Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kenny, D.
Right arrow Articles by Montgomery, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kenny, D.
Right arrow Articles by Montgomery, R. R.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 June 2002, Vol. 99, No. 12, pp. 4428-4433

HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY

The cysteine knot of platelet glycoprotein Ibbeta (GPIbbeta ) is critical for the interaction of GPIbbeta with GPIX

Dermot Kenny, Patricia A. Morateck, and Robert R. Montgomery

From the Blood Research Institute, the Blood Center of Southeastern Wisconsin, Milwaukee; Departments of Medicine and Pediatrics, Medical College of Wisconsin, Milwaukee; and the Royal College of Surgeons in Dublin, Ireland.


    Abstract
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The glycoprotein Ib (GPIb) complex is composed of GPIbalpha covalently attached to GPIbbeta and noncovalently complexed with GPIX and GPV. Patients with Bernard-Soulier syndrome demonstrate that mutations in either GPIbbeta or GPIX result in an absence of platelet GPIbalpha . This occurs through the interaction of GPIX with GPIbbeta . The precise sites of interaction of GPIbbeta with GPIX are not known. To characterize the interaction of GPIbbeta and GPIX, we developed an anti-GPIbbeta monoclonal antibody MBC 257.4, whose epitope was in the N-terminal region of GPIbbeta . N-terminal truncations of GPIbbeta were expressed in mammalian cells. N-terminal truncations of GPIbbeta , missing the first 14, 26, or 31 amino acids, were surface-expressed but did not enable coexpressed GPIX to be surface expressed, suggesting that the site of interaction with GPIX was modified by these deletions. GPIbbeta and GPIX chimeras corresponding to predicted boundaries were used to define the sites of interaction of GPIbbeta with GPIX. Replacing the N-terminal disulfide loops of GPIbbeta (amino acids 1-14) with the corresponding disulfide loops of GPIX (amino acids 1-22) resulted in surface expression of coexpressed wildtype GPIX. However, when the N terminus of GPIbbeta was replaced to residue 32 with the N terminus of GPIX (amino acids 1-36), GPIX did not surface express with this chimera. These results suggest that the cysteine knot region of GPIbbeta in the N terminus is critical for the conformation of GPIbbeta that interacts with GPIX and further suggests that a critical interaction of GPIbbeta with GPIX involve residues 15 through 32 of GPIbbeta . (Blood. 2002;99:4428-4433)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The platelet membrane glycoprotein Ib-IX-V (GPIb-IX-V) complex has a critical role in platelet adhesion mediating hemostasis. The complex is composed of 4 type 1 membrane-spanning proteins: GPIbalpha , GPIbbeta , GPIX, and GPV. Each of these glycoproteins is encoded by a single copy gene. The genes for GPIbalpha and GPIbbeta are located on chromosomes 17 and 22, respectively,1,2 while the genes for GPIX and GPV are located on chromosome 3.3,4 GPIbalpha is disulfide linked to GPIbbeta 5,6; GPIX and GPV are noncovalently associated with the complex.7

It is known that GPIbbeta and GPIX are essential for the surface expression of the complex from experiments in cell lines and naturally occurring mutations8,9 and that the interaction of GPIbbeta with GPIX is essential for the surface expression of GPIbalpha . There are no data on how GPIbbeta interacts with GPIX for the ordered surface expression of the complex. The von Willebrand factor (VWF) binds to the extracellular N-terminal domain of GPIbalpha (His1-Glu282),10,11 which contains 7 tandem leucine-rich repeats (LRRs) and has flanking disulfide looped sequences. GPIbbeta and GPIX are related to GPIbalpha and are very similar to GPIbalpha in their extracellular domains. Both GPIbbeta and GPIX have a single LRR. The amino- and carboxyl-terminal sequences flanking the LRR of GPIbbeta and GPIX are very similar to each other and to GPIbalpha . In both of these regions, cysteines are conserved, suggesting conserved disulfide-loop structures. However, GPIbbeta and GPIX have 4 cysteines N-terminal to the LRR, as compared with 2 in GPIbalpha . On the basis of homology with other LRR proteins, it has been suggested that these 4 cysteines form 2 disulfide loops with a loop-within-a-loop structure.5 To explore the site(s) of interaction between GPIX and GPIbbeta , we developed a novel series of antibodies to GPIbbeta . We used site-directed mutagenesis to produce N-terminal truncations of GPIbbeta as well as GPIbeta -IX chimeras to study the surface expression of the complex in mammalian cell lines.


