Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinclair, A. M.
Right arrow Articles by Green, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinclair, A. M.
Right arrow Articles by Green, A. R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 1 June 2002, Vol. 99, No. 11, pp. 3931-3938

HEMATOPOIESIS

Rescue of the lethal sclminus /minus phenotype by the human SCL locus

Angus M. Sinclair, Anthony J. Bench, Adrian J. C. Bloor, Juan Li, Berthold Göttgens, Maureen L. Stanley, Jane Miller, Sandie Piltz, Susie Hunter, Elisabeth P. Nacheva, María-José Sanchez, and Anthony R. Green

From the University of Cambridge, Department of Haematology, Cambridge Institute for Medical Research, Hills Road, Cambridge, CB2 2XY, United Kingdom.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The stem cell leukemia (SCL) gene encodes a basic helix-loop-helix transcription factor with a critical role in the development of both blood and endothelium. Loss-of-function studies have shown that SCL is essential for the formation of hematopoietic stem cells, for subsequent erythroid development and for yolk sac angiogenesis. SCL exhibits a highly conserved pattern of expression from mammals to teleost fish. Several murine SCL enhancers have been identified, each of which directs reporter gene expression in vivo to a subdomain of the normal SCL expression pattern. However, regulatory elements necessary for SCL expression in erythroid cells remain to be identified and the size of the chromosomal domain needed to support appropriate SCL transcription is unknown. Here we demonstrate that a 130-kilobase (kb) yeast artificial chromosome (YAC) containing the human SCL locus completely rescued the embryonic lethal phenotype of scl-/- mice. Rescued YAC+ scl-/- mice were born in appropriate Mendelian ratios, were healthy and fertile, and exhibited no detectable abnormality of yolk sac, fetal liver, or adult hematopoiesis. The human SCL protein can therefore substitute for its murine homologue. In addition, our results demonstrate that the human SCL YAC contains the chromosomal domain necessary to direct expression to the erythroid lineage and to all other tissues in which SCL performs a nonredundant essential function. (Blood. 2002;99:3931-3938)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The stem cell leukemia (SCL) gene (also known as TAL-1) encodes a basic helix-loop-helix (bHLH) transcription factor with an essential role in the development of both blood and endothelial cells.1 Mice lacking a functional SCL protein failed to develop yolk sac hematopoiesis and blastocyst reconstitution experiments have demonstrated that SCL is required for both definitive and primitive hematopoiesis.2,3 These data suggest that SCL plays a pivotal role in the formation or behavior of hematopoietic stem cells and are consistent with the observation that expression of antisense SCL suppressed the proliferation, cell cycle progression, and self-renewal of a multipotent hematopoietic cell line.4 SCL is likely to perform additional functions following lineage commitment because enforced SCL expression enhanced erythroid differentiation of hematopoietic cell lines5,6 and increased erythroid and megakaryocytic differentiation of normal CD34+ progenitors.7,8

Several lines of evidence demonstrate that SCL is critical for normal endothelial development. scl knockout mice exhibit defective yolk sac angiogenesis thought to reflect an essential function for SCL during vessel formation.9 SCL is also likely to play an earlier role during the formation of endothelial cells. In zebrafish and in murine embryonic stem (ES) cell systems, SCL is expressed in hemangioblasts, bipotent progenitors of blood and endothelium.10,11 Moreover, SCL expression can partially rescue both blood and endothelial defects of the zebrafish cloche mutant12 and ectopic expression of SCL during early development alters the fate of mesodermal cells, resulting in excessive hemangioblast formation at the expense of several other cell types.10

Current evidence therefore suggests that SCL is essential for establishing the transcriptional program necessary for the formation of hemangioblasts and subsequently hematopoietic stem cells. It is also clear that transcriptional dysregulation of the scl gene has profound consequences. These observations emphasize the fundamental biologic significance of the mechanisms that regulate SCL transcription and our laboratory has therefore undertaken a systematic analysis of the transcriptional regulation of the murine scl locus.

Both human and murine SCL are transcribed from 2 lineage-specific promoters.13-17 A survey of the chromatin structure surrounding the murine scl gene has also revealed a panel of DNase I hypersensitive sites associated with enhancer or silencer activity in transfection assays.18 Transgenic reporter assays have so far identified 5 independent enhancers each of which targets expression to a specific subdomain of the normal SCL expression pattern.19-21 A 3' enhancer is of particular interest because it targets expression to the vast majority of hematopoietic progenitors and long-term repopulating hematopoietic stem cells.19,22

However, additional elements remain to be identified and the size of the chromosomal domain that contains all of the scl gene regulatory elements remains unknown. This issue is particularly important given the mounting evidence for the existence of long-range regulatory elements at a number of mammalian loci. Yeast artificial chromosomes (YACs) spanning 120 kilobase (kb), 540 kb, or 625 kb of the Gata-3 locus were unable to completely rescue the pattern of endogenous Gata-3 expression23 and also failed to overcome embryonic lethality in Gata-3-/- mice.24,25 Similarly, large YAC transgenes resulted in only partial rescue of the Dazl and Wt1 null phenotypes.26,27 Studies of chromosome rearrangements have inferred the existence of c-kit regulatory regions at least 100 kb upstream of the coding region28 and more recently, Loots and colleagues have identified a regulatory element that coordinates expression of the interleukin 4, 13, and 5 genes over a region of 120 kb.29

In this paper we demonstrate that a 130-kb YAC containing the human SCL locus completely rescues the lethal phenotype of scl-/- mice and results in normal yolk sac, fetal liver, and adult hematopoiesis.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Isolation and modification of a human SCL YAC

Three human YAC libraries were screened.30-32 Filters were initially hybridized with a 750 bp BamHI fragment from the 3' untranslated region (UTR) of SCL (3' probe)13 and subsequently with a 2.2 kb XhoI fragment derived from the 5' end of the SCL gene (5' probe).13 Six clones came through 2 rounds of screening (4HD12 and 28EF2 from the ICI human YAC library; 48D10 and Y18C10 from the ICRF human YAC library; 638E10 and 781B6 from the CEPH megaYAC library). Preparation of high-molecular-weight yeast DNA plugs and total yeast/YAC DNA, long-range and short-range restriction mapping, and sizing of YACs were performed according to standard methods.33-35 Fluorescence in situ hybridization (FISH) was performed as previously described.36 YAC 4HD12 from the ICI human YAC library was subsequently used for further manipulation.

YAC 4HD12 was retrofitted by spheroplast transformation37 to incorporate I-PpoI sites into each YAC arm firstly with plasmid pUC-OK and subsequently with pUC-WAN.38 The efficiency of transformation was 5% and 3%, respectively. After each transformation, high-molecular-weight yeast DNA plugs were prepared from at least 10 individual transformants. Pulsed field gel electrophoresis (PFGE) followed by Southern hybridization confirmed the size of the modified YAC was unchanged.

