|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the University of Cambridge, Department of
Haematology, Cambridge Institute for Medical Research, Hills Road,
Cambridge, CB2 2XY, United Kingdom.
The stem cell leukemia (SCL) gene encodes a
basic helix-loop-helix transcription factor with a critical role in the
development of both blood and endothelium. Loss-of-function studies
have shown that SCL is essential for the formation of hematopoietic
stem cells, for subsequent erythroid development and for yolk sac
angiogenesis. SCL exhibits a highly conserved pattern of
expression from mammals to teleost fish. Several murine SCL
enhancers have been identified, each of which directs reporter gene
expression in vivo to a subdomain of the normal SCL expression pattern.
However, regulatory elements necessary for SCL expression in erythroid
cells remain to be identified and the size of the chromosomal domain
needed to support appropriate SCL transcription is unknown.
Here we demonstrate that a 130-kilobase (kb) yeast artificial
chromosome (YAC) containing the human SCL locus
completely rescued the embryonic lethal phenotype of
scl The stem cell leukemia (SCL)
gene (also known as TAL-1) encodes a basic helix-loop-helix
(bHLH) transcription factor with an essential role in the development
of both blood and endothelial cells.1 Mice lacking a
functional SCL protein failed to develop yolk sac hematopoiesis and
blastocyst reconstitution experiments have demonstrated that SCL is
required for both definitive and primitive
hematopoiesis.2,3 These data suggest that SCL plays a
pivotal role in the formation or behavior of hematopoietic stem cells
and are consistent with the observation that expression of antisense
SCL suppressed the proliferation, cell cycle progression, and
self-renewal of a multipotent hematopoietic cell line.4 SCL is likely to perform additional functions following lineage commitment because enforced SCL expression enhanced erythroid differentiation of hematopoietic cell lines5,6 and
increased erythroid and megakaryocytic differentiation of normal
CD34+ progenitors.7,8
Several lines of evidence demonstrate that SCL is critical for normal
endothelial development. scl knockout mice exhibit defective yolk sac angiogenesis thought to reflect an essential function for SCL
during vessel formation.9 SCL is also likely to play an
earlier role during the formation of endothelial cells. In zebrafish
and in murine embryonic stem (ES) cell systems, SCL is
expressed in hemangioblasts, bipotent progenitors of blood and
endothelium.10,11 Moreover, SCL expression can
partially rescue both blood and endothelial defects of the zebrafish
cloche mutant12 and ectopic expression of SCL
during early development alters the fate of mesodermal cells, resulting
in excessive hemangioblast formation at the expense of several other
cell types.10
Current evidence therefore suggests that SCL is essential for
establishing the transcriptional program necessary for the formation of
hemangioblasts and subsequently hematopoietic stem cells. It is
also clear that transcriptional dysregulation of the scl
gene has profound consequences. These observations emphasize the
fundamental biologic significance of the mechanisms that regulate
SCL transcription and our laboratory has therefore
undertaken a systematic analysis of the transcriptional regulation of
the murine scl locus.
Both human and murine SCL are transcribed from 2 lineage-specific promoters.13-17 A survey of the chromatin
structure surrounding the murine scl gene has also revealed
a panel of DNase I hypersensitive sites associated with enhancer or
silencer activity in transfection assays.18 Transgenic
reporter assays have so far identified 5 independent enhancers each of
which targets expression to a specific subdomain of the normal SCL
expression pattern.19-21 A 3' enhancer is of particular
interest because it targets expression to the vast majority of
hematopoietic progenitors and long-term repopulating hematopoietic stem
cells.19,22
However, additional elements remain to be identified and the size of
the chromosomal domain that contains all of the scl gene regulatory elements remains unknown. This issue is particularly important given the mounting evidence for the existence of long-range regulatory elements at a number of mammalian loci. Yeast artificial chromosomes (YACs) spanning 120 kilobase (kb), 540 kb, or 625 kb of the Gata-3 locus were unable to completely rescue the
pattern of endogenous Gata-3 expression23 and also failed
to overcome embryonic lethality in Gata-3 In this paper we demonstrate that a 130-kb YAC containing the human
SCL locus completely rescues the lethal phenotype of
scl Isolation and modification of a human SCL YAC
YAC 4HD12 was retrofitted by spheroplast transformation37
to incorporate I-PpoI sites into each YAC arm firstly with
plasmid pUC-OK and subsequently with pUC-WAN.38 The
efficiency of transformation was 5% and 3%, respectively. After each
transformation, high-molecular-weight yeast DNA plugs were prepared
from at least 10 individual transformants. Pulsed field gel
electrophoresis (PFGE) followed by Southern hybridization confirmed the size of the modified YAC was unchanged.