    Materials and methods
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Monoclonal antibodies and reagents

Antibodies were produced as previously described.12 Briefly, BALB/c mice were immunized with acrylamide slices excised from sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels containing reduced denatured platelet GPIbbeta immunopurified as a disulfide-linked complex with GPIbalpha by means of the monoclonal antibody (MoAb) AP-1. The anti-GPIbalpha antibody AP-1 blocks VWF binding to GPIbalpha . From one fusion, a panel of 6 clones was obtained from which 4 were chosen since they reacted strongly with reduced platelet GPIbbeta . The MoAb MBC 257.4 immunoblots both reduced and nonreduced platelet GPIbbeta and was used in the studies described below.

Anti-GPIX MoAbs FMC 25 and GRP were purchased from Harlan Bioproducts (Indianapolis, IN). AK1, a MoAb that recognizes an epitope on GPIX that requires the intact GPIb-IX complex,13 was a generous gift of Dr Michael C. Berndt (Baker Medical Research Institute, Central Melbourne, Victoria, Australia). We have previously shown that this antibody requires the presence of GPIbbeta in cells stably transfected with GPIbalpha and GPIX to recognize the complex.14

Construction of expression vectors

We have previously described a Bernard-Soulier syndrome (BSS) patient who had a deletion of nucleotide 336 in GPIbbeta causing a frameshift and premature termination (GPIbbeta -trunc).9 This patient has no detectable GPIbalpha on the surface of his platelets and has the classical BSS phenotype. We used recombinantly expressed protein containing this mutation to identify the epitope for MBC 257.4. Full-length expression vectors containing GPIbbeta and full-length GPIX have previously been described.9 N-terminal truncations of GPIbbeta were created by means of a strategy based on the type IIS restriction enzyme BsmBI.15,16 Since BsmBI creates a staggered cut on opposite strands of double-stranded DNA at 1 and 5 bases, respectively, 3' of its nonpalindromic recognition sequence (CGTCTC), any desired 4-base overhang can be created by placing sites at the 5'-end of polymerase chain reaction (PCR) primers. The nonhomologous recognition sequence is removed when digested. Thus left- and right-half pairs of PCR products designed with uniquely compatible cohesive ends can be merged seamlessly.

Full-length GPIbbeta was used as the amplification template in creating N-terminal truncations. The left-half PCR extended 3' from the flanking pCIneo sequence (pCIneo961 5'CTTGCGTTTCTGATAGGCACCT) through the signal peptide of GPIbbeta . The right-half PCR extended from the point of the desired truncation through the remainder of GPIbbeta and into the other side of pCIneo (pCI1158 5'-ATTAACCCTCACTAAAGGGAAG (Table 1). The numbering system used in the tables and "Results" refers to the first amino acids following the signal peptide.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Primers used to construct GPIbbeta truncations

PCR products were ligated into PCRII and sequenced to confirm fidelity. Then right- and left-half constructs were digested with XhoI and BsmBI and subcloned into the pCIneo expression vector at the XhoI/XbaI site, in a 3-fragment ligation.

GPIX/GPIbbeta chimeras were created with the use of wildtype plasmids as templates in a strategy in which 2 overlapping first-round PCRs are combined as templates for second-round reamplification to allow extension of a full-length complementary DNA. The first-round PCR products were amplified as follows: the N-terminal portion of the chimera was amplified from GPIX by means of a plasmid primer paired with a chimeric antisense primer containing approximately 20 bases of GPIX sequence followed by approximately 20 bases of GPIbbeta sequence, to produce a first-round product consisting of GPIX sequence up to the desired splice point, followed by a 20-base GPIbbeta overhang. The 3' (C-terminal) portion was amplified from a GPIbbeta plasmid in a similar manner with the use of a chimeric sense primer containing approximately 20 bases of GPIX overhang followed by GPIbbeta sequence complementary to the 20-base pair overhang produced in the previous PCR. The 2 first-round products anneal at the overlapping chimeric GPIX/beta overhangs to serve as templates for second-round amplification. The final construct is amplified by means of flanking plasmid primers to produce a chimera consisting of GPIX and GPIbbeta (Table 2).