To monitor expression from the human SCL locus, an internal ribosomal entry site (IRES) (from encephalomyocarditis virus) nuclear localized (nls) lacZ reporter (kindly provided by E. Andermarcher) was cloned into the NcoI site within the 3' UTR of human SCL. This construct was cloned into the yeast integrating vector, pRS406 (Stratagene, La Jolla, CA), which contains the URA3 selectable marker, to form plasmid p5'lacZ3'. This plasmid was integrated into the modified YAC using Pop-In/Pop-Out technology.39 The YAC was retrofitted with linearized p5'lacZ3' by spheroplast transformation (Pop-In). Total yeast/YAC DNA was prepared from 25 Ura+ Trp+ Lys+ transformants, digested with BglII and HindIII and sequentially hybridized to the 3' probe and the lacZ reporter gene by Southern analysis. The correct pattern was observed in 4 of 25 transformants. Integrity of the YAC was demonstrated by PFGE and Southern hybridization.

To generate transformants without vector sequence but containing 3' UTR with IRES-nls-lacZ (Pop-Out), one transformant was grown in a selection medium containing uracil. The culture was plated onto agar supplemented with 1 mg/mL 5-fluoro-orotic acid (5-FOA) to select against colonies containing the URA3 gene. Fifty-seven of 78 Ura- Trp+ Lys+ transformants40 were found to contain the lacZ reporter gene by hybridization. DNA was prepared from 18 of these, digested with BglII and HindIII and hybridized to the 3' probe. Fourteen demonstrated the expected pattern and all were of the correct size, as determined by PFGE and Southern hybridization.

To determine the 5' and 3' limits of genomic DNA contained within clone 4HD12, the YAC ends were rescued by digesting 100 ng 4HD12 YAC DNA with HaeIII and self-ligating at a low concentration (1 ng/µL). Then, 2 ng of this ligated product was amplified by inverted polymerase chain reaction (PCR), using the following primers: YAC left arm; sense CGCAAGACTTTAATTTATCACTAC and antisense TAGTCGATAGTGGCTCCAAGTAGC; YAC right arm; sense TGGATCCTCTACGCCGGACGCATC and antisense AGTCGAACGCCCGATCTCAA. The resulting products were cloned into pGEM-T vector (Promega, Southampton, United Kingdom) and sequenced. Sequences were compared with sequences in GenBank using BLAST.41

Generation of transgenic mice

Purified YAC DNA was prepared for microinjection as previously described by 2 gel runs without exposure of the DNA to ethidium bromide or UV irradiation.42 YAC DNA in a gel slice was then equilibrated against TENPA (10 mM Tris-HCl, pH7.5, 1 mM EDTA, 100 mM NaCl, 30 µM spermine, 70 µM spermidine), melted at 68°C and the agarose digested with agarase (New England Biolabs, Hitchin, United Kingdom) at 42°C. YAC DNA was dialyzed against microinjection buffer (10 mM Tris, pH 7.4, and 0.25 mM EDTA) on a floating dialysis membrane (0.05 µm; Millipore, Bedford, MA) for 1.5 hours. and diluted to 1 µg/mL for microinjection.

Pronuclear injections were performed into CBA/C57.Bl6 fertilized mouse oocytes that were allowed to divide to 2 cells prior to implantation into the oviducts of pseudopregnant CD1 female mice.43 At 2 weeks of age tail DNA was prepared from founder mice and multiplex PCR analysis was performed to detect lacZ using myogenin as an internal control.44 Founder mice were subsequently backcrossed onto CBA/C57.Bl6 F1 mice to maintain the transgenic lines. In the case of scl-/- rescue analysis, YAC transgenic lines were crossed onto the scl knockout line SV10245 (kindly provided by L. Robb and C. G. Begley). Offspring were genotyped by PCR for the presence of the YAC transgene and the scl- allele as described previously.44,45 Mice heterozygous for the YAC and heterozygous for mutant scl were intercrossed and resulting offspring were genotyped as described above.

Southern analysis of transgenic mice

Copy number quantification of the YAC transgene was performed by digesting 10 µg tail DNA from F2 mice with EcoRI followed by Southern hybridization to equimolar concentrations of size-matched (1.9 kb) probes for the 3'UTR of the endogenous scl (mouse specific) and lacZ (transgene specific). Signal from the lacZ gene was quantified with respect to the 2 copy endogenous scl signal on a Molecular Dynamics PhosphorImager (Kemsing, Kent, United Kingdom). The 3' UTR probe was a 1.9-kb KpnI/BglII fragment from the murine scl complementary DNA (cDNA)46 and the lacZ probe was a 1.9-kb BamHI/SacI fragment from the IRESnlslacZ construct.

Single-cell suspensions were made from the spleens of YAC transgenic mice and were washed once in phosphate-buffered saline (PBS). Cells were resuspended at 2 × 107 cells/mL in PBS at room temperature. Equal volumes of cells and 2% agarose (made up in PBS and equilibrated to 40°C) were mixed and dispensed into chilled plug molds on ice. Plugs were lysed in the same way as for high-molecular-weight yeast plugs,33 washed twice with 24 mM EDTA, 0.5 mM Tris, 1.8 mM N-laurylsarcosine (pH 9.5) for 2 hours at room temperature and stored at 4°C in this buffer. High-molecular-weight DNA was digested in situ with I-PpoI (Promega) in the same manner as described above.33

Transgene integrity was determined by Southern blot analysis of tail DNA from F2 transgenic mice. Restriction digests and probes (as shown in Figure 1) were as follows: L-arm, EcoRI digest of genomic (various sizes detected as extends from L-arm into integration site) and hybridized with a 4-kb AvaI fragment from plasmid pUC-WAN spanning neo and TRP1; fragment 1, BamHI digest to yield a 15.7-kb fragment (29141-44906 in human SCL locus, GenBank accession no. AJ131016) when hybridized with a promoter 1a probe (44447-44647); fragment 2, BglII digest to yield an 11.6-kb fragment when hybridized with an intron 3 probe (49261-49281); fragment 3, BamHI digest to yield a 2.3- kb fragment when hybridized with an exon 4 probe (380-bp NotI/NaeI fragment from mouse scl cDNA); fragment 4, EcoRI digest to yield a 6.2-kb fragment (53539-lacZ gene) when hybridized with an intron 5 probe (54949-54967); fragment 5, EcoRI digest to yield a 3.6-kb fragment of the lacZ gene when hybridized with a lacZ probe (1.9-kb BamHI/SacI fragment); fragment 6, HindIII digest to yield a 16-kb fragment (lacZ-74500) when hybridized with a 3'UTR probe (600-bp fragment from BglII/KpnI digest of human SCL cDNA); fragment 7, BglII digest to yield a 10-kb fragment (72347-82005) when hybridized with a downstream probe (73182-73524); R-arm, EcoRI digest to yield fragments of varying sizes (extending from R-arm into integration site) when hybridized with a 6.3-kb AatII/TthIII I fragment from plasmid pUC-OK spanning the LYS2 gene. The promoter 1a, intron 3, intron 5, and downstream probes were generated by PCR from human genomic DNA.


