 48 cases of childhood ALL.


    Study design
Top
Abstract
Introduction
Study design
Results and discussion
References

A total of 48 children with ALL were recruited at pediatric oncology clinics throughout New Zealand. Archived slides of bone marrow aspirate previously obtained at presentation and at remission were collected after obtaining informed consent in accord with the instructions of regional ethics committees. The age, diagnosis, proportion of blasts, and the reported karyotype are shown in Table 1. Given that children were recruited at follow-up clinics up to 3 years after diagnosis, there may have been a bias toward cases with longer survival.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. The age, diagnosis, percentage of bone marrow blasts, reported karyotype, and allele ratios (lost-retained allele) at tetranucleotide markers D9S1679, D9S746, and D9S761 for the 10 cases of ALL showing loss of heterozygosity

DNA was extracted from unfixed archived slides of bone marrow aspirate with the use of a previously published method5 except that 20 mM EDTA was substituted for the 2.5 mM MgCl2 in the extraction buffer, and the proteinase K digestion was performed at 56°C overnight, followed by an additional 2 hours at 56°C with fresh proteinase K. Parental DNA was extracted from peripheral blood leukocytes.

Loss of heterozygosity

Loss of heterozygosity (LOH) was assessed by using 3 polymorphic tetranucleotide repeat markers D9S1679, D9S746, and D9S761 located on 9p, which are currently mapped to approximately 3, 6, and 14 Mb centromeric of CDKN2A, respectively, within the region showing a high frequency of LOH.3 Polymerase chain reaction (PCR) primers used were D9S746, ACAACTGCTGTCACTCACTGA, AACACAGCGAGACTCCATCTC; D9S761, GCCAAGACCACCGCAGTAC, GGAAGGGAACCCCCATACG; and D9S1679, CACCTCTGCCTGCCAA, TGCTGTGGACCTAACAAAAA. Forward primers were labeled with IRD 800. The relative intensities of the microsatellite alleles amplified from presentation bone marrow slides were quantified by using a LI-COR (Lincoln, NE) DNA sequencer model 4000L and normalized against paired remission bone marrow samples. Samples were scored as having LOH when the relative allele intensity was less than 0.3, an arbitrary cutoff level based on the occurrence of LOH in at least 80% of leukemic cells in a sample containing 10% normal cells. By examining the parental microsatellite bands, the origin of the lost allele was determined. Note that in samples with homozygous loss at a marker, there would be no evidence of any deletion because amplified bands will be derived from residual normal bone marrow cells.

Sequencing

Exon 1-beta of CDKN2A was amplified by PCR, using primers as previously described,6 with the addition of a T3 sequence 5' of the forward primer. PCR products were sequenced by using Amersham Thermosequenase cycle sequencing kit with IRD-labeled T3 primer. Sequencing products were visualized on a LI-COR DNA sequencer model 4000L.


    Results and discussion
Top
Abstract
Introduction
Study design
Results and discussion
References

Of the 48 cases of ALL, 10 showed LOH at one or more of the 3 polymorphic markers on chromosome 9p21 (Table 1, Figure 1). In 9 of these 10 cases the percentage of leukemic blasts in the bone marrow had been reported as more than 90% (for case 21, 81% blasts were reported). Apart from the results for case 53 at D9S1679, the amount of the deleted allele present was consistent with the proportion of normal cells in the bone marrow aspirate biopsy. The parental origin of the lost allele was determined, and in 9 of the 10 cases with LOH the lost allele was maternally derived (P = .02). In 8 of the 10 cases the parental origin of the lost allele was confirmed at more than one locus.


View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Two examples showing loss of the maternally inherited allele at marker D9S746. The lanes show leukemic (L), remission (R), maternal (M), and paternal (P) microsatellite PCR products as imaged on a LI-COR DNA sequencer.

The preferential loss of the maternally derived allele in leukemic cells suggests that a parent-specific process modifies chromosome 9p and that germ-line events may play a role in the leukemogenic pathway. This strong bias toward loss of the maternally derived 9p allele is supported by a previous small study by Heyman et al7 in which 4 of 5 cases of childhood ALL showed loss of the maternal allele (combined probability = 0.007).

