| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Cancer Research and Molecular
Biology and the Section of Hematology, Department of Environmental
Medicine, Norwegian University of Science and Technology, Trondheim,
Norway.
Interleukin-21 (IL-21) is a recently cloned cytokine with homology
to IL-2, IL-4, and IL-15. In this study we examined the effects of
IL-21 on human myeloma cells. We found that IL-21 induced proliferation
and inhibited apoptosis of the IL-6-dependent human myeloma cell lines
ANBL-6, IH-1, and OH-2. The potency of IL-21 was close to that of IL-6
in the OH-2 cell line. Neutralizing antibodies to IL-6 or the IL-6
receptor transducer chain (gp130) did not affect IL-21-induced DNA
synthesis, indicating that IL-21-induced proliferation was not
mediated through these proteins. Tumor necrosis factor (TNF), another
stimulator of myeloma cell growth, up-regulated the expression level of
IL-21 receptor (IL-21R), and combinations of TNF and IL-21 gave
synergistic effects on myeloma cell proliferation. Furthermore, 4 of 9 purified samples of primary myeloma cells showed a significant increase
in DNA synthesis on stimulation of the cells by IL-21. By Western blot
analysis, we demonstrated that the intracellular signaling pathways of
IL-21 in myeloma cells involved phosphorylation of Jak1, Stat3, and
Erk1/2 (p44/42 mitogen-activated protein kinase). IL-21 is a novel
growth and survival factor in multiple myeloma and may represent a
target for future therapy.
(Blood. 2002;99:3756-3762) Multiple myeloma (MM) is a neoplasia of terminally
differentiated B lymphocytes. The disease is usually confined to the
bone marrow. MM is still incurable, with a median patient survival time
of 3 to 4 years.1,2
Refractory late-stage MM is characterized by an increase in plasma cell
labeling index and often involves cells that are responsive to cytokine
stimulation.3 Several cytokines have been implicated in
the pathogenesis of MM. Interleukin-6 (IL-6) is considered the major
growth and antiapoptotic factor for myeloma cells.4-6 However, other cytokines may substitute for IL-6 as a growth factor in
vitro, including tumor necrosis factor (TNF), IL-10, insulinlike growth
factor-1 (IGF-1), interferon alpha, and IL-15.7-14 Freshly isolated cells from patients with MM generally grow poorly in vitro
despite the presence of known growth-promoting factors. This may imply
that myeloma cells depend on still unknown growth factors in vivo.
Finding these factors is important for identification of new
therapeutic targets.
IL-21 and its receptor (IL-21R) were recently
described.15,16 Mature IL-21 is a 131-amino acid residue
4-helix-bundle cytokine with significant sequence homology to IL-2,
IL-4, and, in particular, IL-15. IL-21R has highest homology to the
IL-2R beta chain and the IL-4R alpha chain.15,16
Upon ligand binding, IL-21R has been reported to associate with the
common The biologic functions of IL-21 have so far not been extensively
studied. The main source of IL-21 seems to be activated T lymphocytes.15 IL-21 apparently influences the function of
B, T, and natural killer (NK) lymphocytes at concentrations in the range of 2 to 50 ng/mL. In vitro experiments suggest that IL-21 has
divergent effects on B cells, depending on the nature of the costimulus. IL-21 stimulates proliferation of CD40-activated B cells
but inhibits proliferation induced by anti-IgM antibodies and
IL-4.15 Furthermore, IL-21 induces proliferation and
maturation of NK cell populations from the bone marrow, especially in
synergy with IL-15. IL-21 and anti-CD3 costimulate proliferation of
naive, but not memory, T cells.15 These findings indicate
an important regulatory role for IL-21 in the immune system.
So far, nothing has been published on the involvement of IL-21 in
pathophysiological processes. In this study we examined the effects of
IL-21 on myeloma cells.
Cell lines and culture conditions
An IL-6-dependent human myeloma cell line, IH-1, was established in
our laboratory from the pleural effusion of a myeloma patient.19 It secretes IgA Cells were grown in RPMI 1640 (Life Technologies, Paisley, United
Kingdom) supplemented with 100 µg/mL L-glutamine and 20 µg/mL
gentamicin (referred to as RPMI). ANBL-6, JJN-3, and U-266 were
maintained in RPMI supplemented with 10% heat-inactivated fetal calf
serum (FCS; Hyclone, Logan, UT) and RPMI 8226 with 15% FCS.
OH-2 and IH-1 cells were maintained in RPMI supplemented with 10%
human serum (Blood Bank, Trondheim University Hospital, Norway) because
these cell lines proliferate and thrive far better in human than in
fetal calf serum. The IL-6-dependent cell lines ANBL-6, IH-1, and OH-2
were maintained in media containing 2 ng/mL IL-6. Media were
replenished twice weekly. Cells were cultured at 37°C in a humidified
atmosphere containing 5% CO2. We washed the
IL-6-dependent cell lines and primary myeloma cells 4 times in Hanks
balanced salt solution (Life Technologies) to deplete the cells of
cytokines before the assays were performed.
