Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum (v100,p1132)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosati, R.
Right arrow Articles by Mecucci, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosati, R.
Right arrow Articles by Mecucci, C.
Related Collections
Right arrow Neoplasia
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 May 2002, Vol. 99, No. 10, pp. 3857-3860

BRIEF REPORT

NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15)

Roberto Rosati, Roberta La Starza, Angelo Veronese, Ana Aventin, Christine Schwienbacher, Teresa Vallespi, Massimo Negrini, Massimo F. Martelli, and Cristina Mecucci

From the Hematology and Bone Marrow Transplantation Unit, University of Perugia; the International Cancer Center, Laboratory of Molecular Biology, Rovigo; the Department of Experimental and Diagnostic Medicine and Interdepartment Center for Cancer Research, University of Ferrara, Italy; the Department of Hematology, Sant Pau University Hospital, Barcelona; and the Department of Hematology, Vall d'Hebron Hospital, Barcelona, Spain.


    Abstract
Top
Abstract
Introduction
Study design
Results and discussion
References

Fusion between the NUP98 and NSD3 genes in a patient with acute myeloid leukemia associated with t(8;11)(p11.2;p15), is reported for the first time. The t(8;11)(p11.2;p15) was identified by classical cytogenetics. Fluorescence in situ hybridization (FISH) analysis revealed a split signal with a mix of BAC 118H17 and 290A12, indicating the translocation disrupted NUP98. FISH restriction at 8p11-12 showed a split of BAC 350N15. Molecular investigations into candidate genes in this BAC showed the NUP98 fusion partner at 8p11.2 was the NSD3 gene. To date the NSD3 gene has never been implicated in hematologic malignancies. (Blood. 2002;99:3857-3860)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Study design
Results and discussion
References

In myeloid malignancies several chromosomal translocations and corresponding chimeric genes have been identified between NUP98 at 11p15 and PMX1 at 1q23, HOXD13 at 2q31, NSD1 at 5q35, HOXA9 at 7p15, LEDGF at 9p22, DDX10 at 11q22, and TOP1 at 20q11.1-8 In lymphoid malignancies only a subset of T-cell acute lymphoblastic leukemia with a t(4;11)(q21;p15) and a NUP98-RAP1GDS1 fusion gene has been reported to date.9

Chromosomal bands 8p11-p12 are involved in well-characterized leukemic syndromes, such as acute myeloid leukemia (AML) with erythrophagocytosis and t(8;16)(p11;p13.3)10 and a chronic myeloproliferative disorder (CMPD) with eosinophilia, concomitant lymphoblastic leukemia-lymphoma, and t(8;13)(p11;q12).11 As a result of translocations, MOZ fuses with the CBP gene at 16p13.3 in AML, and FGFR1 rearranges with ZNF198 at 13q12 in the CMPD-lymphoma syndrome. Alternative recombinations with TIF2/8q13 and p300/22q13 for MOZ gene and with FOP/6q27 and CEP110/9q33 for FGFR1 have also been described.12-16

We report the first patient with AML with recombination between the NUP98 gene and a new partner at 8p11.2, telomeric to FGFR1. NSD3 (nuclear receptor-binding su(var)3-9, enhancer of zeste, trithorax [SET] domain containing gene 3), also named WHSC1L1 (Wolf-Hirschhorn syndrome candidate-1-like-1), belongs to the same family as NSD1, whose mouse homolog is an RARalpha -interacting protein,17 and NSD2, named WHSC1 (Wolf-Hirschhorn syndrome candidate-1) or MMSET (multiple myeloma SET domain).


    Study design
Top
Abstract
Introduction
Study design
Results and discussion
References

Patient history

A 65-year-old man was admitted because of fever and malaise. Clinical examination disclosed slight hepatomegaly. Hematologic data were as follows: hematocrit, 22%; hemoglobin level, 9 g/dL; leukocyte count, 159 × 109/L with 84% blast cells, 5% promyelocytes, 3% myelocytes, 2% neutrophils, 2% basophils, 1% eosinophils, and 3% lymphocytes; platelet count, 81 × 109/L. Bone marrow aspirate was indicative of AML, M1-FAB, with multilineage dysplasia. Blast cells were CD7+, CD13+, CD15+, CD33+, CD34+, HLA-DR+ and CD2-, CD3-, CD19-, CD41-, CD61-. The patient died of septic shock during drug-induced marrow aplasia.

