| |
|
|
|
|
|
|
|||
|
BRIEF REPORT
From the Hematology and Bone Marrow
Transplantation Unit, University of Perugia; the International Cancer
Center, Laboratory of Molecular Biology, Rovigo; the Department of
Experimental and Diagnostic Medicine and Interdepartment Center for
Cancer Research, University of Ferrara, Italy; the Department of
Hematology, Sant Pau University Hospital, Barcelona; and the Department
of Hematology, Vall d'Hebron Hospital, Barcelona, Spain.
Fusion between the NUP98 and NSD3
genes in a patient with acute myeloid leukemia associated with
t(8;11)(p11.2;p15), is reported for the first time. The
t(8;11)(p11.2;p15) was identified by classical cytogenetics.
Fluorescence in situ hybridization (FISH) analysis revealed a split
signal with a mix of BAC 118H17 and 290A12, indicating the
translocation disrupted NUP98. FISH restriction at 8p11-12 showed a split of BAC 350N15. Molecular investigations into candidate genes in this BAC showed the NUP98 fusion partner at 8p11.2
was the NSD3 gene. To date the NSD3 gene has
never been implicated in hematologic malignancies.
(Blood. 2002;99:3857-3860) In myeloid malignancies several chromosomal
translocations and corresponding chimeric genes have been identified
between NUP98 at 11p15 and PMX1 at 1q23,
HOXD13 at 2q31, NSD1 at 5q35, HOXA9 at
7p15, LEDGF at 9p22, DDX10 at 11q22, and
TOP1 at 20q11.1-8 In lymphoid malignancies only
a subset of T-cell acute lymphoblastic leukemia with a t(4;11)(q21;p15)
and a NUP98-RAP1GDS1 fusion gene has been
reported to date.9
Chromosomal bands 8p11-p12 are involved in well-characterized
leukemic syndromes, such as acute myeloid leukemia (AML)
with erythrophagocytosis and t(8;16)(p11;p13.3)10
and a chronic myeloproliferative disorder (CMPD) with eosinophilia,
concomitant lymphoblastic leukemia-lymphoma, and
t(8;13)(p11;q12).11 As a result of translocations,
MOZ fuses with the CBP gene at 16p13.3 in AML,
and FGFR1 rearranges with ZNF198 at 13q12 in the
CMPD-lymphoma syndrome. Alternative recombinations with
TIF2/8q13 and p300/22q13 for MOZ gene
and with FOP/6q27 and CEP110/9q33 for
FGFR1 have also been described.12-16
We report the first patient with AML with recombination between
the NUP98 gene and a new partner at 8p11.2, telomeric to
FGFR1. NSD3 (nuclear receptor-binding su(var)3-9,
enhancer of zeste, trithorax [SET] domain containing gene 3), also
named WHSC1L1 (Wolf-Hirschhorn syndrome
candidate-1-like-1), belongs to the same family as
NSD1, whose mouse homolog is an RAR Patient history
Cytogenetics and fluorescence in situ hybridization
The 8p11-12 breakpoint was investigated using YAC 176C9 (Dr M. Chaffanet, Marseilles, France) spanning the MOZ gene, BAC 350N15 spanning the FGFR1 gene, and BAC 513D5 telomeric to the FGFR1 locus. Probes were biotin-labeled. A centromeric probe labeled with digoxigenin was added in each experiment for chromosome 8 (D8Z1) or for chromosome 11 (D11Z1) (Oncor, Gaithersburg, MD). At least 8 metaphases were analyzed using an Olympus fluorescence microscope equipped with a cooled CCD camera (Sensys, Photometrics, Tucson, AZ) run by Pathvysion (Vysis, Stuttgart, Germany). Molecular characterization Database searches and sequence analyses were performed using BLAST algorithms (http://www.ncbi.nlm.nih.gov/BLAST) and RepeatMasker (http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker). All NUP98 primers have been described previously19 except NUP737F, AGTCACTAGAGGAACTTCG. NSD3 primers were designed on GenBank accession number AK022560 (FLJ536f, CAGAAATTCCAAACACAAGAC; FLJ940f, CCAGTTCAGCCAATACTATC; FLJ1856Af, AGCCAACGCAGAGTGTATCATC; FLJ2907Br, GGTGGGCCTCGTTAGACTGCTC; FLJ3081Cr, TTCCCCCAAAATTTCCATACAA; FLJ1204Df, GAAGAATTACTGGCTGAGGCAAC; FLJ1747Er, ATTTCCCATCCCCTGTAGCATTC) and GenBank accession number AF332469 (W1L2863R1, AATTTGCGGACACAGGCTTC; W1L2685R2, TGCAGCACTCTCCCTCAC).Total RNA was reverse-transcribed using SuperscriptII (Life Technologies, Gaithersburg, MD). Using the Expand Long Template PCR System (Roche, Mannheim, Germany) and the appropriate primers, cDNA aliquots were amplified in 10-µL polymerase chain reaction (PCR) as follows: 35 amplification cycles at 94°C for 5 minutes 10 seconds (94°C for 50 seconds, 58°C for 20 seconds, and 68°C for 4 minutes) and at 68°C for 5 minutes. Nested PCR was carried out as follows: 35 amplification cycles at 94°C for 5 minutes (94°C for 30 seconds, 58°C for 20 seconds, 68°C for 2 minutes) and at 68°C for 5 minutes. Sequencing was performed with an automated ABI377 sequencing station after purification using Concert Rapid PCR Purification System (Life Technologies).