Patients and isolation of myeloma cells
Reagents IL-21, soluble IL-21R, and antibodies against IL-21R were kind gifts from R. Holly (ZymoGenetics, Seattle, WA). IL-6 was from BioSource (Camarillo, CA), TNF was from Genentech (South San Francisco, CA), and neutralizing monoclonal antibodies to IL-6 and gp130 were from R&D Systems (Abingdon, United Kingdom). All cytokines used were recombinant human.mRNA analysis RNA isolation, cDNA synthesis, and reverse transcription (RT)-PCR were performed essentially as described.24 RT-PCR reactions were run 40 cycles with an annealing temperature of 64°C. IL-21R sense (5'CCAGGAGTGTGGCAGCTTTC) and antisense (5'GCTTGCCCTTCAGCATGTAGA) primers yielded a 143-base pair amplicon.Proliferation assays To measure DNA synthesis, cells were seeded in 96-well plastic culture plates (Corning Costar, Corning, NY) at a density of 2.5 × 104 cells per well in 200 µL RPMI supplemented with 10% FCS, cytokines and antibodies as indicated in each experiment. After 54 hours, they were pulsed with 0.037 MBq methyl-3H-thymidine (NEN Life Science Products, Boston, MA) per well and harvested 18 hours later with a Micromate 96-well harvester (Packard, Meriden, CT). Beta radiation was measured with a Matrix 96 counter (Packard).For cell number experiments, we seeded 3 × 105 cells in 5 mL RPMI with 10% FCS in 6-well plates or 1 × 106 cells in 10 mL RPMI with 10% FCS in culture bottles, and we supplemented the media with 1 ng/mL IL-6 or 10 ng/mL IL-21. The cells were counted 3 times a week. Media were not replenished. For evaluating IL-21 as a long-term growth factor, media were replenished once a week. Apoptosis assay Cellular viability and apoptosis were determined by flow cytometric analysis of annexin V binding25 and propidium iodide uptake (APOPTEST-FITC kit; Nexins Research, Hoeven, The Netherlands) and were performed as described.19 The cells were incubated with cytokines as indicated for 72 hours in RPMI containing 10% FCS and 1% human serum.Surface IL-21R detection Flow cytometry was used to determine the expression of IL-21R. We incubated 4 × 105 cells with 5 µg/mL biotinylated mouse monoclonal antibody against IL-21R for 30 minutes on ice in phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin. As a negative control we used irrelevant, isotype-matched, biotinylated monoclonal antibodies (anti-FLAG BioM2 biotin conjugate; Sigma, St Louis, MO). The cells were washed, and phycoerythrin-conjugated streptavidin (Becton Dickinson, San Jose, CA) was added for an additional 30 minutes. The cells were washed again and resuspended in PBS before they were analyzed on a flow cytometer (Beckman Coulter). Dead cells and debris were excluded from analysis on the basis of forward- and side-scatter signals.Western blot analysis Cells (2 × 106) were incubated in RPMI supplemented with 10% FCS and cytokines as indicated. They were starved overnight before Jak1 and Erk1/2 assays. After centrifugation and solubilization in 100 µL sodium dodecyl sulfate (SDS) sample buffer (100 mM Tris/HCl, pH 6.8, 10% SDS, 40% glycerol, 0.005% bromophenol blue, 0.7 M 2-mercaptoethanol, and 1 mM Na3VO4), DNA was sheared by repeated pipetting. Samples were then heated to 100°C for 2 minutes, and aliquots of 30 µL were loaded onto SDS polyacrylamide gels. Proteins were transferred to nitrocellulose filters (Bio-Rad, Hercules, CA). Filters were blocked in 5% skimmed milk with 0.05% Tween 20 in Tris-buffered saline, pH 7.4, before probing with antibodies against phosphorylated tyrosine residue (pY) 705 of Stat3, total Stat3 (Cell Signaling Technology, Beverly, MA), pY701 of Stat1 (Upstate Biotechnology, Lake Placid, NY), pYpY1022/1023 of Jak1 (BioSource), and phosphorylated threonine residue (pT) 202/pY204 of Erk1/2 (New England Biolabs, Beverly, MA). Antibodies against pY694/pY699 Stat5a/b, pY641 Stat6, and pY1007/pY1008 Jak2 were from Upstate Biotechnology. Bound antibodies were visualized by chemiluminescence (Amersham Pharmacia Biotech, Uppsala, Sweden). The pY705 Stat3-probed filters were stripped of antibodies and reprobed for total Stat3 using stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7).Nuclear transcription factor- B activation was determined
with a Trans-AM Transcription Factor Assay Kit (Active
Motif, Carlsbad, CA). This is an enzyme-linked immunosorbent assay
(ELISA) with a 96-well plate coated with an oligonucleotide containing the NF- B consensus binding site (5'-GGGACTTTCC-3'). The assay was
performed essentially as described by the manufacturer. Briefly, after
4 washes in Hanks balanced salt solution, cells were seeded on a
24-well plate (106 cells and 0.5 mL medium per
well) and were stimulated for 3 hours with cytokines as
indicated in the legend to Figure 7. Each condition was run in
triplicate. Cells were then washed twice in PBS at 4°C and were
resuspended in 50 µL lysis buffer provided in the kit. Lysates were
diluted 1:10 and added to the ELISA plate. After incubation and 3 washes, primary antibody against NF- B was added. Detection was
accomplished with a horseradish peroxidase-conjugated secondary
antibody and a chromogenic substrate. Optical density at 450 nm was
read and used as a relative measure of NF- B activation.