Cytogenetics and fluorescence in situ hybridization

Karyotyping was performed on unstimulated bone marrow cells after short-term culture. Chromosomes were G-banded and classified according to the International System for Human Cytogenetic Nomenclature.18 Fluorescence in situ hybridization (FISH) studies were performed as described elsewhere.19 We used a mixture of 2 BAC clones (118H17 and 290A12) labeled with biotin for the NUP98 gene.19

The 8p11-12 breakpoint was investigated using YAC 176C9 (Dr M. Chaffanet, Marseilles, France) spanning the MOZ gene, BAC 350N15 spanning the FGFR1 gene, and BAC 513D5 telomeric to the FGFR1 locus. Probes were biotin-labeled. A centromeric probe labeled with digoxigenin was added in each experiment for chromosome 8 (D8Z1) or for chromosome 11 (D11Z1) (Oncor, Gaithersburg, MD). At least 8 metaphases were analyzed using an Olympus fluorescence microscope equipped with a cooled CCD camera (Sensys, Photometrics, Tucson, AZ) run by Pathvysion (Vysis, Stuttgart, Germany).

Molecular characterization

Database searches and sequence analyses were performed using BLAST algorithms (http://www.ncbi.nlm.nih.gov/BLAST) and RepeatMasker (http://repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker). All NUP98 primers have been described previously19 except NUP737F, AGTCACTAGAGGAACTTCG. NSD3 primers were designed on GenBank accession number AK022560 (FLJ536f, CAGAAATTCCAAACACAAGAC; FLJ940f, CCAGTTCAGCCAATACTATC; FLJ1856Af, AGCCAACGCAGAGTGTATCATC; FLJ2907Br, GGTGGGCCTCGTTAGACTGCTC; FLJ3081Cr, TTCCCCCAAAATTTCCATACAA; FLJ1204Df, GAAGAATTACTGGCTGAGGCAAC; FLJ1747Er, ATTTCCCATCCCCTGTAGCATTC) and GenBank accession number AF332469 (W1L2863R1, AATTTGCGGACACAGGCTTC; W1L2685R2, TGCAGCACTCTCCCTCAC).

Total RNA was reverse-transcribed using SuperscriptII (Life Technologies, Gaithersburg, MD). Using the Expand Long Template PCR System (Roche, Mannheim, Germany) and the appropriate primers, cDNA aliquots were amplified in 10-µL polymerase chain reaction (PCR) as follows: 35 amplification cycles at 94°C for 5 minutes 10 seconds (94°C for 50 seconds, 58°C for 20 seconds, and 68°C for 4 minutes) and at 68°C for 5 minutes.

Nested PCR was carried out as follows: 35 amplification cycles at 94°C for 5 minutes (94°C for 30 seconds, 58°C for 20 seconds, 68°C for 2 minutes) and at 68°C for 5 minutes. Sequencing was performed with an automated ABI377 sequencing station after purification using Concert Rapid PCR Purification System (Life Technologies).


    Results and discussion
Top
Abstract
Introduction
Study design
Results and discussion
References

The t(8;11)(p11.2;p15) translocation was found as an isolated anomaly in all 20 bone marrow karyotypes from this patient with de novo AML. The mixture of BAC 118H17 and 290A12 was split, thus generating 3 spots of fluorescence: on normal chromosome 11, on der(11), and on der(8) (Figure 1A, left panel). BAC 350N15 spanned the 8p11-12 breakpoint, showing hybridization signals on normal chromosome 8, on der(8), and on der(11) (Figure 1A, right panel).