To monitor expression from the human SCL locus, an internal
ribosomal entry site (IRES) (from encephalomyocarditis virus) nuclear
localized (nls) lacZ reporter (kindly provided by E. Andermarcher) was
cloned into the NcoI site within the 3' UTR of human
SCL. This construct was cloned into the yeast integrating
vector, pRS406 (Stratagene, La Jolla, CA), which contains the URA3
selectable marker, to form plasmid p5'lacZ3'. This plasmid was
integrated into the modified YAC using Pop-In/Pop-Out
technology.39 The YAC was retrofitted with linearized
p5'lacZ3' by spheroplast transformation (Pop-In). Total yeast/YAC DNA
was prepared from 25 Ura+ Trp+ Lys+
transformants, digested with BglII and HindIII
and sequentially hybridized to the 3' probe and the lacZ reporter gene
by Southern analysis. The correct pattern was observed in 4 of 25 transformants. Integrity of the YAC was demonstrated by PFGE and
Southern hybridization.
To generate transformants without vector sequence but containing 3' UTR
with IRES-nls-lacZ (Pop-Out), one transformant was grown in a selection
medium containing uracil. The culture was plated onto agar supplemented
with 1 mg/mL 5-fluoro-orotic acid (5-FOA) to select against colonies
containing the URA3 gene. Fifty-seven of 78 Ura To determine the 5' and 3' limits of genomic DNA contained within clone
4HD12, the YAC ends were rescued by digesting 100 ng 4HD12 YAC DNA with
HaeIII and self-ligating at a low concentration (1 ng/µL).
Then, 2 ng of this ligated product was amplified by inverted polymerase
chain reaction (PCR), using the following primers: YAC left arm; sense
CGCAAGACTTTAATTTATCACTAC and antisense TAGTCGATAGTGGCTCCAAGTAGC; YAC
right arm; sense TGGATCCTCTACGCCGGACGCATC and antisense
AGTCGAACGCCCGATCTCAA. The resulting products were cloned into pGEM-T
vector (Promega, Southampton, United Kingdom) and sequenced. Sequences
were compared with sequences in GenBank using BLAST.41
Generation of transgenic mice
Pronuclear injections were performed into CBA/C57.Bl6 fertilized mouse
oocytes that were allowed to divide to 2 cells prior to implantation
into the oviducts of pseudopregnant CD1 female mice.43 At
2 weeks of age tail DNA was prepared from founder mice and multiplex
PCR analysis was performed to detect lacZ using myogenin as an internal
control.44 Founder mice were subsequently backcrossed onto
CBA/C57.Bl6 F1 mice to maintain the transgenic lines. In the case of
scl Southern analysis of transgenic mice Copy number quantification of the YAC transgene was performed by digesting 10 µg tail DNA from F2 mice with EcoRI followed by Southern hybridization to equimolar concentrations of size-matched (1.9 kb) probes for the 3'UTR of the endogenous scl (mouse specific) and lacZ (transgene specific). Signal from the lacZ gene was quantified with respect to the 2 copy endogenous scl signal on a Molecular Dynamics PhosphorImager (Kemsing, Kent, United Kingdom). The 3' UTR probe was a 1.9-kb KpnI/BglII fragment from the murine scl complementary DNA (cDNA)46 and the lacZ probe was a 1.9-kb BamHI/SacI fragment from the IRESnlslacZ construct.Single-cell suspensions were made from the spleens of YAC transgenic mice and were washed once in phosphate-buffered saline (PBS). Cells were resuspended at 2 × 107 cells/mL in PBS at room temperature. Equal volumes of cells and 2% agarose (made up in PBS and equilibrated to 40°C) were mixed and dispensed into chilled plug molds on ice. Plugs were lysed in the same way as for high-molecular-weight yeast plugs,33 washed twice with 24 mM EDTA, 0.5 mM Tris, 1.8 mM N-laurylsarcosine (pH 9.5) for 2 hours at room temperature and stored at 4°C in this buffer. High-molecular-weight DNA was digested in situ with I-PpoI (Promega) in the same manner as described above.33 Transgene integrity was determined by Southern blot analysis of tail
DNA from F2 transgenic mice. Restriction digests and probes (as shown
in Figure 1) were as follows: L-arm,
EcoRI digest of genomic (various sizes detected as extends
from L-arm into integration site) and hybridized with a 4-kb
AvaI fragment from plasmid pUC-WAN spanning neo
and TRP1; fragment 1, BamHI digest to yield a
15.7-kb fragment (29141-44906 in human SCL locus, GenBank accession no.
AJ131016) when hybridized with a promoter 1a probe (44447-44647);
fragment 2, BglII digest to yield an 11.6-kb fragment when
hybridized with an intron 3 probe (49261-49281); fragment 3, BamHI digest to yield a 2.3- kb fragment when hybridized with an exon 4 probe (380-bp NotI/NaeI fragment
from mouse scl cDNA); fragment 4, EcoRI digest to
yield a 6.2-kb fragment (53539-lacZ gene) when hybridized with an
intron 5 probe (54949-54967); fragment 5, EcoRI digest to
yield a 3.6-kb fragment of the lacZ gene when hybridized with a lacZ
probe (1.9-kb BamHI/SacI fragment); fragment 6, HindIII digest to yield a 16-kb fragment (lacZ-74500) when hybridized with a 3'UTR probe (600-bp fragment from
BglII/KpnI digest of human SCL cDNA);
fragment 7, BglII digest to yield a 10-kb fragment
(72347-82005) when hybridized with a downstream probe (73182-73524);
R-arm, EcoRI digest to yield fragments of varying sizes
(extending from R-arm into integration site) when hybridized with a
6.3-kb AatII/TthIII I fragment from plasmid pUC-OK spanning the LYS2 gene. The promoter 1a, intron 3, intron 5, and downstream probes were generated by PCR from human
genomic DNA.
Northern blot analysis Poly (A)+ RNAs were isolated from fetal liver as described.47 RNA samples (4 µg) were size fractionated by electrophoresis on a 1% agarose gel containing 0.6% formaldehyde in 1 times 3-[N-Morpholino]propanesulphonic acid (MOPS) (20 mM MOPS, 1 mM EDTA, 5 mM sodium acetate) running buffer, transferred to a nylon membrane (Hybond N+; Amersham Pharmacia Biotech, Bucks, United Kingdom) and hybridized with a 32P-labeled nlslacZ probe (1.9-kb BamHI/SacI fragment) by standard techniques.48 After hybridization and autoradiography with the nlslacZ probe, the filter was stripped and reprobed with a 3'UTR mouse scl probe (1.9 -b BglII/KpnI fragment) and a rat GAPDH probe (kindly provided by T. Enver).Generation of SCL antisera, immunoprecipitation, and Western analysis A peptide corresponding to the C-terminus of murine SCL was used to generate polyclonal SCL specific sheep antisera. The antisera obtained was affinity purified using the immunizing peptide and subsequently precleared using a protein extract from the SCL negative cell line BW5147.