Statistical analysis Statistical significance was determined by using a 2-tailed, unpaired Student t test. The minimal level of significance was P = .05.
IL-21 induced proliferation of IL-6-dependent human myeloma cell lines and primary myeloma cells IL-21 increased the proliferation of 3 different IL-6-dependent cell lines in a dose-dependent manner, as determined by 3H-thymidine incorporation (Figure 1A-C). Significant effects could be demonstrated at concentrations as low as 10 pg/mL in the cell line OH-2. Half-maximal proliferation was achieved at approximately 10-fold higher concentrations of IL-21 than of IL-6 (Figure 1A-C). DNA synthesis was unchanged in the IL-6-independent cell lines U-266, JJN-3, and RPMI 8226 after IL-21 stimulation (Figure 1D). We repeated the latter experiments under low serum conditions (0.5% FCS) but were still unable to find any effect of IL-21 (data not shown).
Four of 9 primary myeloma samples showed an increase in DNA synthesis after stimulation with IL-21 (Table 1). A 183% increase in DNA synthesis after IL-21 stimulation was noted in one sample, whereas in 3 other samples the increase was 34% to 82%. Six of 9 samples were responsive to IL-6 (increase range, 38%-793%). All samples that were responsive to IL-21 were also responsive to IL-6. Absolute 3H counts (Table 1) and response magnitude were lower for primary cells than for cell lines. This probably reflects the low labeling index of primary cells.26 To measure the increase in cell number, cells were grown in culture and
counted 3 times a week. Results for the OH-2 cell line are shown in
Figure 2. IL-21 and IL-6 stimulation led
to an increase in cell counts. For the IH-1 cell line, the increase in
cell counts on day 10 following IL-21 stimulation was 2-fold compared
with 6-fold following IL-6 stimulation (data not shown).
We also replaced IL-6 with 2 ng/mL IL-21 as a supplement to the growth medium for long-time culture of the cell line OH-2. IL-21-supplemented cells continued to proliferate (observation time more than 4 months), indicating that IL-21 can replace IL-6 as a long-term growth factor in a myeloma cell line. Cells cultured in media without IL-21 died within 3 weeks, as determined by morphology and by cell number. IL-21 was an antiapoptotic factor for human myeloma cell lines Cells were stimulated with IL-21 or IL-6, and the percentage of viable cells after a 3-day incubation period was measured by flow cytometry. The fraction of viable cells in all examined cell lines increased after stimulation with IL-21 or IL-6 (Figure 3). Differences in viability between IL-21- and IL-6-stimulated cells were small in the cell lines OH-2 and ANBL-6, whereas in the cell line IH-1, IL-6 gave a higher proportion of viable cells than IL-21. We examined 3 primary myeloma cell samples and found few or no differences in viability after stimulation with IL-21. In one of the samples, there was a 3% increase in viability following IL-21 stimulation and a 21% increase following IL-6 stimulation (Figure 3). No increase was found in the other 2 samples to either IL-21 or IL-6 (data not shown).
Myeloma cell lines expressed IL-21R By RT-PCR, the IL-21R transcript was detected in all examined cell lines (OH-2, IH-1, ANBL-6, JJN-3, U-266 and RPMI 8226) (data not shown). Cell surface expression of IL-21R was detected by flow cytometry in ANBL-6 and OH-2 cells, as exemplified in Figure 4 for the OH-2 cell line (upper histogram).
IL-21 and TNF had synergistic effects on myeloma cell proliferation Our group has previously shown that TNF is a growth factor for OH-2 cells and that IL-6 and IL-15 have synergistic effects with TNF.7,10 Therefore, we examined DNA synthesis after combined stimulation with IL-21 and TNF. Results for the cell line OH-2 and one primary myeloma cell sample are shown in Figure 5. Similar results were obtained for the cell line IH-1 (data not shown). Combined stimulation with 10 ng/mL TNF and 100 ng/mL IL-21 gave a 29-fold increase in DNA synthesis, compared with a 7-fold and a 10-fold increase with TNF and IL-21 alone, respectively. In contrast, the combination of IL-6 and IL-21 was not synergistic. The synergistic effect of IL-21 and TNF on proliferation was also seen in cell number experiments. In the OH-2 cell line, the combination of TNF and IL-21 increased the cell number more than stimulation with IL-6 alone (data not shown).