                              
View this table:
[in this window]
[in a new window]
 
Table 2. Primers used to construct GPIbbeta /IX chimeras

Transient expression

For transient expression studies, HEK293T cells were used. The parent HEK293T cell line is a human renal epithelial cell, transformed with simian virus-40 large T antigen.17 HEK293T cells were maintained at 37°C in a 5% CO2 humidified chamber in modified Eagle media (Sigma, St Louis, MO) supplemented with 10% fetal calf serum. Expression plasmids were transfected into HEK293T cells in the presence of Lipofectamine and Lipfectamine Plus (GIBCO BRL, Rockville, MD) as described.9

Flow cytometry studies

Transfected cells were detached from tissue-culture plates with 3 mM EDTA, centrifuged at 250g, and resuspended in Hanks Balanced Salt Solution with 2% bovine serum albumin. Then, 3 × 105 cells were transferred to each well of a 96-well V-bottom plate (Dynatech, Chantilly, VA) and incubated with either anti-GPIbbeta MoAb 257.4 (5 µg/mL); the anti-GPIX MoAbs FMC-25 or GRP (5 µg/mL); or the complex-specific MoAb AK1 (ascites 1:1200). The cells were then centrifuged, resuspended, and incubated for an additional 30 minutes in a darkened room with a 1:100 dilution of phycoerythrin-conjugated affinity-purified F(ab')2 donkey anti-mouse immunoglobulin-G (IgG) (Jackson Immunoresearch Laboratories, West Grove, PA). The cells were then centrifuged and resuspended in 2% paraformaldehyde, allowed to incubate at least 1 hour at 4°C, and analyzed in a Becton Dickinson (San Jose, CA) FACScan flow cytometer.

Immunoblotting

Cell lysates were separated by SDS-PAGE on a 4% to 20% gradient gel according to Laemmli.18 The separated proteins were electroblotted onto a polyvinylidine difluoride membrane (Novex, San Diego, CA) as described by Towbin et al,19 blocked in phosphate-buffered saline (PBS) containing 5% powdered milk, and then incubated overnight with the anti-GPIbalpha MoAb MBC 257.4. The membrane was washed 3 times with PBS containing 5% powdered milk, incubated with a goat anti-mouse IgG conjugated with horseradish peroxidase, washed again 3 times, developed with SuperSignal Chemiluminescent Substrate (Pierce, Rockford, IL), and visualized by luminescent radiography.


    Results
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Characterization of GPIbbeta MoAb MBC 254.7

From one anti-GPIbbeta fusion, a panel of 6 anti-GPIbbeta clones were obtained, of which 4 reacted strongly with reduced platelet GPIbbeta by Western blot. The MoAb MBC 257.4 was selected on the basis of its ability to immunoblot both reduced and nonreduced GPIbbeta . The epitope of MBC 257.4 was evaluated in a series of experiments expressing known recombinant proteins. In a BSS patient we have previously characterized, we identified a single nucleotide deletion within the codon for Ala80 in GPIbbeta . This mutation causes a translational frameshift, which encodes for 86 altered amino acids and predicts stop codon 15 amino acids short of the length of the wildtype protein. HEK293T cells were transfected with this construct, lysed, run on SDS-PAGE, and reacted with MBC 257.4. MBC 257.4 recognized this expressed protein (Figure 1), suggesting that the epitope for MBC 257.4 is within the N-terminal 80 amino acids of GPIbbeta .


View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. MoAb 257.4 recognition of an epitope in the N terminus 80 residues of GPIbbeta . The recombinant proteins GPIbbeta and GPIbbeta -trunc9 were expressed in HEK293T cells. The cells were lysed, analyzed by SDS-PAGE, and immunobloted with MBC 257.4. Lane 1 shows platelet lysate; lane 2, recombinant wildtype GPIbbeta ; lane 3, recombinant GPIbbeta -trunc.9 The epitope for MBC 257.4 is within the N terminus 80 residues of GPIbbeta .

To further characterize the antibody, HEK 293T cells were transfected with a construct for GPIbbeta with sequential N-terminal deletions. The cells were then reacted with MoAb 257.4 and analyzed by flow cytometry. GPIbbeta constructs truncated at residues 14, 26, or 31 were readily detectable on the surface of cells transfected with the respective constructs. However GPIbbeta truncated at residues 58 and 65 was not detectable with MoAb 257.4 (Figure 2). When the cells transfected with the N-terminal deletions 58 and 65 were reacted with an anti-GPIbbeta polyclonal antibody, there was no increase in surface fluorescence, further suggesting that these constructs were not surface expressed.