Cellular extracts were prepared by suspension in immunoprecipitation
buffer (1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 1 mM EDTA, 1 mM
EGTA, 10 mM Tris-Cl pH 8.0) for 10 minutes on ice, and subsequently
passing several times through a 20-gauge needle. For
immunoprecipitation, 5 µL rabbit antimouse SCL49 or
rabbit serum was added to lysates obtained from a single fetal liver (YAC Analysis of blood Blood was taken from age-matched (8-14 weeks old) control (2 males, 4 females) and rescued (1 male, 3 females) mice by cardiac puncture. Blood counts were performed using an Animal Blood Counter (ABX Hematologie, Montpellier, France). Cell morphology was assessed on May-Grünwald-Giemsa-stained blood smears.Flow cytometry Bone marrow, fetal liver, splenocytes, and thymocytes were harvested in PBS containing 5% fetal calf serum (FCS) and 0.01% sodium azide. Cells (1 × 106) were stained with the appropriate antibody for cell surface antigens on ice for 30 minutes prior to analysis on a FACSsort flow cytometer (Becton Dickinson, San Jose, CA). Dead cells were excluded by propidium iodide (PI) staining and by gating out cells with low forward and side scatter. Monoclonal antibodies were from Pharmingen (San Diego, CA) and included anti-c-kit (2B8), anti-CD34 (RAM34), anti-MAC-1 (M1/70), anti-Gr-1 (RB6-8C5), anti-Ter119 (TER119), anti-CD61 (2C9.G2), anti-B220 (RA3-6B2), anti-CD4 (H129.19), and anti-CD8 (53-6.7). In some instances incubation with streptavidin-phycoerythrin or streptavidin-fluorescein isothiocyanate (Pharmingen) was required for biotin-conjugated antibodies.In vitro colony-forming assays for progenitors Bone marrow cells were seeded at 5 × 104 cells/plate containing 0.3% agar in Iscoves modified Dulbecco medium (IMDM; Gibco, Invitrogen, Paisley, United Kingdom) supplemented with 25% FCS and cytokines (interleukin 3 [IL-3], stem cell factor [SCF], thrombopoietin [Tpo]) for myeloid colony formation51 or in Methocult GF-M3434 methylcellulose (Stem Cell Technologies, Vancouver, BC, Canada) for erythroid and myeloid colony formation. Agar cultures were supplemented with conditioned medium from the BHK cell line (a kind gift from S. Tsai) containing SCF and WEHI 3B cell line conditioned medium as a source of IL-3,51 or with 2 ng/mL recombinant IL-3 and Tpo (R & D Systems, Abingdon, United Kingdom). Duplicate agar and triplicate Methocult cultures were incubated at 37°C in a humidified atmosphere of 5% CO2 and colonies were scored after 7 days of culture.Yolk sacs from day 8.5 embryos were separated from the embryo proper, which was subsequently used for genotype analysis by PCR as described previously. The individual yolk sacs were placed in 1 mL PBS containing 20% FCS and passed through 26- and 30-gauge needles to obtain a single-cell suspension. All cells were centrifuged and resuspended in 100 µL IMDM and seeded into 1 mL Methocult GF-M3434 methylcellulose and were cultured in a fully humidified atmosphere of 5% CO2 for 7 days prior to scoring. To confirm that erythroid colonies were hemoglobinized 2,7-diaminofluorene (Sigma-Aldrich) staining was performed at 9 days of culture.52
Isolation and characterization of a human SCL YAC A YAC clone, 4HD12, containing the human SCL gene was isolated from the ICI human YAC library by colony hybridization. FISH with the YAC identified signals only at chromosome 1p32 consistent with the location of the SCL locus (data not shown). PFGE followed by Southern hybridization indicated the YAC was approximately 130 kb in size (Figure 1A and data not shown). Restriction digestion of YAC DNA with BamHI, EcoRI, HindIII, or SacI followed by Southern hybridization with 5' and 3' SCL probes demonstrated that the SCL locus within the YAC was intact and long-range restriction mapping with NotI, SalI, and SfiI indicated that the SCL gene lay within the middle of the YAC (Figure 1A and data not shown). To determine the 5' and 3' limits of the clone, the end fragments were rescued by inverted PCR and sequenced. Comparison with the sequence of an SCL PAC clone (GenBank accession number AJ131016)21 demonstrated that the 3' end of the YAC insert was located 36 kb downstream of the MAP17 transcriptional start site. The genomic sequence adjacent to the left YAC arm was found to be identical to exon 11 of human SIL (GenBank accession number AF349650). An EcoRI site lies 200 to 300 bp upstream of human SIL exon 1153 and the YAC library