We also examined whether IL-6 or TNF had any effect on IL-21R expression after 18 hours of stimulation. TNF stimulation led to an increase in IL-21R expression on the cell surface, in contrast to IL-6, which did not influence IL-21R expression (Figure 4). Increase in DNA synthesis after stimulation with IL-21 was not mediated by IL-6 or gp130 DNA synthesis was measured after a 72-hour incubation period with or without cytokines (1 ng/mL IL-6 or 40 ng/mL IL-21) in the presence or absence of specific antibodies against IL-6 (5 µg/mL) or the signal transducer chain of IL-6 receptor, gp130 (5 µg/mL). Results for OH-2 cells are shown in Figure 6, and similar results were obtained in IH-1 cells. IL-21 stimulation was not affected by the addition of anti-IL-6 or anti-gp130, whereas the effects of IL-6 decreased significantly. Similar results were found using equimolar concentrations of IL-21 (5 ng/mL) and IL-6 (2 ng/mL) (data not shown). Soluble IL-21R (5 µg/mL) neutralized the IL-21 effect almost completely. Adding soluble IL-21R to the unstimulated or IL-6-stimulated cells did not influence 3H-thymidine incorporation.
Thus, there were no indications of IL-21-induced autocrine secretion of IL-6 or IL-21 in myeloma cells. Furthermore, because soluble IL-21R did not influence the effect of IL-6, we have no indication of IL-6-induced IL-21 secretion. IL-21 mediated its effects through Jak1, Stat3, and Erk1/2 Western blot analysis was used to identify the intracellular signaling pathways of IL-21 in myeloma cells. We found that IL-21 induced tyrosine phosphorylation of Jak1 (Figure 7A) and Stat3 (Figure 7B). Stat1 was weakly tyrosine-phosphorylated in IL-6-stimulated cells, but not in IL-21-stimulated cells (Figure 7B). In the mitogen-activated protein kinase (MAPK) pathway, IL-21 and IL-6 led to the phosphorylation of Erk1/2 (p44/42 MAPK) (Figure 7C). TNF, but not IL-21 or IL-6, activated NF- B (Figure 7D) as determined by ELISA. IL-21 did not affect
phosphorylation levels of Jak2, Stat5a/b, or Stat6 proteins (data not
shown). In the IL-6-independent cell lines RPMI 8226 and JJN-3, IL-21
did not induce phosphorylation of Stat3. IL-6 induced Stat3
phosphorylation in RPMI 8226, but not in JJN-3 cells. Erk1/2 was
phosphorylated in RPMI 8226 and JJN-3 cells after overnight serum
starvation, and the level of phosphorylation was not influenced by IL-6
or IL-21 stimulation (data not shown).
This paper adds a novel factor, IL-21, to the list of cytokines that are able to support myeloma cell growth. We show that IL-21 had potent growth-promoting and antiapoptotic effects on the cytokine-dependent myeloma cell lines ANBL-6, OH-2, and IH-1. Increased DNA synthesis was observed in 4 of 9 patient samples, indicating that responsiveness to IL-21 is not merely a phenomenon seen in the cell lines. The effect of IL-21 in cellular proliferation was weaker than that of IL-6 in all 3 IL-6-dependent cell lines. In inhibiting apoptosis, IL-21 had effects similar to those of IL-6 in the OH-2 and ANBL-6 cell lines. In the IH-1 cell line, IL-21 was a weaker antiapoptotic factor than IL-6. IL-6 is considered the most important growth factor for myeloma cells.4-6 Importantly, IL-21 was able to replace IL-6 as a growth factor for long-term proliferation of the OH-2 cell line. Cytokine-dependent cell lines were sensitive to stimulation by IL-21, as increased DNA synthesis was seen with concentrations as low as 10 pg/mL in the OH-2 cell lines. In contrast to the results from Parrish-Novak et al15 in normal B and T cells, IL-21 was able to induce the growth of myeloma cells without the presence of a costimulus. Furthermore, IL-21 was a more potent growth and antiapoptotic factor than other known myeloma cell growth factors such as IL-10, IL-15, TNF, and IGF-1 in the 3 IL-6-dependent cell lines examined (A.-T.B., T.B.R., A.W., et al, unpublished observations, May 2001). These results indicate a role for IL-21 in myeloma biology. Because myeloma cell growth factors may induce autocrine secretion of gp130 family cytokines, it was important to investigate whether this was the case for IL-21.9,11 However, antibodies blocking IL-6 or gp130 did not affect the IL-21-induced growth, arguing against induction of an IL-6 autocrine growth loop. Given that soluble IL-21R did not reduce the proliferation of MM cells under basal or IL-6-stimulated conditions, we have no indication of autocrine secretion of IL-21 from MM cells. Interestingly, we found a clear synergism between IL-21 and TNF. In fact, a stronger proliferative response could be obtained with the combination of IL-21 and TNF than with an optimal dose of IL-6 alone in OH-2 cells and in one of our patient samples. Combinations of IL-21 and IL-6 did not produce synergistic effects on proliferation. One of the reasons for the IL-21-TNF synergism could be TNF-mediated up-regulation of IL-21R, as demonstrated in the OH-2 and ANBL-6 cell lines. Our group has earlier described synergism between TNF and IL-6 and between TNF and IL-15 in the OH-2 cell line.7,10 These findings indicate that TNF might be more important to myeloma growth as a synergistic stimulant than its effects as a single agent suggest. To better understand the effect of IL-21 on myeloma cells, we examined
some of the intracellular signaling pathways. IL-6 is known to mediate
its proliferative and antiapoptotic signal in myeloma cells through the
Jak/Stat pathway and the Ras/MAPK pathway.27,28 Stat3 is
an important molecule in the proliferation and survival of myeloma
cells.29 We show that IL-21 activates Jak1, Stat3, and
Erk1/2 in myeloma cells, but apparently not Stat1, Stat5, or NF- Other myeloma growth factors include IGF-1, IL-10, IL-15, IFN- The observation that IL-21 and IL-15 induce the growth of myeloma cells
opens up the possibility of a pathophysiologic role for the
common Little is known about cytokine levels in the bone marrow
microenvironment of myeloma cells. Minute amounts of IL-6 and TNF and
higher amounts of the angiogenic factors HGF, basic fibroblast growth
factor, and VEGF have been detected in the bone
marrow.37-39 Bone marrow levels of cytokines that use the
common In conclusion, we demonstrate that IL-21 had growth-promoting and antiapoptotic effects on myeloma cells in vitro. Furthermore, IL-21 could substitute for IL-6 as a long-term growth factor, and there was synergism between IL-21 and TNF.