The t(8;11)(p11.2;p15) translocation was found as
an isolated anomaly in all 20 bone marrow karyotypes from this patient
with de novo AML. The mixture of BAC 118H17 and 290A12 was split, thus generating 3 spots of fluorescence: on normal chromosome 11, on der(11), and on der(8) (Figure 1A, left
panel). BAC 350N15 spanned the 8p11-12 breakpoint, showing
hybridization signals on normal chromosome 8, on der(8), and on der(11)
(Figure 1A, right panel).
BAC 350N15 was found to contain 2 candidate genes, FGFR1 and NSD3, which were screened for an in-frame fusion transcript with NUP98. PCR experiments excluded FGFR1 involvement. The NSD3 gene, like NSD2, is known to encode 2 splicing isoforms, a long form and a short form.20,21 Primers were first designed on the short form (FLJ1856Af, FLJ2907Br, FLJ3081Cr, FLJ1204Df, FLJ1747Er). As reports suggest, the 5' end of NUP98 bears the oncogenic-related portion. PCR experiments investigated whether (5')NUP98-NSD3(3') chimeric transcripts were present in patient-derived cDNA. Results showed NUP98-NSD3 fusion transcripts (Figure 1B,
upper panel). The NUP1252F-FLJ1747Er amplification product was
sequenced, confirming an in-frame fusion between the 2 genes (Figure
1B, lower panel). Breakpoints were located between exons 3 and 4 in the
NSD3 gene and between exons 11 and 12 in NUP98
(Figure 2A-B). Successful amplification
from primer FLJ3081Cr implied the expression of short-form chimeric
NSD3 (Figure 2C).
To investigate the expression of long-form mRNA (Figure 2D), nested PCR was performed with primers W1L2685R2 and W1L2863R1 in combination with NUP98 forward primers. Only one band, of the appropriate length, was amplified (data not shown), confirming that the long transcript was present. Because no product was extended after exon 12, the presence of exon 14, which is involved in alternative splicing20 (Figure 2A,E), could not be determined. We also analyzed the expression of the reciprocal transcript (5')NSD3-NUP98(3') by matching primers NUP1811R and NUP2887R with 2 NSD3 forward primers FLJ536f and FLJ940f. A specific band of the correct length (data not shown) revealed the patient's cells expressed reciprocal fusion mRNA. The reciprocal transcript NSD3-NUP98 maintained the 5' part of NSD3, encoding for a split PWWP domain, and the 3' part of NUP98, with few FG repeats and the RNA-binding domain (Figure 2F). As far as we know, NSD3 is the eighth NUP98 partner in myeloid malignancies, so NUP98, like MLL and ETV6, is emerging as a promiscuous gene that recombines and fuses with different genomic sites. In the NSD family, NSD1, located at 5q35, has been shown to rearrange with NUP98 in childhood AML.3 NSD2, located at 4p16, is the fusion partner of immunoglobulin heavy- chain gene at 14q32 in a recurrent translocation of multiple myeloma.21,22 Angrand et al20 found NSD3 as part of an amplicon in breast cancer with 8p karyotypic abnormalities. We also confirmed NSD3 amplification in 1 of 30 unselected cases of breast cancer analyzed by semiquantitative PCR (unpublished data, May 2001). This is the first report of NSD3 rearrangements in hematologic malignancies. These 3 NSD family members have a common region of conserved
architecture3,20,21 In conclusion, NSD3 has been observed for the first time as a translocation partner of NUP98 in acute myeloid leukemia. Further functional analysis of the chimeric transcripts will elucidate their specific role in leukemogenesis.