The identity of the leukemogenic gene or genes in the 9p21 region is not yet certain, although good candidates exist. The region contains genes for at least 3 cell cycle regulatory proteins p15, p16, and p14ARF and there is good evidence for the existence of another tumor suppressor gene (TSG) nearby.8 An additional complexity with respect to this region is that some cases of ALL show hemizygous deletion, whereas others show homozygous deletion. Acquisition of homozygous loss during tumor evolution suggests that nullisomy for 9p21 may not be necessary for leukemia initiation, but that progressive loss of genes may enhance malignant growth.9-11 Because analysis of leukemic cells at clinical presentation will reflect the summation of all previous genomic events, the interpretation of observations from 9p21 requires caution. However, we propose 3 models to explain the parental bias of LOH, each of which is consistent with the involvement of a TSG on chromosome 9p and in each the maternal deletion provides the "second hit," unmasking prior changes on the paternal allele.

In the first model, maternal LOH unmasks genetic mutation of a 9p TSG on the paternal allele. A precedent for this model is provided by bilateral retinoblastoma in which paternal de novo RB mutations are followed by somatic loss of the maternally derived allele.1 For childhood ALL, mutations of the candidate genes CDKN2A and CDKN2B are rare, although exon 1-beta of CDKN2A that encodes the p14ARF protein has not yet been extensively investigated.12-14 Because of this we sequenced exon 1-beta in the 10 cases of ALL showing LOH by using primers as previously described,6 but no mutations were detected. However, a model involving genetic mutation would appear to conflict with observations on the lack of heritability of ALL. That is, very few familial cases of ALL have been reported, and no increase in the rate of malignancy in the offspring of children with ALL has been observed.15

A second model that could account for the apparent germ-line origin but the lack of heritability assumes that the paternal mutation is epigenetic. A pathologic epigenetic event, in which a gene is inactivated by inappropriate methylation during spermatogenesis, provides a plausible explanation because epigenetic inactivation CDKN2B, through promoter methylation, has been observed in some cases of ALL. In these cases, about half of the leukemic DNA samples from leukemias with LOH of 9p genes showed methylation of the remaining allele.16

The third model proposes that the paternally derived gene is not inactivated by mutation but by the normal physiologic process of genomic imprinting. A precedent for this model is the preferential deletion of the maternal copy of p73, an imprinted TSG involved in childhood neuroblastoma.2 Although studies in mice provide no evidence to support genomic imprinting of Cdkn2a or Cdkn2b, it is interesting that imbalances between the relative expression levels of CDKN2A alleles, which might reflect genomic imprinting, have been reported.17

Our data together with previous data from Heyman et al7 provide strong evidence for the involvement of a paternal germ-line factor that predisposes to a proportion of cases of childhood ALL. If this factor involves a pathologic process, such as genetic or epigenetic mutation, then targeted epidemiologic studies of the paternal environment in the subgroup of children with 9p LOH may provide a useful way forward to understanding the environmental factors involved in childhood ALL.


    Footnotes

Submitted April 16, 2001; accepted August 23, 2001.

Supported by the Cancer Society of New Zealand, the New Zealand Lottery Grants Board, and the Child Cancer Foundation.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Ian M. Morison, Cancer Genetics Laboratory, Department of Biochemistry, University of Otago, PO Box 56, Dunedin, New Zealand; e-mail: ian.morison{at}otago.ac.nz.


    References
Top
Abstract
Introduction
Study design
Results and discussion
References

1. Kato MV, Ishizaki K, Shimizu T, et al. Parental origin of germ-line and somatic mutations in the retinoblastoma gene. Hum Genet. 1994;94:31-38[CrossRef][Medline] [Order article via Infotrieve].

2. Kaghad M, Bonnet H, Yang A, et al. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell. 1997;90:809-819[CrossRef][Medline] [Order article via Infotrieve].

3. Takeuchi S, Koike M, Seriu T, et al. Homozygous deletions at 9p21 in childhood acute lymphoblastic leukemia detected by microsatellite analysis. Leukemia. 1997;11:1636-1640[CrossRef][Medline] [Order article via Infotrieve].

4. Chambon-Pautas C, Cavé H, Gérard B, et al. High-resolution allelotype analysis of childhood B-lineage acute lymphoblastic leukemia. Leukemia. 1998;12:1107-1113[CrossRef][Medline] [Order article via Infotrieve].

5. Brisco MJ, Condon J, Hughes E, et al. Prognostic significance of detection of monoclonality in remission marrow in acute lymphoblastic leukemia in childhood. Leukemia. 1993;7:1514-1520[Medline] [Order article via Infotrieve].

6. FitzGerald MG, Harkin DP, Silva-Arrieta S, et al. Prevalence of germ-line mutations in p16, p19ARF, and CDK4 in familial melanoma: analysis of a clinic-based population. Proc Natl Acad Sci U S A. 1996;93:8541-8545[Abstract/Free Full Text].