We thank Rick Holly (ZymoGenetics, Seattle, WA) for kindly providing the IL-21 reagents. We also thank Hanne Hella, Berit F. Stordal, and Mari Sorensen for their excellent technical assistance and Sidsel Krokstad for helping us with the EBV analysis.
Submitted September 27, 2001; accepted January 8, 2002.
Supported by grants from The Norwegian Cancer Society; Rakel og Otto Kr. Bruuns legat; Blix legat; The Cancer Fund of Trondheim University Hospital; and The Norwegian Research Council.
A.-T.B. and T.B.R. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Torstein Baade Ro, Dept of Cancer Research and Molecular Biology, Norwegian University of Science and Technology, MTFS, N-7489, Trondheim, Norway; e-mail: torstein.ro{at}medisin.ntnu.no.
1.
Combination chemotherapy versus melphalan plus prednisone as treatment for multiple myeloma: an overview of 6,633 patients from 27 randomized trials: Myeloma Trialists' Collaborative Group.
J Clin Oncol.
1998;16:3832-3842
2.
Lenhoff S, Hjorth M, Holmberg E, et al.
Impact on survival of high-dose therapy with autologous stem cell support in patients younger than 60 years with newly diagnosed multiple myeloma: a population-based study: Nordic Myeloma Study Group.
Blood.
2000;95:7-11
3.
Zhang XG, Klein B, Bataille R.
Interleukin-6 is a potent myeloma-cell growth factor in patients with aggressive multiple myeloma.
Blood.
1989;74:11-13 4. Kawano M, Hirano T, Matsuda T, et al. Autocrine generation and requirement of BSF-2/IL-6 for human multiple myelomas. Nature. 1988;332:83-85[CrossRef][Medline] [Order article via Infotrieve].
5.
Klein B, Zhang XG, Jourdan M, et al.
Paracrine rather than autocrine regulation of myeloma-cell growth and differentiation by interleukin-6.
Blood.
1989;73:517-526
6.
Van Damme J, Opdenakker G, Simpson RJ, et al.
Identification of the human 26-kD protein, interferon beta 2 (IFN-beta 2), as a B cell hybridoma/plasmacytoma growth factor induced by interleukin 1 and tumor necrosis factor.
J Exp Med.
1987;165:914-919 7. Borset M, Waage A, Brekke OL, Helseth E. TNF and IL-6 are potent growth factors for OH-2, a novel human myeloma cell line. Eur J Haematol. 1994;53:31-37[Medline] [Order article via Infotrieve].
8.
Georgii-Hemming P, Wiklund HJ, Ljunggren O, Nilsson K.
Insulin-like growth factor I is a growth and survival factor in human multiple myeloma cell lines.
Blood.
1996;88:2250-2258
9.
Gu ZJ, Costes V, Lu ZY, et al.
Interleukin-10 is a growth factor for human myeloma cells by induction of an oncostatin M autocrine loop.
Blood.
1996;88:3972-3986 10. Hjorth-Hansen H, Waage A, Borset M. Interleukin-15 blocks apoptosis and induces proliferation of the human myeloma cell line OH-2 and freshly isolated myeloma cells. Br J Haematol. 1999;106:28-34[CrossRef][Medline] [Order article via Infotrieve]. 11. Lu ZY, Gu ZJ, Zhang XG, et al. Interleukin-10 induces interleukin-11 responsiveness in human myeloma cell lines. FEBS Lett. 1995;377:515-518[CrossRef][Medline] [Order article via Infotrieve].
12.
Lu ZY, Zhang XG, Rodriguez C, et al.
Interleukin-10 is a proliferation factor but not a differentiation factor for human myeloma cells.
Blood.
1995;85:2521-2527
13.
Tinhofer I, Marschitz I, Henn T, Egle A, Greil R.
Expression of functional interleukin-15 receptor and autocrine production of interleukin-15 as mechanisms of tumor propagation in multiple myeloma.
Blood.