View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. FISH experiments and molecular characterization of fusion transcripts. (Ai) FISH with probe D11Z1 (red) for the alpha satellite of centromere 11 and a mixture of BAC 118H17 and BAC 290A12 (green), to encompass the NUP98 gene at 11p15. Red signals are present on normal 11 and der(11), and green signals are present on normal 11, der(11) (arrow), and der(8) (arrowhead). (Aii) FISH with probe D8Z1 (red) for the alpha satellite of centromere 8 and BAC 350N15 (green), to encompass the FGFR1 and NSD3 genes at 8p11.2. Red signals are present on normal 8 and on der(8), and green signals are present on normal 8, der(8) (arrowhead), and der(11) (arrow). (Bi) Nested PCR detects NUP98-NSD3 short fusion transcripts. After primary amplification with primers NUP737F-FLJ3081Cr, diluted aliquots of PCR products were amplified with the following primers: lanes 1-2, NUP737F-FLJ2907Br (2477 base pair [bp]); lanes 3-4, NUP737F-FLJ1747Er (1317 bp); lanes 5-6, NUP1252F-FLJ3081Cr (2136 bp); lanes 7-8, NUP1252F- FLJ2907Br (1962 bp); lanes 9-10, NUP1252F- FLJ1747Er (802 bp). Lane M, molecular weight markers (lambda DNA digested with HindIII). Negative controls without cDNA are marked as (-). (Bii) Nucleotide and deduced amino acid sequences of NUP98 and NSD3 cDNA at the fusion point. Sequence numbers refer to GenBank accession no. U41815 for NUP98 and AF332469 for NSD3.

BAC 350N15 was found to contain 2 candidate genes, FGFR1 and NSD3, which were screened for an in-frame fusion transcript with NUP98. PCR experiments excluded FGFR1 involvement. The NSD3 gene, like NSD2, is known to encode 2 splicing isoforms, a long form and a short form.20,21 Primers were first designed on the short form (FLJ1856Af, FLJ2907Br, FLJ3081Cr, FLJ1204Df, FLJ1747Er). As reports suggest, the 5' end of NUP98 bears the oncogenic-related portion. PCR experiments investigated whether (5')NUP98-NSD3(3') chimeric transcripts were present in patient-derived cDNA.

Results showed NUP98-NSD3 fusion transcripts (Figure 1B, upper panel). The NUP1252F-FLJ1747Er amplification product was sequenced, confirming an in-frame fusion between the 2 genes (Figure 1B, lower panel). Breakpoints were located between exons 3 and 4 in the NSD3 gene and between exons 11 and 12 in NUP98 (Figure 2A-B). Successful amplification from primer FLJ3081Cr implied the expression of short-form chimeric NSD3 (Figure 2C).


View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. NSD3 and NUP98 exon structures and chimeric transcripts. (A, B) NSD3 and NUP98 exon structures showing encoded domains. Coding regions are depicted as dark gray; noncoding regions are light gray. Exon lengths are to scale, as indicated by ruler. Primers used in this study are positioned below the respective gene (only the end parts of the names are indicated). (A) NSD3 exon structure. All transcript sequences start at various points in exon 0. Ending points are indicated for the following GenBank accession numbers: (a) (WHSC1L1s), AF332468; (b) (WHSC1L1l), AF332469; (c) (FLJ12498), AK022560; (d) (NSD3S), AJ295992; (e) (NSD3L), AJ295990; (f) (NSD3L2, lacking exon 14), AJ295991. (B) NUP98 exon structure, derived from GenBank accession number U41815. Exons 11 to 15 are also indicated as A-E by Arai et al.7 (C-F) Schematic representation of NSD3-NUP98 fusion transcripts. NUP98-derived exons are depicted as light gray; NSD3-derived exons are dark gray. (C) Short-form transcript, containing NUP98 exons 1 through 11 and NSD3 exons 4 through 9a. (D) Long-form transcript, containing NUP98 exons 1 through 11 and NSD3 exons 4 through 23. (E) Alternatively spliced long-form transcript, lacking NSD3 exon 14. (F) Reciprocal transcript, containing NSD3 exons 0 through 3 and NUP98 exons 12 through 20.