View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. GPIbbeta with N-terminal deletions to residue 31 and N-terminal deletions of GPIbbeta distal to residue 58.  GPIbbeta with N-terminal deletions to residue 31 is expressed on the cell surface and recognized by MoAb 257.4, whereas N-terminal deletions of GPIbbeta distal to residue 58 are not detected on the cell surface. HEK293T cells were transfected with wildtype GPIbbeta alone (panel A) and with GPIbbeta truncated at residue 14 (panel B), 26 (panel C), 31 (panel D), 58 (panel E), and 65 (panel F). The cells were then reacted with MoAb 257.4. There is a significant increase in fluorescence on the cells expressing wildtype GPIbbeta and GPIbbeta truncated at residues 14, 26, and 31. There is no increase in surface fluorescence in cells transfected with GPIbbeta truncated at residue 58 or 65 compared with mock-transfected cells. Thus, N-terminal truncations to residue 31 appear to be expressed while truncations to 58 do not.

To further define the epitope for 257.4, we analyzed the binding of 257.4 to a series of GPIbbeta /GPIX chimeras by flow cytometry. Chimeras were created where sequential N-terminal deletions of GPIbbeta were replaced with the corresponding structural domain of GPIX. This approach allowed us to more precisely define the binding region for MoAb 257.4. The cysteine knot at the N terminus of GPIbbeta (residues 1-14) was spliced and replaced with the cysteine knot region of GPIX, residues 1 through 22, to create chimera GPIX22/beta 15. MoAb 257.4 bound to this chimera (Figure 3). The N terminus of GPIbbeta was truncated more distally at residue 31 and replaced with the homologous region from GPIX, chimera GPIX36/beta 32. This chimera was detected on the surface of transfected cells with MoAb 257.4 (Figure 3). The N terminus of GPIbbeta was truncated at residue 49 and replaced with the homologous region of GPIX, chimera GPIX53/beta 49. This chimera was recognized by MoAb 257.4 (Figure 3). Since GPIbbeta was replaced to residue 49 in these chimeras and the MoAb 257.4 reacted strongly with this chimera, this suggests that the epitope for the antibody lies distal to residue 49. This antibody also recognizes a recombinant mutant GPIbbeta with a translational frameshift at residue 80. Together, these results suggest that the epitope for MBC 257.4 is between residues 50 and 80 of GPIbbeta . As discussed above, these truncations defined the epitope for MBC 257.4 and allowed us to explore more precisely the interactions of GPIbbeta with GPIX.


View larger version (32K):
[in this window]
[in a new window]
 
Figure 3. Surface expression of chimeras of GPIX and GPIbbeta . HEK 293T cells transfected with wildtype GPIbbeta (panel A) or the chimeras GPIX22ñ beta 15, (panel B) GPIX36/beta 32 (panel C), and GPIX53/49 (panel D) were reacted with MoAb 257.4. There is a significant increase in fluorescence in cells transfected with chimeras GPIX22ñ beta 15 and GPIX36/beta 32 and GPIX53/49. Thus, chimeras of GPIX and GPIbbeta are surface expressed.

Complex formation of GPIbbeta with GPIX

Expression of GPIX with N-terminal truncations of GPIbbeta . To investigate the interaction of GPIbbeta with GPIX, plasmids encoding GPIbbeta and GPIX or wildtype GPIX with serial N-terminal truncations of GPIbbeta were transiently transfected into HEK293T cells. These cells were then incubated with an anti-GPIX MoAb, FMC25, followed by a phycoerythrin-conjugated donkey antimouse antibody, and then analyzed by flow cytometry.

When wildtype GPIbbeta and wildtype GPIX were simultaneously cotransfected into HEK 293T cells, GPIX were readily detectable on the cell surface (Figure 4). However, when GPIbbeta truncated at residues 14 or 26 was cotransfected into HEK293T cells, GPIX was not detectable on the cell surface (Figure 4B-C), nor was there any increase in fluorescence when the cells were reacted with the complex-specific antibody AK1 (Figure 4E-F). To determine if these truncations of GPIbbeta interacted with GPIbalpha , GPIbbeta truncated at residue 26 and wildtype GPIbalpha were simultaneously transfected into HEK293T cells. The cells were immunoprecipitated with the anti-GPIbalpha antibody and immunoblotted with MBC 257.4. Since GPIbeta Delta 1-26 is present, this demonstrates that it is complexed with GPIbalpha (Figure 5).