2000;95:610-618 14. Westendorf JJ, Ahmann GJ, Greipp PR, Witzig TE, Lust JA, Jelinek DF. Establishment and characterization of three myeloma cell lines that demonstrate variable cytokine responses and abilities to produce autocrine interleukin-6. Leukemia. 1996;10:866-876[Medline] [Order article via Infotrieve]. 15. Parrish-Novak J, Dillon SR, Nelson A, et al. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature. 2000;408:57-63[CrossRef][Medline] [Order article via Infotrieve].
16.
Ozaki K, Kikly K, Michalovich D, Young PR, Leonard WJ.
Cloning of a type I cytokine receptor most related to the IL-2 receptor beta chain.
Proc Natl Acad Sci U S A.
2000;97:11439-11444
17.
Asao H, Okuyama C, Kumaki S, et al.
Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex.
J Immunol.
2001;167:1-5 18. Jackson N, Lowe J, Ball J, et al. Two new IgA1-kappa plasma cell leukaemia cell lines (JJN-1 & JJN-2) which proliferate in response to B cell stimulatory factor 2. Clin Exp Immunol. 1989;75:93-99[Medline] [Order article via Infotrieve].
19.
Hjertner O, Hjorth-Hansen H, Borset M, Seidel C, Waage A, Sundan A.
Bone morphogenetic protein-4 inhibits proliferation and induces apoptosis of multiple myeloma cells.
Blood.
2001;97:516-522
20.
Pellat-Deceunynk C, Amiot M, Bataille R, et al.
Human myeloma cell lines as a tool for studying the biology of multiple myeloma: a reappraisal 18 years after.
Blood.
1995;86:4001-4002 21. Enbom M, Strand A, Falk KI, Linde A. Detection of Epstein-Barr virus, but not human herpesvirus 8, DNA in cervical secretions from Swedish women by real-time polymerase chain reaction. Sex Transm Dis. 2001;28:300-306[CrossRef][Medline] [Order article via Infotrieve]. 22. Durie BG, Salmon SE. A clinical staging system for multiple myeloma: correlation of measured myeloma cell mass with presenting clinical features, response to treatment, and survival. Cancer. 1975;36:842-854[CrossRef][Medline] [Order article via Infotrieve]. 23. Borset M, Helseth E, Naume B, Waage A. Lack of IL-1 secretion from human myeloma cells highly purified by immunomagnetic separation. Br J Haematol. 1993;85:446-451[Medline] [Order article via Infotrieve].
24.
Borset M, Hjorth-Hansen H, Seidel C, Sundan A, Waage A.
Hepatocyte growth factor and its receptor c-met in multiple myeloma.
Blood.
1996;88:3998-4004
25.
Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST, van Oers MH.
Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis.
Blood.
1994;84:1415-1420 26. Pileri A, Massaia M, Dianzani U, Omede P, Boccadoro M. Cytobiological studies in multiple myeloma. Acta Haematol. 1987;78(suppl 1):41-42. 27. Berger LC, Hawley TS, Lust JA, Goldman SJ, Hawley RG. Tyrosine phosphorylation of JAK-TYK kinases in malignant plasma cell lines growth-stimulated by interleukins 6 and 11. Biochem Biophys Res Commun. 1994;202:596-605[CrossRef][Medline] [Order article via Infotrieve].
28.
Ogata A, Chauhan D, Teoh G, et al.
IL-6 triggers cell growth via the Ras-dependent mitogen-activated protein kinase cascade.
J Immunol.
1997;159:2212-2221 29. Catlett-Falcone R, Landowski TH, Oshiro MM, et al. Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. Immunity. 1999;10:105-115[CrossRef][Medline] [Order article via Infotrieve]. 30. Borset M, Medvedev AE, Sundan A, Espevik T. The role of the two TNF receptors in proliferation, NF-kappa B activation and discrimination between TNF and LT alpha signalling in the human myeloma cell line OH-2. Cytokine. 1996;8:430-438[CrossRef][Medline] [Order article via Infotrieve].
31.
Podar K, Tai YT, Davies FE, et al.
Vascular endothelial growth factor triggers signaling cascades mediating multiple myeloma cell growth and migration.
Blood.
2001;98:428-435 32. Armitage RJ, Macduff BM, Eisenman J, Paxton R, Grabstein KH. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J Immunol. 1995;154:483-490[Abstract].
33.
Peschel C, Paul WE, Ohara J, Green I.
Effects of B cell stimulatory factor-1/interleukin 4 on hematopoietic progenitor cells.
Blood.
1987;70:254-263 34. Namen AE, Lupton S, Hjerrild K, et al. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature. 1988;333:571-573[CrossRef][Medline] [Order article via Infotrieve]. 35. Klein B. Update of gp130 cytokines in multiple myeloma. Curr Opin Hematol. 1998;5:186-191[Medline] [Order article via Infotrieve]. 36. Leonard WJ, Noguchi M, Russell SM, McBride OW. The molecular basis of X-linked severe combined immunodeficiency: the role of the interleukin-2 receptor gamma chain as a common gamma chain, gamma c. Immunol Rev. 1994;138:61-86[CrossRef][Medline] [Order article via Infotrieve].