View larger version (46K):
[in this window]
[in a new window]
 
Figure 1. Structure and analysis of the human SCL YAC transgenes. (A) Diagram of the 130-kb YAC containing the human SCL gene together with part of the SIL gene and the complete MAP17 gene. A fine detail map of the modified SCL locus is shown together with the location of the IRES-nls-lacZ cassette (hatched box) within the 3' UTR of exon 6 (open box). Numbered horizontal lines indicate the restriction fragments assessed by Southern analysis (Table 1). (B) Southern hybridization of tail DNA from 5 lines together with a nontransgenic control mouse using equimolar concentrations of size matched probes for lacZ (transgene specific) and murine scl 3' UTR (mouse specific). Transgene copy numbers were calculated with respect to the endogenous mouse scl gene.

Northern blot analysis

Poly (A)+ RNAs were isolated from fetal liver as described.47 RNA samples (4 µg) were size fractionated by electrophoresis on a 1% agarose gel containing 0.6% formaldehyde in 1 times 3-[N-Morpholino]propanesulphonic acid (MOPS) (20 mM MOPS, 1 mM EDTA, 5 mM sodium acetate) running buffer, transferred to a nylon membrane (Hybond N+; Amersham Pharmacia Biotech, Bucks, United Kingdom) and hybridized with a 32P-labeled nlslacZ probe (1.9-kb BamHI/SacI fragment) by standard techniques.48 After hybridization and autoradiography with the nlslacZ probe, the filter was stripped and reprobed with a 3'UTR mouse scl probe (1.9 -b BglII/KpnI fragment) and a rat GAPDH probe (kindly provided by T. Enver).

Generation of SCL antisera, immunoprecipitation, and Western analysis

A peptide corresponding to the C-terminus of murine SCL was used to generate polyclonal SCL specific sheep antisera. The antisera obtained was affinity purified using the immunizing peptide and subsequently precleared using a protein extract from the SCL- negative cell line BW5147.

Cellular extracts were prepared by suspension in immunoprecipitation buffer (1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 10 mM Tris-Cl pH 8.0) for 10 minutes on ice, and subsequently passing several times through a 20-gauge needle. For immunoprecipitation, 5 µL rabbit antimouse SCL49 or rabbit serum was added to lysates obtained from a single fetal liver (YAC-scl+/-; YAC-scl+/+) or 2 fetal livers (YAC+scl-/-) and incubated overnight at 4°C. Immune complexes were recovered with protein A-Sepharose 4B (Amersham Pharmacia Biotech) and washed 3 times in PBS. Proteins and immune complexes were boiled in Laemmli buffer for 5 minutes, resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Equal transfer was confirmed by Ponceau S staining. Western analysis with sheep antimouse SCL antisera, followed by horseradish peroxidase-conjugated antisheep IgG (Sigma-Aldrich, Dorset, United Kingdom) was performed according to standard methods.50 Chemiluminescent visualization of proteins was performed using Supersignal West Femto substrate (Pierce, Rockford, IL) according to the manufacturer's instructions.

Analysis of blood

Blood was taken from age-matched (8-14 weeks old) control (2 males, 4 females) and rescued (1 male, 3 females) mice by cardiac puncture. Blood counts were performed using an Animal Blood Counter (ABX Hematologie, Montpellier, France). Cell morphology was assessed on May-Grünwald-Giemsa-stained blood smears.

Flow cytometry

Bone marrow, fetal liver, splenocytes, and thymocytes were harvested in PBS containing 5% fetal calf serum (FCS) and 0.01% sodium azide. Cells (1 × 106) were stained with the appropriate antibody for cell surface antigens on ice for 30 minutes prior to analysis on a FACSsort flow cytometer (Becton Dickinson, San Jose, CA). Dead cells were excluded by propidium iodide (PI) staining and by gating out cells with low forward and side scatter. Monoclonal antibodies were from Pharmingen (San Diego, CA) and included anti-c-kit (2B8), anti-CD34 (RAM34), anti-MAC-1 (M1/70), anti-Gr-1 (RB6-8C5), anti-Ter119 (TER119), anti-CD61 (2C9.G2), anti-B220 (RA3-6B2), anti-CD4 (H129.19), and anti-CD8 (53-6.7). In some instances incubation with streptavidin-phycoerythrin or streptavidin-fluorescein isothiocyanate (Pharmingen) was required for biotin-conjugated antibodies.

In vitro colony-forming assays for progenitors

Bone marrow cells were seeded at 5 × 104 cells/plate containing 0.3% agar in Iscoves modified Dulbecco medium (IMDM; Gibco, Invitrogen, Paisley, United Kingdom) supplemented with 25% FCS and cytokines (interleukin 3 [IL-3], stem cell factor [SCF], thrombopoietin [Tpo]) for myeloid colony formation51 or in Methocult GF-M3434 methylcellulose (Stem Cell Technologies, Vancouver, BC, Canada) for erythroid and myeloid colony formation. Agar cultures were supplemented with conditioned medium from the BHK cell line (a kind gift from S. Tsai) containing SCF and WEHI 3B cell line conditioned medium as a source of IL-3,51 or with 2 ng/mL recombinant IL-3 and Tpo (R & D Systems, Abingdon, United Kingdom). Duplicate agar and triplicate Methocult cultures were incubated at 37°C in a humidified atmosphere of 5% CO2 and colonies were scored after 7 days of culture.