was generated by a partial EcoRI digest. These data indicate that this EcoRI site marks the 5' end of the YAC insert and that the size of the insert is therefore 131 kb.To allow rapid assessment of YAC-transgene integrity in transgenic mice, I-PpoI restriction sites were inserted into both arms of the YAC.38 To facilitate analysis of human SCL expression in transgenic mice, an IRES-lacZ cassette was inserted into the 3' UTR of exon 6 of the human SCL gene (Figure 1A). Modified YAC clones were analyzed by PFGE and Southern hybridization at each stage of the modification. After modification and confirmation, purified high-molecular-weight YAC DNA was prepared and microinjected into oocytes. Transgenic founders were screened by PCR for the presence of the transgene. From a total of 161 offspring, 5 transgenic founders were identified (2037, 2054, 2074, 2083, and 2133). Southern blot analysis was performed to assess transgene copy number. Line 2083 was found to contain approximately 13 copies of the human SCL YAC, whereas all other lines contained approximately 2 copies of the transgene (Figure 1B). Pulsed field gel electrophoresis and Southern hybridization were performed to assess the structure of the integrated YAC in each transgenic line (data not shown). Lines 2054, 2083, and 2133 each gave rise to a band of the expected size (130 kb) demonstrating an absence of major genomic rearrangements. A band of approximately 90 kb was observed in line 2037 suggesting the presence of a 40-kb deletion. Line 2074 gave rise to a band that comigrated with high-molecular-weight genomic DNA, consistent with loss of one or both I-PpoI sites. A more detailed Southern analysis was then performed of a 57-kb region
surrounding and including the human SCL gene (Figure 1A,
Table 1, and data not shown). Consistent
with the PFGE results, line 2037 contained a large deletion, which
removed SCL exons 1a to 5. However, the human SCL
exon/intron structure was intact in the remaining 4 transgenic lines
and all of these contained unrearranged flanking sequence extending 16 kb upstream and 20 kb downstream of the human SCL gene.
Expression of the human SCL transgene To assess expression of the human SCL gene, X-gal staining was performed on E12.5 and E13.5 embryos from all YAC transgenic lines. At these time points SCL is known to be expressed in the yolk sac, fetal liver, and central nervous system.54,55 Control transgenic embryos carrying a 7E3/lacZ murine scl transgene20 gave
appropriate X-gal staining. However, no staining was observed in
embryos from any of the YAC transgenic lines, even after 48 hours of
incubation at 37°C.
To determine whether the fusion gene was transcribed, Northern blot
analysis was performed on E14.5 fetal liver, which is known to express
readily detectable levels of murine scl messenger RNA
(mRNA)54 (Figure 2). No
expression of the transgene was detected in line 2037 consistent with
the Southern blot data demonstrating deletion of SCL 5'
exons in this line. Human SCL transcripts were detected in
the 4 remaining transgenic lines. These data therefore further suggest
that the failure to detect lacZ expression by X-gal staining was likely
to reflect a defect in lacZ translation, probably related to the
specific IRES sequence that was used. Lines 2074 and 2133 both
contained 2 copies of the transgene but exhibited markedly different
levels of transgene expression, suggesting that the human
SCL gene is subject to stable or variegating position effects.56 Line 2083 contained 13 copies of the transgene
but displayed a level of transgene expression similar to line 2133, which only contained 2 copies, thus demonstrating an absence of copy
number-dependent expression. These results suggest that either the
human SCL locus does not have a locus control region
(LCR)-like element or that such an element exists but is not contained
within the 130-kb transgene. It is also possible that the presence of lacZ may have rendered the transgene particularly susceptible to
position effects.57
The human SCL YAC rescues the scl / embryos die at approximately
E9.0 as a consequence of defective yolk sac hematopoiesis and
angiogenesis.9,45,55,58 To assess whether the human
SCL YAC could rescue the scl/
phenotype, YAC transgenic lines 2133, 2054, and 2074 were bred with
scl+/ mice. Offspring were typed by PCR for
the presence of the human SCL transgene and for the murine
scl and scl+ alleles.