To investigate the expression of long-form mRNA (Figure 2D), nested PCR was performed with primers W1L2685R2 and W1L2863R1 in combination with NUP98 forward primers. Only one band, of the appropriate length, was amplified (data not shown), confirming that the long transcript was present. Because no product was extended after exon 12, the presence of exon 14, which is involved in alternative splicing20 (Figure 2A,E), could not be determined. We also analyzed the expression of the reciprocal transcript (5')NSD3-NUP98(3') by matching primers NUP1811R and NUP2887R with 2 NSD3 forward primers FLJ536f and FLJ940f. A specific band of the correct length (data not shown) revealed the patient's cells expressed reciprocal fusion mRNA. The reciprocal transcript NSD3-NUP98 maintained the 5' part of NSD3, encoding for a split PWWP domain, and the 3' part of NUP98, with few FG repeats and the RNA-binding domain (Figure 2F).

As far as we know, NSD3 is the eighth NUP98 partner in myeloid malignancies, so NUP98, like MLL and ETV6, is emerging as a promiscuous gene that recombines and fuses with different genomic sites. In the NSD family, NSD1, located at 5q35, has been shown to rearrange with NUP98 in childhood AML.3 NSD2, located at 4p16, is the fusion partner of immunoglobulin heavy- chain gene at 14q32 in a recurrent translocation of multiple myeloma.21,22 Angrand et al20 found NSD3 as part of an amplicon in breast cancer with 8p karyotypic abnormalities. We also confirmed NSD3 amplification in 1 of 30 unselected cases of breast cancer analyzed by semiquantitative PCR (unpublished data, May 2001). This is the first report of NSD3 rearrangements in hematologic malignancies.

These 3 NSD family members have a common region of conserved architecture3,20,21---PHD fingers I-IV, PWWP, SAC/SET, PHD-V, and C5HCH (Figure 2A)---which suggests their involvement in chromatin remodeling and regulation of transcription. The fusion transcripts NUP98-NSD1 in t(5;11)3 and NUP98-NSD3 in t(8;11) both show this region fused to NUP98 FG repeats, which are known to bind transcription factors such as cyclic adenosine 3',5'-monophosphate response element binding protein (CREB)-binding protein.23 Moreover, transcriptional regulation genes, such as PMX1,1 HOXD13,2 HOXA9,4-5 and LEDGF,6 are other fusion partners for NUP98 in malignancies. Altogether, these data support the hypothesis that the transcription regulation function is critical for NUP98 fusion gene oncogenicity.

In conclusion, NSD3 has been observed for the first time as a translocation partner of NUP98 in acute myeloid leukemia. Further functional analysis of the chimeric transcripts will elucidate their specific role in leukemogenesis.


    Footnotes

Submitted October 5, 2001; accepted January 14, 2002.

Supported by Associazione Italiana per la Ricerca sul Cancro (C.M., M.N.), Associazione Italiana contro le Leucemie-linfomi (C.M.), Ministero dell'Università e della Ricerca Scientifica e Tecnologica (C.M., M.N.), and Associazione Sergio Luciani (R.R.).

R.R. and R.L.S. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Cristina Mecucci, Hematology and Bone Marrow Transplantation Unit, Policlinico Monteluce, Via Brunamonti, 06123 Perugia, Italy; e-mail: crimecux{at}unipg.it.


    References
Top
Abstract
Introduction
Study design
Results and discussion
References

1. Nakamura T, Yamazaki Y, Hatano Y, Miura I. NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15). Blood. 1999;94:741-747[Abstract/Free Full Text].

2. Raza-Egilmez SZ, Jani-Sait SN, Grossi M, Higgins MJ, Shows TB, Aplan PD. NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia. Cancer Res. 1998;58:4269-4273[Abstract/Free Full Text].

3. Jaju RJ, Fidler C, Haas OA, et al. A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia. Blood. 2001;98:1264-1267[Abstract/Free Full Text].

4. Borrow J, Shearman AM, Stanton VP Jr, et al. The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet. 1996;12:159-167[CrossRef][Medline] [Order article via Infotrieve].

5. Nakamura T, Largaespada DA, Lee MP, et al. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat Genet. 1996;12:154-158[CrossRef][Medline] [Order article via Infotrieve].

6. Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ, Slovak ML. t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF). Cancer Res. 2000;60:6227-6229[Abstract/Free Full Text].