Yolk sacs from day 8.5 embryos were separated from the embryo proper, which was subsequently used for genotype analysis by PCR as described previously. The individual yolk sacs were placed in 1 mL PBS containing 20% FCS and passed through 26- and 30-gauge needles to obtain a single-cell suspension. All cells were centrifuged and resuspended in 100 µL IMDM and seeded into 1 mL Methocult GF-M3434 methylcellulose and were cultured in a fully humidified atmosphere of 5% CO2 for 7 days prior to scoring. To confirm that erythroid colonies were hemoglobinized 2,7-diaminofluorene (Sigma-Aldrich) staining was performed at 9 days of culture.52


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Isolation and characterization of a human SCL YAC

A YAC clone, 4HD12, containing the human SCL gene was isolated from the ICI human YAC library by colony hybridization. FISH with the YAC identified signals only at chromosome 1p32 consistent with the location of the SCL locus (data not shown). PFGE followed by Southern hybridization indicated the YAC was approximately 130 kb in size (Figure 1A and data not shown). Restriction digestion of YAC DNA with BamHI, EcoRI, HindIII, or SacI followed by Southern hybridization with 5' and 3' SCL probes demonstrated that the SCL locus within the YAC was intact and long-range restriction mapping with NotI, SalI, and SfiI indicated that the SCL gene lay within the middle of the YAC (Figure 1A and data not shown). To determine the 5' and 3' limits of the clone, the end fragments were rescued by inverted PCR and sequenced. Comparison with the sequence of an SCL PAC clone (GenBank accession number AJ131016)21 demonstrated that the 3' end of the YAC insert was located 36 kb downstream of the MAP17 transcriptional start site. The genomic sequence adjacent to the left YAC arm was found to be identical to exon 11 of human SIL (GenBank accession number AF349650). An EcoRI site lies 200 to 300 bp upstream of human SIL exon 1153 and the YAC library was generated by a partial EcoRI digest. These data indicate that this EcoRI site marks the 5' end of the YAC insert and that the size of the insert is therefore 131 kb.

To allow rapid assessment of YAC-transgene integrity in transgenic mice, I-PpoI restriction sites were inserted into both arms of the YAC.38 To facilitate analysis of human SCL expression in transgenic mice, an IRES-lacZ cassette was inserted into the 3' UTR of exon 6 of the human SCL gene (Figure 1A). Modified YAC clones were analyzed by PFGE and Southern hybridization at each stage of the modification. After modification and confirmation, purified high-molecular-weight YAC DNA was prepared and microinjected into oocytes.

Transgenic founders were screened by PCR for the presence of the transgene. From a total of 161 offspring, 5 transgenic founders were identified (2037, 2054, 2074, 2083, and 2133). Southern blot analysis was performed to assess transgene copy number. Line 2083 was found to contain approximately 13 copies of the human SCL YAC, whereas all other lines contained approximately 2 copies of the transgene (Figure 1B).

Pulsed field gel electrophoresis and Southern hybridization were performed to assess the structure of the integrated YAC in each transgenic line (data not shown). Lines 2054, 2083, and 2133 each gave rise to a band of the expected size (130 kb) demonstrating an absence of major genomic rearrangements. A band of approximately 90 kb was observed in line 2037 suggesting the presence of a 40-kb deletion. Line 2074 gave rise to a band that comigrated with high-molecular-weight genomic DNA, consistent with loss of one or both I-PpoI sites.

A more detailed Southern analysis was then performed of a 57-kb region surrounding and including the human SCL gene (Figure 1A, Table 1, and data not shown). Consistent with the PFGE results, line 2037 contained a large deletion, which removed SCL exons 1a to 5. However, the human SCL exon/intron structure was intact in the remaining 4 transgenic lines and all of these contained unrearranged flanking sequence extending 16 kb upstream and 20 kb downstream of the human SCL gene.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Integrity of human SCL/lacZ YAC within transgenic lines

Expression of the human SCL transgene

To assess expression of the human SCL gene, X-gal staining was performed on E12.5 and E13.5 embryos from all YAC transgenic lines. At these time points SCL is known to be expressed in the yolk sac, fetal liver, and central nervous system.54,55 Control transgenic embryos carrying a -7E3/lacZ murine scl transgene20 gave appropriate X-gal staining. However, no staining was observed in embryos from any of the YAC transgenic lines, even after 48 hours of incubation at 37°C.

To determine whether the fusion gene was transcribed, Northern blot analysis was performed on E14.5 fetal liver, which is known to express readily detectable levels of murine scl messenger RNA (mRNA)54 (Figure 2). No expression of the transgene was detected in line 2037 consistent with the Southern blot data demonstrating deletion of SCL 5' exons in this line. Human SCL transcripts were detected in the 4 remaining transgenic lines. These data therefore further suggest that the failure to detect lacZ expression by X-gal staining was likely to reflect a defect in lacZ translation, probably related to the specific IRES sequence that was used. Lines 2074 and 2133 both contained 2 copies of the transgene but exhibited markedly different levels of transgene expression, suggesting that the human SCL gene is subject to stable or variegating position effects.56 Line 2083 contained 13 copies of the transgene but displayed a level of transgene expression similar to line 2133, which only contained 2 copies, thus demonstrating an absence of copy number-dependent expression. These results suggest that either the human SCL locus does not have a locus control region (LCR)-like element or that such an element exists but is not contained within the 130-kb transgene. It is also possible that the presence of lacZ may have rendered the transgene particularly susceptible to position effects.57


View larger version (69K):
[in this window]
[in a new window]
 
Figure 2. Expression of the human SCL gene. Northern analysis of poly(A)+ RNA from E14.5 fetal liver hybridized with a lacZ probe to detect expression of the human SCL/lacZ transgene, a 3' UTR probe for endogenous mouse scl, and a GAPDH probe as a control for mRNA loading. RNA was obtained from the indicated transgenic lines as well as from a wild-type control (WT).

The human SCL YAC rescues the scl-/- phenotype

The scl-/- embryos die at approximately E9.0 as a consequence of defective yolk sac hematopoiesis and angiogenesis.9,45,55,58 To assess whether the human SCL YAC could rescue the scl-/- phenotype, YAC transgenic lines 2133, 2054, and 2074 were bred with scl+/- mice. Offspring were typed by PCR for the presence of the human SCL transgene and for the murine scl- and scl+ alleles. Compound heterozygotes (YAC+scl+/-) were intercrossed and viable offspring were typed by PCR (Figure 3 and Table 2). As expected, no scl-/- offspring lacking the human SCL YAC were identified. By contrast all 3 YAC transgenic lines gave rise to viable scl-/- offspring that carried the human SCL YAC (Figure 3 and Table 2). These YAC+scl-/- offspring were found in the expected Mendelian frequency, were indistinguishable from their littermates (up to 8 months of age) and were fertile. The total number of YAC+scl-/- mice followed for 2 to 8 months were 37 (line 2054), 25 (line 2074), and 12 (line 2133). In addition, a further 23 (line 2054), 4 (line 2074), and 17 (line 2133) were followed for 8 to 16 months.