Compound heterozygotes (YAC+scl+/)
were intercrossed and viable offspring were typed by PCR (Figure 3 and Table
2). As expected, no
scl/ offspring lacking the human
SCL YAC were identified. By contrast all 3 YAC transgenic
lines gave rise to viable scl/ offspring
that carried the human SCL YAC (Figure 3 and Table 2). These
YAC+scl/ offspring were found in
the expected Mendelian frequency, were indistinguishable from their
littermates (up to 8 months of age) and were fertile. The total number
of YAC+scl/ mice followed for 2 to 8 months were 37 (line 2054), 25 (line 2074), and 12 (line 2133). In
addition, a further 23 (line 2054), 4 (line 2074), and 17 (line 2133)
were followed for 8 to 16 months.
To assess the level of human SCL protein in rescued
YAC+scl
Rescued scl /
embryos comprises a complete absence of hematopoiesis. A detailed
analysis of adult and embryonic hematopoiesis in rescued
YAC+scl/ mice was therefore
performed. Analysis of peripheral blood demonstrated that adult
YAC+scl/ mice had normal
hemoglobin levels together with normal platelet, white cell, and
differential counts (Table 3). Inspection
of peripheral blood smears did not reveal any morphologic abnormalities (data not shown).
Flow cytometry was used to assess the spectrum of hematopoietic cells
present in adult bone marrow, spleen, thymus, and fetal liver
(Table 4). A panel of antibodies
recognizing markers present on progenitors (c-kit, CD34), monocytes
(Mac1), granulocytes (Gr-1), erythroid cells (Ter119), megakaryocytes
(CD61), mast cells (IgE/anti-IgE), B cells (B220), and T cells (CD4,
CD8) was used. Percentages of double-negative and double-positive
thymocytes were also assessed, as were percentages of
c-kit+ and Ter119+ cells in E11.5 and E12.5
fetal livers. No significant differences were obtained between control
(YAC+scl+/
Colony assays were used to investigate whether more subtle
defects were present in the progenitor compartment. The numbers of
myeloid and erythroid colonies present in adult bone marrow were the
same in rescued YAC+scl
In addition to an absence of hematopoiesis,
scl These data therefore demonstrate that the human SCL YAC
completely rescues the lethal scl
We demonstrate here that the human SCL locus can rescue
the lethal phenotype of scl The SCL gene is expressed in a subset of blood cells (progenitors, erythroid, mast, and megakaryocytic lineages), endothelial cells, and specific regions of the brain and spinal cord. This pattern of expression is highly conserved throughout vertebrate evolution from zebrafish to mammals.1,10,12,20,55 Systematic analysis of the murine scl locus has identified a series of independent enhancers, each of which directs reporter gene expression to a subdomain of the normal SCL expression pattern.18-21 Of particular interest is a 3' enhancer that directs expression to blood and endothelial progenitors throughout ontogeny19 and also to long-term repopulating hematopoietic stem cells.22 However additional elements remain to be identified because this 3' enhancer is the only hematopoietic element identified so far and it does not direct expression to Ter119+ erythroid cells.19 By contrast the endogenous SCL gene is expressed in erythroid cells,54,55,59,60 thus suggesting that maintenance of SCL expression during erythroid differentiation is mediated by an as yet unidentified enhancer. Comparative genomic sequence analysis of the murine and human SCL loci have identified a number of peaks of homology that do not correspond to known enhancers and that therefore represent candidates for additional regulatory elements.61 Previous attempts to rescue the scl SCL is known to be essential for the formation of hematopoietic stem
cells,2,3 for subsequent erythroid
differentiation,22 and for yolk sac
angiogenesis.9 SCL may also play an essential role in
other tissues including midbrain, hindbrain, spinal cord, and
intraembryonic endothelium, but analysis has been precluded by the