View larger version (26K):
[in this window]
[in a new window]
 
Figure 4. The role of the N terminus of GPIbbeta in the coexpression of GPIX. The N terminus of GPIbbeta is essential for the coexpression of GPIX. Wildtype GPIbbeta and wildtype GPIX were simultaneously cotransfected into HEK 293T cells (panels A, D). GPIbbeta truncated at residues 14 (B, E) or 26 (C, F) were cotransfected into HEK293T cells with GPIX. Cells were then reacted with the anti-GPIX antibody FMC 25 (panels A-C) or the complex-specific antibody AK1 (panels D-F). N-terminal truncations of GPIbbeta do not bring GPIX to the surface.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. GPIbbeta Delta 1-26 complexed with GPIbalpha . GPIbbeta truncated at residue 26 and wildtype GPIbalpha were simultaneously transfected into HEK293T cells. The cells were immunopreciptated with an anti-GPIbalpha antibody and immunoblotted with an anti-GPIbbeta polyclonal antibody. This demonstrated that GPIbeta Delta 1-26 is complexed with GPIbalpha .

Expression of GPIX with GPIbbeta /GPIX chimeras. Since N-terminal truncations of GPIbbeta allowed the surface expression of GPIbbeta alone but did not bring GPIX to the surface, we explored the interaction of GPIbbeta with GPIX with a series of GPIbbeta /GPIX chimeras. To control for potential conformational changes induced by deleting the N terminus of GPIbbeta , we generated a series of chimeras between GPIbbeta and GPIX at defined boundaries. The cysteine knot at the N terminus of GPIbbeta (residues 1-14) was spliced and replaced with the cysteine knot region of GPIX (residues 1-22) to create chimera GPIX22/beta 15. This chimeric construct was cotransfected simultaneously with wildtype GPIX. The cells were then reacted with the complex-specific antibody AK1. Chimera GPIX22/beta 15 expressed on the cell surface (Figure 3). When chimera GPIX22/beta 15 was cotransfected into HEK293T cells simultaneously with GPIX, there was a significant increase in fluorescence when the cells were reacted with the complex-specific antibody AK1, suggesting that chimera GPIX22/beta 15 interacts with GPIX to bring GPIX to the surface (Figure 6).


View larger version (31K):
[in this window]
[in a new window]
 
Figure 6. N-terminal 14 amino acids of GPIbbeta and surface expression of GPIX. The N-terminal 14 amino acids of GPIbbeta are essential for the surface expression of GPIX. The chimeras GPIX22/beta 15, GPIX36/beta 32, and GPIX53/49 were cotransfected with GPIX into HEK293T cells and reacted with the anti-GPIX antibody FMC 25 (panels A-D) or the complex-specific antibody AK1 (panels E-H). Panels A and E are wildtype beta and wildtype IX. Panels B and F are the chimera GPIX22/beta 15, which brings GPIX to the surface and is complexed to GPIX22/beta 15 since there is a significant increase in surface fluorescence in these cells when reacted with the antibody AK1 as compared with mock-transfected cells. In contrast, when cells simultaneously transfected with chimeras GPIX36/beta 32 (panels C, G) and GPIX53/49 (panels D, H) and GPIX are reacted with either the anti-GPIX (panels C, D) antibody or AK1 (panels G, H), there is no increase in fluorescence compared with mock-transfected cells. Thus, the N-terminal 14 residues of GPIbbeta are essential for the surface expression of GPIX.

In another chimeric construct, the N terminus of GPIbbeta was truncated more distally at residue 31 (N terminus to the LRR region) and replaced with the homologous region from GPIX, chimera GPIX36/beta 32. This chimera surface expresses (Figure 3), but does not interact with, GPIX (Figure 6) since it is not detected with AK1.

The N terminus of GPIbbeta was truncated at residue 49 (middle of the leucine-rich motif) and replaced with the homologous region of GPIX, chimera GPIX53/beta 49; this chimera did surface express (Figure 3), but did not complex with, GPIX (Figure 6), as shown by the negative response when the cells are reacted with AK1. Thus, the residues 15 through 32 of GPIbbeta are critical for the interaction with GPIX.