7. Arai Y, Hosoda F, Kobayashi H, et al. The inv(11)(p15q22) chromosome translocation of the novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase RNA gene, DDX10. Blood. 1997;89:3936-3944[Abstract/Free Full Text].

8. Ahuja HG, Felix CA, Aplan PD. The t(11;20)(p15;q11) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion. Blood. 1999;94:3258-3261[Abstract/Free Full Text].

9. Hussey DJ, Nicola M, Moore S, Peters GB, Dobrovic A. The t(4;11)(q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia. Blood. 1999;94:2072-2079[Abstract/Free Full Text].

10. Borrow J, Stanton VP Jr, Andresen JM, et al. The translocation t(8;16)(p11;p13) of acute myeloid leukaemia fuses a putative acetyltransferase to the CREB-binding protein. Nat Genet. 1996;14:33-41[CrossRef][Medline] [Order article via Infotrieve].

11. Xiao S, Nalabolu SR, Aster JC, et al. FGFR1 is fused with a novel zinc-finger gene, ZNF198, in the t(8;13) leukaemia/lymphoma syndrome. Nat Genet. 1998;18:84-87[CrossRef][Medline] [Order article via Infotrieve].

12. Liang J, Prouty L, Williams BJ, Dayton MA, Blanchard KL. Acute mixed lineage leukemia with an inv(8)(p11q13) resulting in fusion of the genes for MOZ and TIF2. Blood. 1998;92:2118-2122[Abstract/Free Full Text].

13. Carapeti M, Aguiar RC, Goldman JM, Cross NC. A novel fusion between MOZ and the nuclear receptor coactivator TIF2 in acute myeloid leukemia. Blood. 1998;91:3127-3133[Abstract/Free Full Text].

14. Chaffanet M, Gressin L, Preudhomme C, Soenen-Cornu V, Birnbaum D, Pebusque MJ. MOZ is fused to p300 in an acute monocytic leukemia with t(8;22). Genes Chromosomes Cancer. 2000;28:138-144[CrossRef][Medline] [Order article via Infotrieve].

15. Popovici C, Zhang B, Gregoire MJ, et al. The t(6;8)(q27;p11) translocation in a stem cell myeloproliferative disorder fuses a novel gene, FOP, to fibroblast growth factor receptor 1. Blood. 1999;93:1381-1389[Abstract/Free Full Text].

16. Guasch G, Mack GJ, Popovici C, et al. FGFR1 is fused to the centrosome-associated protein CEP110 in the 8p12 stem cell myeloproliferative disorder with t(8;9)(p12;q33). Blood. 2000;95:1788-1796[Abstract/Free Full Text].

17. Huang N, vom Baur E, Garnier JM, et al. Two distinct nuclear receptor interaction domains in NSD1, a novel SET protein that exhibits characteristics of both corepressors and coactivators. EMBO J. 1998;17:3398-3412[CrossRef][Medline] [Order article via Infotrieve].

18. Mitelman F, ed. ISCN: An International System for Human Cytogenetic Nomenclature. Basel, Switzerland: S. Karger; 1995.

19. Mecucci C, La Starza R, Negrini M, et al. t(4;11)(q21;p15) translocation involving NUP98 and RAP1GDS1 genes: characterization of a new subset of T acute lymphoblastic leukaemia. Br J Haematol. 2000;109:788-793[CrossRef][Medline] [Order article via Infotrieve].

20. Angrand PO, Apiou F, Stewart AF, Dutrillaux B, Losson R, Chambon P. NSD3, a new set-domain containing gene, maps to 8p12 and is amplified in human breast cancer cell lines. Genomics. 2001;74:79-88[CrossRef][Medline] [Order article via Infotrieve].

21. Stec I, Wright TJ, van Ommen GJ, et al. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma. Hum Mol Genet. 1998;7:1071-1082[Abstract/Free Full Text].

22. Chesi M, Nardini E, Lim RS, Smith KD, Kuehl MW, Bergsagel PL. The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts. Blood. 1998;92:3025-3034[Abstract/Free Full Text].