Submitted October 5, 2001; accepted January 14, 2002.
Supported by Associazione Italiana per la Ricerca sul Cancro (C.M., M.N.), Associazione Italiana contro le Leucemie-linfomi (C.M.), Ministero dell'Università e della Ricerca Scientifica e Tecnologica (C.M., M.N.), and Associazione Sergio Luciani (R.R.).
R.R. and R.L.S. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Cristina Mecucci, Hematology and Bone Marrow Transplantation Unit, Policlinico Monteluce, Via Brunamonti, 06123 Perugia, Italy; e-mail: crimecux{at}unipg.it.
1.
Nakamura T, Yamazaki Y, Hatano Y, Miura I.
NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15).
Blood.
1999;94:741-747
2.
Raza-Egilmez SZ, Jani-Sait SN, Grossi M, Higgins MJ, Shows TB, Aplan PD.
NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia.
Cancer Res.
1998;58:4269-4273
3.
Jaju RJ, Fidler C, Haas OA, et al.
A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia.
Blood.
2001;98:1264-1267 4. Borrow J, Shearman AM, Stanton VP Jr, et al. The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet. 1996;12:159-167[CrossRef][Medline] [Order article via Infotrieve]. 5. Nakamura T, Largaespada DA, Lee MP, et al. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat Genet. 1996;12:154-158[CrossRef][Medline] [Order article via Infotrieve].
6.
Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ, Slovak ML.
t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF).
Cancer Res.
2000;60:6227-6229
7.
Arai Y, Hosoda F, Kobayashi H, et al.
The inv(11)(p15q22) chromosome translocation of the novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase RNA gene, DDX10.
Blood.
1997;89:3936-3944
8.
Ahuja HG, Felix CA, Aplan PD.
The t(11;20)(p15;q11) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion.
Blood.
1999;94:3258-3261
9.
Hussey DJ, Nicola M, Moore S, Peters GB, Dobrovic A.
The t(4;11)(q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia.
Blood.
1999;94:2072-2079 10. Borrow J, Stanton VP Jr, Andresen JM, et al. The translocation t(8;16)(p11;p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB-binding protein. Nat Genet. 1996;14:33-41[CrossRef][Medline] [Order article via Infotrieve]. 11. Xiao S, Nalabolu SR, Aster JC, et al. FGFR1 is fused with a novel zinc-finger gene, ZNF198, in the t(8;13) leukaemia/lymphoma syndrome. Nat Genet. 1998;18:84-87[CrossRef][Medline] [Order article via Infotrieve].
12.
Liang J, Prouty L, Williams BJ, Dayton MA, Blanchard KL.
Acute mixed lineage leukemia with an inv(8)(p11q13) resulting in fusion of the genes for MOZ and TIF2.
Blood.
1998;92:2118-2122
13.
Carapeti M, Aguiar RC, Goldman JM, Cross NC.
A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia.
Blood.
1998;91:3127-3133 14. Chaffanet M, Gressin L, Preudhomme C, Soenen-Cornu V, Birnbaum D, Pebusque MJ. MOZ is fused to p300 in an acute monocytic leukemia with t(8;22). Genes Chromosomes Cancer. 2000;28:138-144[CrossRef][Medline] [Order article via Infotrieve].
15.
Popovici C, Zhang B, Gregoire MJ, et al.
The t(6;8)(q27;p11) translocation in a stem cell myeloproliferative disorder fuses a novel gene, FOP, to fibroblast growth factor receptor 1.
Blood.
1999;93:1381-1389
16.
Guasch G, Mack GJ, Popovici C, et al.
FGFR1 is fused to the centrosome-associated protein CEP110 in the 8p12 stem cell myeloproliferative disorder with t(8;9)(p12;q33).
Blood.