7. Heyman M, Grandér D, Bröndum-Nielsen K, Liu Y, Söderhäll S, Einhorn S. Deletions of the short arm of chromosome 9, including the interferon-alpha -beta genes, in acute lymphocytic leukaemia. Studies on loss of heterozygosity, parental origin of deleted genes and prognosis. Int J Cancer. 1993;54:748-753[Medline] [Order article via Infotrieve].

8. Hamada K, Kohno T, Takahashi M, et al. Two regions of homozygous deletion clusters at chromosome band 9p21 in human lung cancer. Genes Chromosomes Cancer. 2000;27:308-318[CrossRef][Medline] [Order article via Infotrieve].

9. Glendening JM, Flores JF, Walker GJ, Stone S, Albino AP, Fountain JW. Homozygous loss of the p15INK4B gene (and not the p16INK4 gene) during tumor progression in a sporadic melanoma patient. Cancer Res. 1995;55:5531-5535[Abstract/Free Full Text].

10. Maloney KW, McGavran L, Odorn LF, Hunger SP. Acquisition of p16INK4a and p15INK4b gene abnormalities between initial diagnosis and relapse in children with acute lymphoblastic leukemia. Blood. 1999;93:2380-2385[Abstract/Free Full Text].

11. Carter TL, Reaman GH, Kees UR. INK4A/ARF deletions are acquired at relapse in childhood acute lymphoblastic leukaemia: a paired study on 25 patients using real-time polymerase chain reaction. Br J Haematol. 2001;113:323-328[CrossRef][Medline] [Order article via Infotrieve].

12. Quelle DW, Cheng M, Ashmun RA, Sherr CJ. Cancer-associated mutations at the INK4a locus cancel cell cycle arrest by p16INK4a but not by the alternative reading frame protein p19ARF. Proc Natl Acad Sci U S A. 1997;94:669-673[Abstract/Free Full Text].

13. Ruas M, Peters G. The p16INK4a/CDKN2a tumor suppressor and its relatives. Biochim Biophys Acta. 1998;1378:F115-F177[Medline] [Order article via Infotrieve].

14. Gardie B, Cayuela J-M, Martini S, Sigaux F. Genomic alterations of the p19ARF encoding exons in T-cell acute lymphoblastic leukemia. Blood. 1998;91:1016-1020[Abstract/Free Full Text].

15. Hawkins MM, Draper GJ, Winter DL. Cancer in the offspring of survivors of childhood leukaemia and non-Hodgkin lymphomas. Br J Cancer. 1995;71:1335-1339[Medline] [Order article via Infotrieve].

16. Herman JG, Civin CI, Issa J-P, Collector MI, Sharkis SJ, Baylin SB. Distinct patterns of inactivation of p15INK4B and p16INK4A characterize the major types of hematological malignancies. Cancer Res. 1997;57:837-841[Abstract/Free Full Text].

17. Rizos H, Becker TM, Holland EA, Kefford RF, Mann GJ. Differential expression of p16INK4a and p16beta transcripts in B-lymphoblastoid cells from members of hereditary melanoma families without CDKN2A exon mutations. Oncogene. 1997;15:515-523[CrossRef][Medline] [Order article via Infotrieve].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
J. L. Wilson, I. M. Morison, K. Paulsson, and B. Johansson
No evidence for preferential maternal origin of duplicated chromosome 14 in hyperdiploid ALL
Blood, February 15, 2005; 105(4): 1837 - 1838.
[Full Text] [PDF]


Home page
Cancer Res.Home page
M. Raghavan, D. M. Lillington, S. Skoulakis, S. Debernardi, T. Chaplin, N. J. Foot, T. A. Lister, and B. D. Young
Genome-Wide Single Nucleotide Polymorphism Analysis Reveals Frequent Partial Uniparental Disomy Due to Somatic Recombination in Acute Myeloid Leukemias
Cancer Res., January 15, 2005; 65(2): 375 - 378.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Paulsson, I. Panagopoulos, S. Knuutila, K. J. Jee, S. Garwicz, T. Fioretos, F. Mitelman, and B. Johansson
Formation of trisomies and their parental origin in hyperdiploid childhood acute lymphoblastic leukemia
Blood, October 15, 2003; 102(8): 3010 - 3015.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. J. M. van Schooten, L. M. Ellis, I. M. Morison, and J. Webb
Reassessment of loss of heterozygosity within MLL in childhood acute lymphoblastic leukemia
Blood, May 15, 2003; 101(10): 4222 - 4222.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morison, I. M.
Right arrow Articles by Reeve, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morison, I. M.
Right arrow Articles by Reeve, A. E.
Related Collections
Right arrow Neoplasia
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020