23. Kasper LH, Brindle PK, Schnabel CA, Pritchard CE, Cleary ML, van Deursen JM. CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity. Mol Cell Biol. 1999;19:764-776[Abstract/Free Full Text].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Hum Mol GenetHome page
A. Miremadi, M. Z. Oestergaard, P. D.P. Pharoah, and C. Caldas
Cancer genetics of epigenetic genes
Hum. Mol. Genet., April 15, 2007; 16(R1): R28 - R49.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-J. Sun, J. Wei, X.-Y. Wu, M. Hu, L. Wang, H.-H. Wang, Q.-H. Zhang, S.-J. Chen, Q.-H. Huang, and Z. Chen
Identification and Characterization of a Novel Human Histone H3 Lysine 36-specific Methyltransferase
J. Biol. Chem., October 21, 2005; 280(42): 35261 - 35271.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Tonon, K.-K. Wong, G. Maulik, C. Brennan, B. Feng, Y. Zhang, D. B. Khatry, A. Protopopov, M. J. You, A. J. Aguirre, et al.
High-resolution genomic profiles of human lung cancer
PNAS, July 5, 2005; 102(27): 9625 - 9630.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
A. Tefferi and D. G. Gilliland
The JAK2V617F Tyrosine Kinase Mutation in Myeloproliferative Disorders: Status Report and Immediate Implications for Disease Classification and Diagnosis
Mayo Clin. Proc., July 1, 2005; 80(7): 947 - 958.
[Abstract] [PDF]


Home page
BloodHome page
Y.-W. Lin, C. Slape, Z. Zhang, and P. D. Aplan
NUP98-HOXD13 transgenic mice develop a highly penetrant, severe myelodysplastic syndrome that progresses to acute leukemia
Blood, July 1, 2005; 106(1): 287 - 295.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Di Croce
Chromatin modifying activity of leukaemia associated fusion proteins
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R77 - R84.
[Abstract] [Full Text] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
G. TONON, C. BRENNAN, A. PROTOPOPOV, G. MAULIK, B. FENG, Y. ZHANG, D.B. KHATRY, M.J. YOU, A.J. AGUIRRE, E.S. MARTIN, et al.
Common and Contrasting Genomic Profiles among the Major Human Lung Cancer Subtypes
Cold Spring Harb Symp Quant Biol, January 1, 2005; 70(0): 11 - 24.
[Abstract] [PDF]


Home page
BloodHome page
R. M. Gurevich, P. D. Aplan, and R. K. Humphries
NUP98-Topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation
Blood, August 15, 2004; 104(4): 1127 - 1136.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Ghannam, A. Takeda, T. Camarata, M. A. Moore, A. Viale, and N. R. Yaseen
The Oncogene Nup98-HOXA9 Induces Gene Transcription in Myeloid Cells
J. Biol. Chem., January 9, 2004; 279(2): 866 - 875.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
N. J. Krogan, M. Kim, A. Tong, A. Golshani, G. Cagney, V. Canadien, D. P. Richards, B. K. Beattie, A. Emili, C. Boone, et al.
Methylation of Histone H3 by Set2 in Saccharomyces cerevisiae Is Linked to Transcriptional Elongation by RNA Polymerase II
Mol. Cell. Biol., June 15, 2003; 23(12): 4207 - 4218.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Lahortiga, J. L. Vizmanos, X. Agirre, I. Vazquez, J. C. Cigudosa, M. J. Larrayoz, F. Sala, A. Gorosquieta, K. Perez-Equiza, M. J. Calasanz, et al.
NUP98 Is Fused to Adducin 3 in a Patient with T-Cell Acute Lymphoblastic Leukemia and Myeloid Markers, with a New Translocation t(10;11)(q25;p15)
Cancer Res., June 15, 2003; 63(12): 3079 - 3083.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski
In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression
Blood, February 15, 2003; 101(4): 1520 - 1529.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum (v100,p1132)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosati, R.
Right arrow Articles by Mecucci, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosati, R.
Right arrow Articles by Mecucci, C.
Related Collections
Right arrow Neoplasia
Right arrow Brief Reports
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020