View larger version (54K):
[in this window]
[in a new window]
 
Figure 3. The human SCL YAC completely rescues the scl-/- embryonic lethal phenotype. PCR genotype analysis of offspring derived from interbreeding YAC+/-scl+/- male and YAC+/-scl+/- female mice from line 2074. Lanes 1 and 2, YAC+/-scl+/- male and female parents; lanes 3 to 9, offspring with the following genotypes: 3, (YAC-scl+/-); 4, (YAC+scl+/+); 5, (YAC+scl+/-); 6-9, (YAC+scl-/-); +ve, positive control (YAC+ scl+/-); -ve, no DNA control.


                              
View this table:
[in this window]
[in a new window]
 
Table 2. Rescue of scl-/- phenotype by the human SCL YAC

To assess the level of human SCL protein in rescued YAC+scl-/- mice, we performed Western analysis on E14.5 fetal livers from lines 2054 and 2074. Low levels of human SCL protein were observed in YAC+scl-/- livers relative to YAC-scl+/+ and YAC-scl+/-controls (data not shown). The level of human SCL protein was demonstrated more clearly by immunoprecipitation with a rabbit anti-SCL antibody followed by Western analysis with a sheep anti-SCL antibody (Figure 4). These results demonstrate that low levels of human SCL transcript are accompanied by a correspondingly low level of SCL protein and that the latter is sufficient for rescue of the lethal scl-/- phenotype.


View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. Detection of human SCL protein in rescued YAC+ scl-/- E14.5 fetal liver. Cell lysates were prepared from E14.5 fetal livers obtained from transgenic (line 2054) and nontransgenic mice. These were immunoprecipitated (IP) with rabbit antimouse SCL antisera or preimmune rabbit serum as indicated. The immunoprecipitates were subsequently Western blotted using an antimouse SCL antibody raised in sheep. Lysates from SCL-expressing cell lines (K562, human erythroleukemia; M1, mouse myeloid leukemia) and an SCL-nonexpressing cell line (J558L, mouse plasmacytoma) were included on the immunoblot as controls.

Rescued scl-/- mice have normal adult, fetal liver, and yolk sac hematopoiesis

The major phenotypic defect in scl-/- embryos comprises a complete absence of hematopoiesis. A detailed analysis of adult and embryonic hematopoiesis in rescued YAC+scl-/- mice was therefore performed. Analysis of peripheral blood demonstrated that adult YAC+scl-/- mice had normal hemoglobin levels together with normal platelet, white cell, and differential counts (Table 3). Inspection of peripheral blood smears did not reveal any morphologic abnormalities (data not shown).

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Comparison of full blood counts of control and rescued scl-/- mice

Flow cytometry was used to assess the spectrum of hematopoietic cells present in adult bone marrow, spleen, thymus, and fetal liver (Table 4). A panel of antibodies recognizing markers present on progenitors (c-kit, CD34), monocytes (Mac1), granulocytes (Gr-1), erythroid cells (Ter119), megakaryocytes (CD61), mast cells (IgE/anti-IgE), B cells (B220), and T cells (CD4, CD8) was used. Percentages of double-negative and double-positive thymocytes were also assessed, as were percentages of c-kit+ and Ter119+ cells in E11.5 and E12.5 fetal livers. No significant differences were obtained between control (YAC+scl+/-) and rescued (YAC+scl-/-) mice.

                              
View this table:
[in this window]
[in a new window]
 
Table 4. FACS analysis of hematopoietic tissues from rescued scl-/- mice

Colony assays were used to investigate whether more subtle defects were present in the progenitor compartment. The numbers of myeloid and erythroid colonies present in adult bone marrow were the same in rescued YAC+scl-/- and control YAC+scl+/- littermates from line 2054 (Figure 5A). Subdivision of the myeloid colonies into granulocyte, monocyte, granulocyte-monocyte, and megakaryocyte did not reveal any differences between the rescued YAC+scl-/- mice and controls (Figure 5B). To assess yolk sac hematopoiesis, colony assays were performed using cells from E9.5 yolk sacs (Figure 5C). As previously described,45,58 no hematopoietic colonies were obtained from scl-/- yolk sacs (data not shown). By contrast, there was no significant difference between the numbers of erythroid and myeloid colonies obtained from rescued YAC+scl-/- or control YAC+scl+/- yolk sacs.


View larger version (45K):
[in this window]
[in a new window]
 
Figure 5. Analysis of hematopoietic progenitors and yolk sac angiogenesis in rescued YAC+ scl-/- mice. Hematopoietic progenitor assays were performed using adult bone marrow (A,B) or yolk sac (C) from mice of the indicated genotype derived from line 2054. In each case, histograms represent the mean of 6 cultures from 2 mice. (A) Myeloid and erythroid (erythroid burst-forming unit [BFU-E]) colonies obtained from adult bone marrow from line 2054. Myeloid colonies were obtained by growth either in IL-3 and SCF or IL-3 and Tpo. (B) Myeloid colony types obtained by growth in IL-3 and SCF. (C) Yolk sac BFU-Es obtained from line 2133 or 2054. (D) Yolk sac vasculature from E9.5 embryos of the indicated genotype from line 2074. Note the large vitelline vessels present in both control and rescued yolk sacs.

In addition to an absence of hematopoiesis, scl-/- embryos have also been reported to exhibit defects in yolk sac angiogenesis. In particular large vitelline vessels are absent in E9.5 scl-/- yolk sacs as a consequence of a cell autonomous defect in endothelial development.9 By contrast, the vitelline vessels present in rescued YAC+scl-/- yolk sacs were indistinguishable from those present in control YAC+scl+/- embryos (Figure 5D).

These data therefore demonstrate that the human SCL YAC completely rescues the lethal scl-/- phenotype and in particular is able to support normal yolk sac, fetal liver, and adult hematopoiesis together with yolk sac angiogenesis.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

We demonstrate here that the human SCL locus can rescue the lethal phenotype of scl-/- mice. The human SCL protein can therefore function in place of the murine SCL protein. More importantly, our results demonstrate that a 130-kb region spanning the human SCL locus contains the chromosomal domain necessary to direct SCL expression to erythroid cells and to other tissues in which SCL performs a nonredundant essential function. Identification of a human SCL domain capable of complementing the scl-/- phenotype opens up the possibility of systematically deleting individual regulatory elements and thereby examining the consequences of ablating SCL expression in specific cell types.