    Discussion
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

It has previously been shown, in experiments using recombinant expression in mammalian cell lines and in naturally occurring mutations, that the interaction of GPIbbeta with GPIX is essential for the normal surface expression of GPIbalpha .8,9 The precise sites of interaction of GPIbbeta and GPIX are not known. To define the sites of interaction of GPIbbeta with GPIX, we made a new series of antibodies, which recognize GPIbbeta . We demonstrated that one of these antibodies recognizes an epitope between residues 50 and 80 of GPIbbeta . We then constructed a series of truncations of GPIbbeta at the amino terminus. These experiments suggested that the amino terminus was important for the interaction between GPIbalpha and GPIbbeta . We then generated a series of chimeras, replacing the N terminus of GPIbbeta with the corresponding domain of GPIX, and demonstrate that the cysteine knot region of GPIbbeta is critical for the conformation of GPIbbeta that interacts with GPIX. Furthermore, we have shown that residues 15 through 32 of GPIbbeta are critical for the interaction of GPIbbeta with GPIX.

The secondary structures of GPIX and GPIbbeta have not yet been defined. It has been suggested that these regions are homologous to GPIbalpha .5 GPIbalpha has an N-terminal flank with a single cysteine loop, 7 LRRs, and a C-terminal flanking region containing 2 disulfide loops. GPIbbeta and GPIX have similar structural domains, with each containing a single LRR. It is interesting that the flanking amino acids on both sides of the LRR are homologous in the proteins of this group. It has been suggested by Hickey et al20 that the flanking amino acid sequences on both sides of the region containing the LRR may represent the product of an ancestral oligonucleotide sequence in which the flanking segments remained constant and the central LRR underwent duplication. The results of the present investigation demonstrate a critical role for the N terminus-flanking region of GPIbbeta with GPIX.

Molecular characterization of the defects in BSS has helped define critical regions in the GPIb-IX complex. Our previous investigations have demonstrated that GPIbbeta is essential for the normal surface expression of GPIX. There are 4 published reports of mutations within GPIbbeta that cause the BSS phenotype.9,14,21,22 To date, there have been no descriptions of point mutations within the N-terminal flanking region of GPIbbeta that cause the syndrome. In contrast, 2 mutations that cause BSS have been described within the C-terminal flanking region of GPIX.23,24 It is unclear why point mutations in the N-terminal flanking region of GPIX give rise to the BSS phenotype. One explanation is that the mutation produces an unstable protein that fails to express. Alternatively, if this region of GPIX can no longer interact with GPIbbeta , neither GPIbalpha nor GPIX would be detectable on the platelet surface. In the patient described by Rivera et al,23 a homozygous Tright-arrowC transition changed Cys8right-arrowArg. The results of our experiments suggest that this region of GPIX might no longer interact with GPIbbeta , and hence GPIbalpha would not be expressed on the cell surface. Interestingly, Rivera et al noted circulating glycocalicin in their patient's plasma. This suggests that GPIbalpha was being made, yet not inserted in the plasma membrane. We have noted a similar finding in another BSS patient with a mutation in GPIbbeta .14 Wright et al24 described 3 patients who were doubly heterozygous for mutations within GPIX. One mutation was an Aright-arrowG transition in codon 21, and the other was an Aright-arrowG change in codon 45. These mutations changed an Asp to Gly in the N terminus-flanking region of GPIX and an Asn to Ser within the LRR. Again, it was not clear how these mutations caused the BSS phenotype although the authors proposed that these mutations disrupted the stable assembly of the complex. Our results support their hypothesis. Mutations in GPIX that result from changes in the codons for cysteines on either flanking region of the LRR resulted in BSS.23,25 This mutation probably disrupts the disulfide bonding pattern in the amino terminus and hence altered the secondary structure of GPIX, which disrupts the proper assembly and anchoring of the complex.23 In the present investigation, we used chimeras where the cysteine knots of both GPIbbeta and GPIX were preserved within each of the subunits by swapping precise structural domains. These results demonstrate the critical importance of this region for the precise insertion of the whole complex in the plasma membrane.