37.
Di Raimondo F, Azzaro MP, Palumbo G, et al.
Angiogenic factors in multiple myeloma: higher levels in bone marrow than in peripheral blood.
Haematologica.
2000;85:800-805 38. Abildgaard N, Rungby J, Glerup H, et al. Long-term oral pamidronate treatment inhibits osteoclastic bone resorption and bone turnover without affecting osteoblastic function in multiple myeloma. Eur J Haematol. 1998;61:128-134[Medline] [Order article via Infotrieve].
39.
Seidel C, Borset M, Hjertner O, et al.
High levels of soluble syndecan-1 in myeloma-derived bone marrow: modulation of hepatocyte growth factor activity.
Blood.
2000;96:3139-3146
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
J. Dien Bard, P. Gelebart, M. Anand, Z. Zak, S. A. Hegazy, H. M. Amin, and R. Lai IL-21 Contributes to JAK3/STAT3 Activation and Promotes Cell Growth in ALK-Positive Anaplastic Large Cell Lymphoma Am. J. Pathol., August 1, 2009; 175(2): 825 - 834. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Sprynski, D. Hose, L. Caillot, T. Reme, J. D. Shaughnessy Jr, B. Barlogie, A. Seckinger, J. Moreaux, M. Hundemer, M. Jourdan, et al. The role of IGF-1 as a major growth factor for myeloma cell lines and the prognostic relevance of the expression of its receptor Blood, May 7, 2009; 113(19): 4614 - 4626. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Thedrez, C. Harly, A. Morice, S. Salot, M. Bonneville, and E. Scotet IL-21-Mediated Potentiation of Antitumor Cytolytic and Proinflammatory Responses of Human V{gamma}9V{delta}2 T Cells for Adoptive Immunotherapy J. Immunol., March 15, 2009; 182(6): 3423 - 3431. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Konforte, N. Simard, and C. J. Paige IL-21: An Executor of B Cell Fate J. Immunol., February 15, 2009; 182(4): 1781 - 1787. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Burger, S. Le Gouill, Y.-T. Tai, R. Shringarpure, P. Tassone, P. Neri, K. Podar, L. Catley, T. Hideshima, D. Chauhan, et al. Janus kinase inhibitor INCB20 has antiproliferative and apoptotic effects on human myeloma cells in vitro and in vivo Mol. Cancer Ther., January 1, 2009; 8(1): 26 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Menoret, S. Maiga, G. Descamps, C. Pellat-Deceunynck, C. Fraslon, M. Cappellano, P. Moreau, R. Bataille, and M. Amiot IL-21 Stimulates Human Myeloma Cell Growth through an Autocrine IGF-1 Loop J. Immunol., November 15, 2008; 181(10): 6837 - 6842. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lamprecht, S. Kreher, I. Anagnostopoulos, K. Johrens, G. Monteleone, F. Jundt, H. Stein, M. Janz, B. Dorken, and S. Mathas Aberrant expression of the Th2 cytokine IL-21 in Hodgkin lymphoma cells regulates STAT3 signaling and attracts Treg cells via regulation of MIP-3{alpha} Blood, October 15, 2008; 112(8): 3339 - 3347. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye STAT3 is required for IL-21-induced secretion of IgE from human naive B cells Blood, September 1, 2008; 112(5): 1784 - 1793. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Kolb IL-21 as new therapy for CLL? Blood, May 1, 2008; 111(9): 4424 - 4425. [Full Text] [PDF] |
||||
![]() |
A. Gowda, J. Roda, S.-R. A. Hussain, A. Ramanunni, T. Joshi, S. Schmidt, X. Zhang, A. Lehman, D. Jarjoura, W. E. Carson, et al. IL-21 mediates apoptosis through up-regulation of the BH3 family member BIM and enhances both direct and antibody-dependent cellular cytotoxicity in primary chronic lymphocytic leukemia cells in vitro Blood, May 1, 2008; 111(9): 4723 - 4730. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation J. Immunol., April 1, 2008; 180(7): 4805 - 4815. [Abstract] [Full Text] [PDF] |
||||
![]() |
U.-M. Fagerli, R. U. Holt, T. Holien, T. K. Vaatsveen, F. Zhan, K. W. Egeberg, B. Barlogie, A. Waage, H. Aarset, H. Y. Dai, et al. Overexpression and involvement in migration by the metastasis-associated phosphatase PRL-3 in human myeloma cells Blood, January 15, 2008; 111(2): 806 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, B. K. Skrumsager, J. Cebon, T. Nicholaou, J. W. Barlow, N. P. H. Moller, K. Skak, D. Lundsgaard, K. S. Frederiksen, P. Thygesen, et al. An Open-Label, Two-Arm, Phase I Trial of Recombinant Human Interleukin-21 in Patients with Metastatic Melanoma Clin. Cancer Res., June 15, 2007; 13(12): 3630 - 3636. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zeng, R. Spolski, E. Casas, W. Zhu, D. E. Levy, and W. J. Leonard The molecular basis of IL-21-mediated proliferation Blood, May 15, 2007; 109(10): 4135 - 4142. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Caruso, D. Fina, I. Peluso, M. C. Fantini, C. Tosti, G. D. V. Blanco, O. A. Paoluzi, F. Caprioli, F. Andrei, C. Stolfi, et al. IL-21 Is Highly Produced in Helicobacter pylori-Infected Gastric Mucosa and Promotes Gelatinases Synthesis J. Immunol., May 1, 2007; 178(9): 5957 - 5965. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Richardson, T. Hideshima, and K. C. Anderson Plasma cell dyscrasias ASH Self-Assessment Program, January 1, 2007; 2007(1): 298 - 327. [Full Text] [PDF] |