The SCL gene is expressed in a subset of blood cells (progenitors, erythroid, mast, and megakaryocytic lineages), endothelial cells, and specific regions of the brain and spinal cord. This pattern of expression is highly conserved throughout vertebrate evolution from zebrafish to mammals.1,10,12,20,55 Systematic analysis of the murine scl locus has identified a series of independent enhancers, each of which directs reporter gene expression to a subdomain of the normal SCL expression pattern.18-21 Of particular interest is a 3' enhancer that directs expression to blood and endothelial progenitors throughout ontogeny19 and also to long-term repopulating hematopoietic stem cells.22 However additional elements remain to be identified because this 3' enhancer is the only hematopoietic element identified so far and it does not direct expression to Ter119+ erythroid cells.19 By contrast the endogenous SCL gene is expressed in erythroid cells,54,55,59,60 thus suggesting that maintenance of SCL expression during erythroid differentiation is mediated by an as yet unidentified enhancer. Comparative genomic sequence analysis of the murine and human SCL loci have identified a number of peaks of homology that do not correspond to known enhancers and that therefore represent candidates for additional regulatory elements.61

Previous attempts to rescue the scl-/- phenotype in mice have met with only partial success probably because the transgenes were not subject to appropriate transcriptional regulation. An SCL cDNA under the control of murine stem cell virus regulatory elements has been used to rescue scl-/- ES cells.3 However germ line transmission of the ES cells was not obtained and the hematopoietic potential of rescued scl-/- ES cells was studied in chimeras by assessing the ES cell contribution to pooled populations of blood cells. This precluded any assessment of whether the rescued hematopoietic cells were quantitatively or qualitatively normal. We have recently demonstrated that an SCL cDNA controlled by the SCL gene 3' enhancer results in selective rescue of early hematopoietic progenitors and yolk sac angiogenesis in scl-/- embryos.22 However, consistent with the idea of a distinct SCL erythroid enhancer, this construct was unable to support normal erythropoiesis and the embryos died of severe anemia. By contrast, the human SCL YAC reported here rescued normal levels of yolk sac, fetal liver, and adult hematopoiesis including erythropoiesis thus demonstrating that the YAC contains the missing erythroid regulatory elements.

SCL is known to be essential for the formation of hematopoietic stem cells,2,3 for subsequent erythroid differentiation,22 and for yolk sac angiogenesis.9 SCL may also play an essential role in other tissues including midbrain, hindbrain, spinal cord, and intraembryonic endothelium, but analysis has been precluded by the early embryonic lethality of scl-/- mice. Our results suggest that the human SCL YAC contains all the regulatory elements necessary to direct appropriate SCL expression to the full complement of tissues in which SCL provides essential nonredundant functions.

This notion is consistent with comparative synteny data. We have previously characterized and sequenced the SCL genomic loci from human, mouse, chicken, and pufferfish and have found that the genes immediately flanking pufferfish SCL were unrelated to those known to flank both avian and mammalian SCL genes.21,61,62 In view of the conserved pattern of SCL expression between mammals and teleost fish, these results implied that SCL regulatory elements might be confined to the region between the upstream and downstream flanking genes. Moreover, a 10.4-kb fragment of pufferfish genomic DNA, containing the SCL gene and extending to the 5' and 3' flanking genes, directed appropriate expression to hematopoietic and neural tissue in transgenic zebrafish embryos.62 Our current results accord with these data because the human SCL YAC contains the entire SCL locus extending to both upstream (SIL) and downstream (MAP17) genes.

Interestingly, the human SCL YAC did not give rise to copy number-dependent expression and the levels of transgene expression also varied between transgenic lines carrying the same transgene copy number. These phenomena are well recognized in transgenic mice and are usually attributed to stable or variegating position effects (for a review, see Martin and Whitelaw56). Although we cannot completely exclude the possibility that different YAC transgenic lines have acquired distinct mutations or deletions of regulatory elements, the use of I-PpoI restriction sites allowed us to confirm the size of the integrated YAC in each transgenic line. Moreover, higher resolution conventional electrophoresis and Southern hybridization did not detect any rearrangements in a region of 57 kb spanning the SCL gene and including 16 kb and 20 kb of upstream and downstream sequence, respectively. Instead our results suggest that the SCL YAC does not exhibit LCR-like activity. It is possible that an SCL LCR element lies outside the YAC, but the comparative synteny data discussed above argue against this possibility. Instead, our results are consistent with the concept that the complement of regulatory elements sufficient to ensure appropriate expression of the SCL gene in its endogenous location may be inadequate to protect the gene from transcriptional constraints operating elsewhere in the genome.


    Acknowledgments

We thank Dr Clare Huxley for advice concerning YAC modification and transfer and for the plasmids pUC-OK, pUC-WAN, and pRS406. We are grateful to Prof Glenn Begley and Dr Lorraine Robb for sending us the scl knockout line, SV102, and for help with hematopoietic colony assays. We thank Dr E. Andermarcher for the IRES-nls-lacZ construct, Dr T. Enver for the rat GAPDH probe, and Dr S. Tsai for BHK-conditioned medium. We also thank Drs Andreas Schedl, Wendy Dean, and Wolf Reik for advice and assistance regarding the generation of transgenic mice.


    Footnotes

Submitted September 17, 2001; accepted January 23, 2002.

Supported by the Wellcome Trust, the Leukaemia Research Fund, the Medical Research Council, and the Pre-Leukaemia Society.

A.M.S. and A.J.B. contributed equally to this work.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Anthony R. Green, University of Cambridge, Department of Haematology, Cambridge Institute for Medical Research, Hills Rd, Cambridge, CB2 2XY, United Kingdom; e-mail: arg1000{at}cam.ac.uk.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Begley CG, Green AR. The SCL gene: from case report to critical hematopoietic regulator. Blood. 1999;93:2760-2770[Free Full Text].

2. Robb L, Elwood NJ, Elefanty AG, et al. The SCL gene product is required for the generation of all hematopoietic lineages in the adult mouse. EMBO J. 1996;15:4123-4129[Medline] [Order article via Infotrieve].

3. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57[CrossRef][Medline] [Order article via Infotrieve].

4. Green AR, De Luca E, Begley CG. Antisense SCL suppresses self-renewal and enhances spontaneous erythroid differentiation of the human leukaemic cell line K562. EMBO J. 1991;10:4153-4158[Medline] [Order article via Infotrieve].

5. Aplan PD, Nakahra K, Orkin SH, Kirsch IR. The SCL gene product: a positive regulator of erythroid differentiation. EMBO J. 1992;11:4073-4081[Medline] [Order article via Infotrieve].

6. Hoang T, Paradis E, Brady G, et al. Opposing effects of the basic helix-loop-helix transcription factor SCL on erythroid and monocytic differentiation. Blood. 1996;87:102-111[Abstract/Free Full Text].

7. Elwood NJ, Zogos H, Pereira DS, Dick JE, Begley CG. Enhanced megakaryocyte and erythroid development from normal human CD34(+) cells: consequence of enforced expression of SCL. Blood. 1998;91:3756-3765[Abstract/Free Full Text].