Dong et al26 investigated assembly and transport of the entire GPIb complex using transfected mammalian cells. They showed that the full complex was formed within minutes in the endoplasmic reticulum. Surprisingly, they noted that GPIbalpha , even in the complexed form, was highly susceptible to degradation. When GPIbalpha was expressed as a partial complex with either GPIbbeta or GPIX, more than 60% of GPIbalpha was degraded. In contrast, the partial complex consisting of GPIbbeta and GPIX was relatively stable. From our previous investigations on patients with BSS, we have shown that it is the critical interaction of GPIbbeta with GPIX that brings GPIbalpha to the surface. The present investigation extends our previous work and the analysis of complex assembly by Dong et al.26

GPIX mutations appear to disrupt the GPIb/IX structure, as evidenced by exposure of a cryptic site on GPIbbeta 23 and decreased expression of GPIX thorough its failure to interact with GPIbbeta .24 Previous investigations on the role of GPIbbeta have been limited by a paucity of GPIbbeta antibodies. In this investigation, we made and characterized a novel anti-GPIbbeta antibody. While the results of this investigation further define the role of GPIbbeta in assembly of the complex, additional studies are required to further define the functional role of GPIbbeta .


    Footnotes

Submitted October 31, 2001; accepted February 6, 2002.

Supported by National Institutes of Health grants HL56027, HL44612, and HL33721 and grants from the Higher Education Authority and Enterprise Ireland.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Dermot Kenny, MACC Fund Research Center---Dept of Pediatrics, Medical College of Wisconsin, 8701 Watertown Plank Rd, PO Box 26509, Milwaukee, WI 53226-0509; e-mail: dkenny{at}rcsi.ie.


    References
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Wenger RH, Wicki AN, Kieffer N, Adolph S, Hameister H, Clemetson KJ. The 5' flanking region and chromosomal localization of the gene encoding human platelet glycoprotein Ibalpha . Gene. 1989;85:517-524[CrossRef][Medline] [Order article via Infotrieve].

2. Yagi M, Edelhoff S, Disteche CM, Roth GJ. Structural characterization and chromosomal location of the gene encoding human platelet glycoprotein Ibbeta . J Biol Chem. 1994;269:17424-17427[Abstract/Free Full Text].

3. Hickey MJ, Deaven LL, Roth GJ. Human platelet glycoprotein IX: characterization of cDNA and localization of the gene to chromosome 3. FEBS Lett. 1990;274:189-192[CrossRef][Medline] [Order article via Infotrieve].

4. Lanza F, Morales M, de La Salle C, et al. Cloning and characterization of the gene encoding the human platelet glycoprotein V. J Biol Chem. 1993;268:20801-20807[Abstract/Free Full Text].

5. López JA. The platelet glycoprotein Ib-IX complex. Blood Coagul Fibrinolysis. 1994;5:97-119[Medline] [Order article via Infotrieve].

6. López JA, Chung DW, Fujikawa K, Hagen FS, Davie EW, Roth GJ. The alpha  and beta  chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence. Proc Natl Acad Sci U S A. 1988;85:2135-2139[Abstract/Free Full Text].

7. Modderman PW, Admiraal LG, Sonnenberg A, von dem Borne AE. Glycoproteins V and Ib-IX form a noncovalent complex in the platelet membrane. J Biol Chem. 1992;267:364-369[Abstract/Free Full Text].

8. López JA, Weisman S, Sanan DA, Sih T, Chambers M, Li CQ. Glycoprotein (GP) Ibbeta is the critical subunit linking GP Ibalpha and GP IX in the GP Ib-complex. J Biol Chem. 1994;269:23716-23721[Abstract/Free Full Text].

9. Kenny D, Morateck PA, Gill JC, Montgomery RR. The critical interaction of glycoprotein Ibbeta with GPIX: a genetic cause of Bernard-Soulier syndrome. Blood. 1999;93:2968-2975[Abstract/Free Full Text].

10. Murata M, Ware J, Ruggeri ZM. Site-directed mutagenesis of a soluble recombinant fragment of platelet glycoprotein Ibalpha demonstrating negatively charged residues involved in von Willebrand factor binding. J Biol Chem. 1991;266:15474-15480[Abstract/Free Full Text].

11. Vincente V, Houghten RA, Ruggeri ZM. Identification of a site in the alpha chain of platelet glycoprotein Ib that participates in von Willebrand factor binding. J Biol Chem. 1990;265:274-280[Abstract/Free Full Text].