||||
![]() |
D. Konforte and C. J. Paige Identification of Cellular Intermediates and Molecular Pathways Induced by IL-21 in Human B Cells J. Immunol., December 15, 2006; 177(12): 8381 - 8392. [Abstract] [Full Text] [PDF] |
||||
![]() |
G Monteleone, R Caruso, D Fina, I Peluso, V Gioia, C Stolfi, M C Fantini, F Caprioli, R Tersigni, L Alessandroni, et al. Control of matrix metalloproteinase production in human intestinal fibroblasts by interleukin 21 Gut, December 1, 2006; 55(12): 1774 - 1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Theocharis, C. Seidel, M. Borset, K. Dobra, V. Baykov, V. Labropoulou, I. Kanakis, E. Dalas, N. K. Karamanos, A. Sundan, et al. Serglycin Constitutively Secreted by Myeloma Plasma Cells Is a Potent Inhibitor of Bone Mineralization in Vitro J. Biol. Chem., November 17, 2006; 281(46): 35116 - 35128. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Good, V. L. Bryant, and S. G. Tangye Kinetics of Human B Cell Behavior and Amplification of Proliferative Responses following Stimulation with IL-21 J. Immunol., October 15, 2006; 177(8): 5236 - 5247. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pelletier and D. Girard Differential Effects of IL-15 and IL-21 in Myeloid (CD11b+) and Lymphoid (CD11b-) Bone Marrow Cells J. Immunol., July 1, 2006; 177(1): 100 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. de Totero, R. Meazza, S. Zupo, G. Cutrona, S. Matis, M. Colombo, E. Balleari, I. Pierri, M. Fabbi, M. Capaia, et al. Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells Blood, May 1, 2006; 107(9): 3708 - 3715. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, M. Bleakley, and C. Yee IL-21 Influences the Frequency, Phenotype, and Affinity of the Antigen-Specific CD8 T Cell Response J. Immunol., August 15, 2005; 175(4): 2261 - 2269. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pelletier, A. Bouchard, and D. Girard In Vivo and In Vitro Roles of IL-21 in Inflammation J. Immunol., December 15, 2004; 173(12): 7521 - 7530. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ozaki, R. Spolski, R. Ettinger, H.-P. Kim, G. Wang, C.-F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al. Regulation of B Cell Differentiation and Plasma Cell Generation by IL-21, a Novel Inducer of Blimp-1 and Bcl-6 J. Immunol., November 1, 2004; 173(9): 5361 - 5371. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hov, R. U. Holt, T. B. Ro, U.-M. Fagerli, H. Hjorth-Hansen, V. Baykov, J. G. Christensen, A. Waage, A. Sundan, and M. Borset A Selective c-Met Inhibitor Blocks an Autocrine Hepatocyte Growth Factor Growth Loop in ANBL-6 Cells and Prevents Migration and Adhesion of Myeloma Cells Clin. Cancer Res., October 1, 2004; 10(19): 6686 - 6694. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hideshima, P. L. Bergsagel, W. M. Kuehl, and K. C. Anderson Advances in biology of multiple myeloma: clinical applications Blood, August 1, 2004; 104(3): 607 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moroz, C. Eppolito, Q. Li, J. Tao, C. H. Clegg, and P. A. Shrikant IL-21 Enhances and Sustains CD8+ T Cell Responses to Achieve Durable Tumor Immunity: Comparative Evaluation of IL-2, IL-15, and IL-21 J. Immunol., July 15, 2004; 173(2): 900 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Krueger and K. Callis Potential of Tumor Necrosis Factor Inhibitors in Psoriasis and Psoriatic Arthritis Arch Dermatol, February 1, 2004; 140(2): 218 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, N. S. Mitsiades, C. J. McMullan, V. Poulaki, R. Shringarpure, T. Hideshima, M. Akiyama, D. Chauhan, N. Munshi, X. Gu, et al. Transcriptional signature of histone deacetylase inhibition in multiple myeloma: Biological and clinical implications PNAS, January 13, 2004; 101(2): 540 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Mehta, A. L. Wurster, M. J. Whitters, D. A. Young, M. Collins, and M. J. Grusby IL-21 Induces the Apoptosis of Resting and Activated Primary B Cells J. Immunol., April 15, 2003; 170(8): 4111 - 4118. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Parrish-Novak, D. C. Foster, R. D. Holly, and C. H. Clegg Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses J. Leukoc. Biol., November 1, 2002; 72(5): 856 - 863. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||