8. Valtieri M, Tocci A, Gabbianelli M, et al. Enforced TAL-1 expression stimulates primitive, erythroid and megakaryocytic progenitors but blocks the granulopoietic differentiation program. Cancer Res. 1998;58:562-569[Abstract/Free Full Text].

9. Visvader JE, Fujiwara Y, Orkin SH. Unsuspected role for the T-cell leukemia protein SCL/tal-1 in vascular development. Genes Dev. 1998;12:473-479[Abstract/Free Full Text].

10. Gering M, Rodaway AR, Gottgens B, Patient RK, Green AR. The SCL gene specifies haemangioblast development from early mesoderm. EMBO J. 1998;17:4029-4045[CrossRef][Medline] [Order article via Infotrieve].

11. Robertson SM, Kennedy M, Shannon JM, Keller G. A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development. 2000;127:2447-2459[Abstract].

12. Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, Zon LI. SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev. 1998;12:621-626[Abstract/Free Full Text].

13. Aplan PD, Begley CG, Bertness V, et al. The SCL gene is formed from a transcriptionally complex locus. Mol Cell Biol. 1990;10:6426-6435[Abstract/Free Full Text].

14. Begley CG, Robb L, Rockman S, et al. Structure of the gene encoding the murine SCL protein. Gene. 1994;138:93-99[CrossRef][Medline] [Order article via Infotrieve].

15. Lecointe N, Bernard O, Naert K, et al. GATA- and SP1-binding sites are required for the full activity of the tissue-specific promoter of the tal-1 gene. Oncogene. 1994;9:2623-2632[Medline] [Order article via Infotrieve].

16. Bockamp EO, McLaughlin F, Murrell AM, et al. Lineage-restricted regulation of the murine SCL/TAL-1 promoter. Blood. 1995;86:1502-1514[Abstract/Free Full Text].

17. Bockamp EO, McLaughlin F, Gottgens B, Murrell AM, Elefanty AG, Green AR. Distinct mechanisms direct SCL/tal-1 expression in erythroid cells and CD34 positive primitive myeloid cells. J Biol Chem. 1997;272:8781-8790[Abstract/Free Full Text].

18. Gottgens B, McLaughlin F, Bockamp EO, et al. Transcription of the SCL gene in erythroid and CD34 positive primitive myeloid cells is controlled by a complex network of lineage-restricted chromatin-dependent and chromatin-independent regulatory elements. Oncogene. 1997;15:2419-2428[CrossRef][Medline] [Order article via Infotrieve].

19. Sanchez M, Gottgens B, Sinclair AM, et al. An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors. Development. 1999;126:3891-3904[Abstract].

20. Sinclair AM, Gottgens B, Barton LM, et al. Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites. Dev Biol. 1999;209:128-142[CrossRef][Medline] [Order article via Infotrieve].

21. Gottgens B, Barton LM, Gilbert JG, et al. Analysis of vertebrate SCL loci identifies conserved enhancers. Nat Biotechnol. 2000;18:181-186[CrossRef][Medline] [Order article via Infotrieve].

22. Sanchez MJ, Bockamp EO, Miller J, Gambardella L, Green AR. Selective rescue of early haematopoietic progenitors in Scl-/- mice by expressing Scl under the control of a stem cell enhancer. Development. 2001;128:4815-4827[Abstract/Free Full Text].

23. Lakshmanan G, Lieuw KH, Lim KC, et al. Localization of distant urogenital system-, central nervous system-, and endocardium-specific transcriptional regulatory elements in the GATA-3 locus. Mol Cell Biol. 1999;19:1558-1568[Abstract/Free Full Text].

24. Lakshmanan G, Lieuw KH, Grosveld F, Engel JD. Partial rescue of GATA-3 by yeast artificial chromosome transgenes. Dev Biol. 1998;204:451-463[CrossRef][Medline] [Order article via Infotrieve].

25. Lim KC, Lakshmanan G, Crawford SE, Gu Y, Grosveld F, Engel JD. Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system. Nat Genet. 2000;25:209-212[CrossRef][Medline] [Order article via Infotrieve].

26. Moore AW, McInnes L, Kreidberg J, Hastie ND, Schedl A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 1999;126:1845-1857[Abstract].

27. Slee R, Grimes B, Speed RM, et al. A human DAZ transgene confers partial rescue of the mouse Dazl null phenotype. Proc Natl Acad Sci U S A. 1999;96:8040-8045[Abstract/Free Full Text].

28. Bedell MA, Brannan CI, Evans EP, Copeland NG, Jenkins NA, Donovan PJ. DNA rearrangements located over 100 kb 5' of the Steel (Sl)-coding region in Steel-panda and Steel-contrasted mice deregulate Sl expression and cause female sterility by disrupting ovarian follicle development. Genes Dev. 1995;9:455-470[Abstract/Free Full Text].

29. Loots GG, Locksley RM, Blankespoor CM, et al. Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons. Science. 2000;288:136-140[Abstract/Free Full Text].

30. Anand R, Riley JH, Butler R, Smith JO, Markham F. A 3.5 genome equivalent multi access YAC library: construction, characterisation, screening and storage. Nucl Acids Res. 1990;18:1951-1956[Abstract/Free Full Text].

31. Larin Z, Monaco AP, Lehrach H. Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc Natl Acad Sci U S A. 1991;88:4123-4127[Abstract/Free Full Text].

32. Chumakov IM, Le Gall I, Billaut A, et al. Isolation of chromosome 21-specific yeast artificial chromosomes from a total human genome library. Nature. 1992;359:380-386[CrossRef][Medline] [Order article via Infotrieve].

33. Ragoussis J. Restriction analysis of YACs. In: Markie D, ed. YAC Protocols. Vol 54. Methods in Molecular Biology. Totowa, NJ: Humana Press; 1995:69-74.

34. Silverman G. Purification of YAC-containing total yeast DNA. In: Markie D, ed. YAC Protocols. Vol 54. Totowa, NJ: Humana Press; 1996:65-68.

35. Bench AJ, Aldred MA, Humphray SJ, et al. A detailed physical and transcriptional map of the region of chromosome 20 that is deleted in myeloproliferative disorders and refinement of the common deleted region. Genomics. 1998;49:351-362[CrossRef][Medline] [Order article via Infotrieve].

36. Asimakopoulos FA, Holloway TL, Nacheva EP, Scott MA, Fenaux P, Green AR. Detection of chromosome 20q deletions in bone marrow metaphases but not peripheral blood granulocytes in patients with myeloproliferative disorders or myelodysplastic syndromes. Blood. 1996;87:1561-1570[Abstract/Free Full Text].