12. Ruggeri ZM, Marco LD, Gatti L, Bader R, Montgomery RR. Platelets have more than one binding site for von Willebrand factor. J Clin Invest. 1983;72:1-12[Medline] [Order article via Infotrieve].

13. Du X, Beutler L, Ruan C, Castaldi PA, Berndt MC. Glycoprotein Ib and glycoprotein IX are fully complexed in the intact platelet membrane. Blood. 1987;69:1524-1527[Abstract/Free Full Text].

14. Moran N, Morateck P, Deering A, et al. The surface expression of GPIbalpha is dependent on GPIbbeta : evidence from a novel mutation causing Bernard-Soulier syndrome. Blood. 2000;96:540-545[Abstract/Free Full Text].

15. Padgett KA, Sorge JA. Creating seamless junctions independent of restriction sites in PCR cloning. Gene. 1996;168:31-35[CrossRef][Medline] [Order article via Infotrieve].

16. Szybalski W, Kim SC, Hasan N, Podhajska AJ. Class-IIS restriction enzymes: a review. Gene. 1991;100:13-26[CrossRef][Medline] [Order article via Infotrieve].

17. DuBridge RB, Tang P, Hsia HC, Leong P-M, Miller JH, Calos MP. Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol. 1987;7:379-387[Abstract/Free Full Text].

18. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680-685[CrossRef][Medline] [Order article via Infotrieve].

19. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocelluose sheets: procedure and some applications. Proc Natl Acad Sci U S A. 1979;76:4350-4354[Abstract/Free Full Text].

20. Hickey MJ, Williams SA, Roth GJ. Human platelet glycoprotein IX: an adhesive prototype of leucine-rich glycoproteins with flank-center-flank structures. Proc Natl Acad Sci U S A. 1989;86:6773-6777[Abstract/Free Full Text].

21. Ludlow LB, Schick BP, Budarf ML, et al. Identification of a mutation in a GATA binding site of the platelet glycoprotein Ibbeta promoter resulting in the Bernard-Soulier syndrome. J Biol Chem. 1996;271:22076-22080[Abstract/Free Full Text].

22. Kunishima S, Lopez JA, Kobayashi S, et al. Missense mutations of the glycoprotein (GP) Ibbeta gene impairing the GPIb alpha /beta disulfide linkage in a family with giant platelet disorder. Blood. 1997;89:2404-2412[Abstract/Free Full Text].

23. Rivera CE, Villagra J, Riordan M, Williams S, Lindstrom KJ, Rick ME. Identification of a new mutation in platelet glycoprotein IX (GPIX) in a patient with Bernard-Soulier syndrome. Br J Haematol. 2001;112:105-108[CrossRef][Medline] [Order article via Infotrieve].

24. Wright SD, Michaelides K, Johnson DJD, West NC, Tuddenham EGD. Double heterozygosity for mutations in the platelet glycoprotein IX gene in three siblings with Bernard-Soulier syndrome. Blood. 1993;81:2339-2347[Abstract/Free Full Text].

25. Noda M, Fujimura K, Takafuta T, et al. A point mutation in glycoprotein IX coding sequence (Cys73{TGT} to Tyr{TAT}) causes impaired surface expression of GPIb/IX/V complex in two families with Bernard-Soulier syndrome. Thromb Haemost. 1996;76:874-878[Medline] [Order article via Infotrieve].

26. Dong J, Gao S, López JA. Synthesis, assembly, and intracellular transport of the platelet glycoprotein Ib-IX-V complex. J Biol Chem. 1998;273:31449-31454[Abstract/Free Full Text].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
X. Mo, N. Lu, A. Padilla, J. A. Lopez, and R. Li
The Transmembrane Domain of Glycoprotein Ibbeta Is Critical to Efficient Expression of Glycoprotein Ib-IX Complex in the Plasma Membrane
J. Biol. Chem., August 11, 2006; 281(32): 23050 - 23059.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Simizu, S. Takagi, Y. Tamura, and H. Osada
RECK-Mediated Suppression of Tumor Cell Invasion Is Regulated by Glycosylation in Human Tumor Cell Lines
Cancer Res., August 15, 2005; 65(16): 7455 - 7461.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kenny, D.
Right arrow Articles by Montgomery, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kenny, D.
Right arrow Articles by Montgomery, R. R.
Related Collections
Right arrow Hemostasis, Thrombosis, and Vascular Biology
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020