early embryonic lethality of scl This notion is consistent with comparative synteny data. We have previously characterized and sequenced the SCL genomic loci from human, mouse, chicken, and pufferfish and have found that the genes immediately flanking pufferfish SCL were unrelated to those known to flank both avian and mammalian SCL genes.21,61,62 In view of the conserved pattern of SCL expression between mammals and teleost fish, these results implied that SCL regulatory elements might be confined to the region between the upstream and downstream flanking genes. Moreover, a 10.4-kb fragment of pufferfish genomic DNA, containing the SCL gene and extending to the 5' and 3' flanking genes, directed appropriate expression to hematopoietic and neural tissue in transgenic zebrafish embryos.62 Our current results accord with these data because the human SCL YAC contains the entire SCL locus extending to both upstream (SIL) and downstream (MAP17) genes. Interestingly, the human SCL YAC did not give rise to copy number-dependent expression and the levels of transgene expression also varied between transgenic lines carrying the same transgene copy number. These phenomena are well recognized in transgenic mice and are usually attributed to stable or variegating position effects (for a review, see Martin and Whitelaw56). Although we cannot completely exclude the possibility that different YAC transgenic lines have acquired distinct mutations or deletions of regulatory elements, the use of I-PpoI restriction sites allowed us to confirm the size of the integrated YAC in each transgenic line. Moreover, higher resolution conventional electrophoresis and Southern hybridization did not detect any rearrangements in a region of 57 kb spanning the SCL gene and including 16 kb and 20 kb of upstream and downstream sequence, respectively. Instead our results suggest that the SCL YAC does not exhibit LCR-like activity. It is possible that an SCL LCR element lies outside the YAC, but the comparative synteny data discussed above argue against this possibility. Instead, our results are consistent with the concept that the complement of regulatory elements sufficient to ensure appropriate expression of the SCL gene in its endogenous location may be inadequate to protect the gene from transcriptional constraints operating elsewhere in the genome.
We thank Dr Clare Huxley for advice concerning YAC modification and transfer and for the plasmids pUC-OK, pUC-WAN, and pRS406. We are grateful to Prof Glenn Begley and Dr Lorraine Robb for sending us the scl knockout line, SV102, and for help with hematopoietic colony assays. We thank Dr E. Andermarcher for the IRES-nls-lacZ construct, Dr T. Enver for the rat GAPDH probe, and Dr S. Tsai for BHK-conditioned medium. We also thank Drs Andreas Schedl, Wendy Dean, and Wolf Reik for advice and assistance regarding the generation of transgenic mice.
Submitted September 17, 2001; accepted January 23, 2002.
Supported by the Wellcome Trust, the Leukaemia Research Fund, the Medical Research Council, and the Pre-Leukaemia Society.
A.M.S. and A.J.B. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Anthony R. Green, University of Cambridge, Department of Haematology, Cambridge Institute for Medical Research, Hills Rd, Cambridge, CB2 2XY, United Kingdom; e-mail: arg1000{at}cam.ac.uk.
1.
Begley CG, Green AR.
The SCL gene: from case report to critical hematopoietic regulator.
Blood.
1999;93:2760-2770 2. Robb L, Elwood NJ, Elefanty AG, et al. The SCL gene product is required for the generation of all hematopoietic lineages in the adult mouse. EMBO J. 1996;15:4123-4129[Medline] [Order article via Infotrieve]. 3. Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell. 1996;86:47-57[CrossRef][Medline] [Order article via Infotrieve]. 4. Green AR, De Luca E, Begley CG. Antisense SCL suppresses self-renewal and enhances spontaneous erythroid differentiation of the human leukaemic cell line K562. EMBO J. 1991;10:4153-4158[Medline] [Order article via Infotrieve]. < |
/
Top
Abstract
Introduction