37. Larin Z, Monaco AP, Lehrach H. Generation of large insert YAC libraries. In: Markie D, ed. YAC Protocols. Vol 54. Methods in Molecular Biology. Totowa, NJ: Humana Press; 1995:1-11.

38. Fairhead C, Heard E, Arnaud D, Avner P, Dujon B. Insertion of unique sites into YAC arms for rapid physical analysis following YAC transfer into mammalian cells. Nucl Acids Res. 1995;23:4011-4012[Free Full Text].

39. Duff K, Huxley C. Targeting mutations to YACs by homologous recombination. In: Markie D, ed. YAC Protocols. Vol 54. Methods in Molecular Biology. Totowa, NJ: Humana Press; 1995:187-198.

40. Cole CG, Collins JE, Dunham I. YAC library screening. In: Markie D, ed. YAC Protocols. Vol 54. Methods in Molecular Biology. Totowa, NJ: Humana Press; 1995:23-47.

41. Altschul SF, Gish W, Miller W, Meyers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410[CrossRef][Medline] [Order article via Infotrieve].

42. Schedl A, Grimes B, Montoliu L. YAC transfer by microinjection. In: Markie D, ed. YAC Protocols. Vol 54. Methods in Molecular Biology. Totowa, NJ: Humana Press; 1995:293-306.

43. Hogan B, Beddington R, Costantini F, Lacy E. Manipulating the mouse embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1994.

44. Miles C, Sanchez MJ, Sinclair A, Dzierzak E. Expression of the Ly-6E.1 (Sca-1) transgene in adult hematopoietic stem cells and the developing mouse embryo. Development. 1997;124:537-547[Abstract].

45. Robb L, Lyons I, Li R, et al. Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci U S A. 1995;92:7075-7079[Abstract/Free Full Text].

46. Begley CG, Visvader J, Green AR, et al. Molecular cloning and chromosomal localisation of the murine homolog of the human "helix-loop-helix" gene SCL. Proc Natl Acad Sci U S A. 1991;88:869-873[Abstract/Free Full Text].

47. Gonda TJ, Sheiness DK, Bishop JM. Transcripts from the cellular homologs of retroviral oncogenes: distribution among chicken tissues. Mol Cell Biol. 1982;2:617-624[Abstract/Free Full Text].

48. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.

49. Murrell AM, Bockamp E-O, Göttgens B, et al. Discordant regulation of SCL/TAL-1 mRNA and protein during erythroid differentiation. Oncogene. 1995;11:131-139[Medline] [Order article via Infotrieve].

50. Harlow E, Lane D. Using Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1999.

51. Metcalf DM. The Hemopoietic Colony Stimulating Factors. Amsterdam, The Netherlands: Elsevier; 1984.

52. Kaiho SI, Mizuno K. Sensitive assay systems for detection of hemoglobin with 2,7-diaminofluorene: histochemistry and colorimetry for erythrodifferentiation. Anal Biochem. 1985;149:117-120[CrossRef][Medline] [Order article via Infotrieve].

53. Aplan PD, Lombardi DP, Kirsch IR. Structural characterization of SIL, a gene frequently disrupted in T-cell acute lymphoblastic leukemia. Mol Cell Biol. 1991;11:5462-5469[Abstract/Free Full Text].

54. Green AR, Visvader J, Lints T, Harvey R, Begley CG. SCL is co-expressed with GATA-1 in haemopoietic cells but is also expressed in developing brain. Oncogene. 1992;7:653-660[Medline] [Order article via Infotrieve].

55. Elefanty AG, Begley CG, Hartley L, Papaevangeliou B, Robb L. SCL expression in the mouse embryo detected with a targeted lacZ reporter gene demonstrates its localization to hematopoietic, vascular, and neural tissues. Blood. 1999;94:3754-3763[Abstract/Free Full Text].

56. Martin DI, Whitelaw E. The vagaries of variegating transgenes. Bioessays. 1996;18:919-923[CrossRef][Medline] [Order article via Infotrieve].

57. Guy LG, Kothary R, DeRepentigny Y, Delvoye N, Ellis J, Wall L. The beta -globin locus control region enhances transcription of but does not confer position-independent expression onto the lacZ gene in transgenic mice. EMBO J. 1996;15:3713-3721[Medline] [Order article via Infotrieve].

58. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukemia oncoprotein tal-1/SCL. Nature. 1995;373:432-434[CrossRef][Medline] [Order article via Infotrieve].

59. Green AR, Salvaris E, Begley CG. Erythroid expression of the "helix-loop-helix" gene, SCL. Oncogene. 1991;6:475-479[Medline] [Order article via Infotrieve].

60. Visvader J, Begley CG, Adams JM. Differential expression of the LYL, SCL and E2A helix-loop-helix genes within the hemopoietic system. Oncogene. 1991;6:195-204[Medline] [Order article via Infotrieve].

61. Gottgens B, Gilbert JG, Barton LM, et al. Long-range comparison of human and mouse SCL loci: localized regions of sensitivity to restriction endonucleases correspond precisely with peaks of conserved noncoding sequences. Genome Res. 2001;11:87-97[Abstract/Free Full Text].

62. Barton LM, Gottgens B, Gering M, et al. Regulation of the stem cell leukemia (SCL) gene: a tale of two fishes. Proc Natl Acad Sci U S A. 2001;98:6747-6752[Abstract/Free Full Text].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GENES CELLSHome page
S. Unezaki, R. Horai, K. Sudo, Y. Iwakura, and S. Ito
Ovol2/Movo, a homologue of Drosophila ovo, is required for angiogenesis, heart formation and placental development in mice
Genes Cells, June 1, 2007; 12(6): 773 - 785.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Delabesse, S. Ogilvy, M. A. Chapman, S. G. Piltz, B. Gottgens, and A. R. Green
Transcriptional Regulation of the SCL Locus: Identification of an Enhancer That Targets the Primitive Erythroid Lineage In Vivo
Mol. Cell. Biol., June 15, 2005; 25(12): 5215 - 5225.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
M. A. Chapman, I. J. Donaldson, J. Gilbert, D. Grafham, J. Rogers, A. R. Green, and B. Gottgens
Analysis of Multiple Genomic Sequence Alignments: A Web Resource, Online Tools, and Lessons Learned From Analysis of Mammalian SCL Loci
Genome Res., February 1, 2004; 14(2): 313 - 318.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sinclair, A. M.
Right arrow Articles by Green, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sinclair, A. M.
Right arrow Articles by Green, A. R.
Related Collections
Right arrow Hematopoiesis and Stem Cells
Right arrow Gene Expression
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020