2000;95:1788-1796 17. Huang N, vom Baur E, Garnier JM, et al. Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators. EMBO J. 1998;17:3398-3412[CrossRef][Medline] [Order article via Infotrieve]. 18. Mitelman F, ed. ISCN: An International System for Human Cytogenetic Nomenclature. Basel, Switzerland: S. Karger; 1995. 19. Mecucci C, La Starza R, Negrini M, et al. t(4;11)(q21;p15) translocation involving NUP98 and RAP1GDS1 genes: characterization of a new subset of T acute lymphoblastic leukaemia. Br J Haematol. 2000;109:788-793[CrossRef][Medline] [Order article via Infotrieve]. 20. Angrand PO, Apiou F, Stewart AF, Dutrillaux B, Losson R, Chambon P. NSD3, a new set-domain containing gene, maps to 8p12 and is amplified in human breast cancer cell lines. Genomics. 2001;74:79-88[CrossRef][Medline] [Order article via Infotrieve].
21.
Stec I, Wright TJ, van Ommen GJ, et al.
WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma.
Hum Mol Genet.
1998;7:1071-1082
22.
Chesi M, Nardini E, Lim RS, Smith KD, Kuehl MW, Bergsagel PL.
The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts.
Blood.
1998;92:3025-3034
23.
Kasper LH, Brindle PK, Schnabel CA, Pritchard CE, Cleary ML, van Deursen JM.
CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity.
Mol Cell Biol.
1999;19:764-776
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. Miremadi, M. Z. Oestergaard, P. D.P. Pharoah, and C. Caldas Cancer genetics of epigenetic genes Hum. Mol. Genet., April 15, 2007; 16(R1): R28 - R49. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-J. Sun, J. Wei, X.-Y. Wu, M. Hu, L. Wang, H.-H. Wang, Q.-H. Zhang, S.-J. Chen, Q.-H. Huang, and Z. Chen Identification and Characterization of a Novel Human Histone H3 Lysine 36-specific Methyltransferase J. Biol. Chem., October 21, 2005; 280(42): 35261 - 35271. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tonon, K.-K. Wong, G. Maulik, C. Brennan, B. Feng, Y. Zhang, D. B. Khatry, A. Protopopov, M. J. You, A. J. Aguirre, et al. High-resolution genomic profiles of human lung cancer PNAS, July 5, 2005; 102(27): 9625 - 9630. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tefferi and D. G. Gilliland The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis Mayo Clin. Proc., July 1, 2005; 80(7): 947 - 958. [Abstract] [PDF] |
||||
![]() |
Y.-W. Lin, C. Slape, Z. Zhang, and P. D. Aplan NUP98-HOXD13 transgenic mice develop a highly penetrant, severe myelodysplastic syndrome that progresses to acute leukemia Blood, July 1, 2005; 106(1): 287 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Di Croce Chromatin modifying activity of leukaemia associated fusion proteins Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R77 - R84. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. TONON, C. BRENNAN, A. PROTOPOPOV, G. MAULIK, B. FENG, Y. ZHANG, D.B. KHATRY, M.J. YOU, A.J. AGUIRRE, E.S. MARTIN, et al. Common and Contrasting Genomic Profiles among the Major Human Lung Cancer Subtypes Cold Spring Harb Symp Quant Biol, January 1, 2005; 70(0): 11 - 24. [Abstract] [PDF] |
||||
![]() |
R. M. Gurevich, P. D. Aplan, and R. K. Humphries NUP98-Topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation Blood, August 15, 2004; 104(4): 1127 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ghannam, A. Takeda, T. Camarata, M. A. Moore, A. Viale, and N. R. Yaseen The Oncogene Nup98-HOXA9 Induces Gene Transcription in Myeloid Cells J. Biol. Chem., January 9, 2004; 279(2): 866 - 875. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Krogan, M. Kim, A. Tong, A. Golshani, G. Cagney, V. Canadien, D. P. Richards, B. K. Beattie, A. Emili, C. Boone, et al. Methylation of Histone H3 by Set2 in Saccharomyces cerevisiae Is Linked to Transcriptional Elongation by RNA Polymerase II Mol. Cell. Biol., June 15, 2003; 23(12): 4207 - 4218. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Lahortiga, J. L. Vizmanos, X. Agirre, I. Vazquez, J. C. Cigudosa, M. J. Larrayoz, F. Sala, A. Gorosquieta, K. Perez-Equiza, M. J. Calasanz, et al. NUP98 Is Fused to Adducin 3 in a Patient with T-Cell Acute Lymphoblastic Leukemia and Myeloid Markers, with a New Translocation t(10;11)(q25;p15) Cancer Res., June 15, 2003; 63(12): 3079 - 3083. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression Blood, February 15, 2003; 101(4): 1520 - 1529. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||