|
|
 Previous Article | Table of Contents | Next Article 
Blood, 15 June 2002, Vol. 99, No. 12, pp. 4428-4433
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
The cysteine knot of platelet glycoprotein Ib (GPIb) is
critical for the interaction of GPIb with GPIX
Dermot Kenny,
Patricia A. Morateck, and
Robert R. Montgomery
From the Blood Research Institute, the Blood Center of
Southeastern Wisconsin, Milwaukee; Departments of Medicine and
Pediatrics, Medical College of Wisconsin, Milwaukee; and the
Royal College of Surgeons in Dublin, Ireland.
 |
Abstract |
The glycoprotein Ib (GPIb) complex is composed of GPIb
covalently attached to GPIb and noncovalently complexed with GPIX and GPV. Patients with Bernard-Soulier syndrome demonstrate
that mutations in either GPIb or GPIX result in an absence of
platelet GPIb. This occurs through the interaction of GPIX with
GPIb. The precise sites of interaction of GPIb with GPIX are not
known. To characterize the interaction of GPIb and GPIX, we
developed an anti-GPIb monoclonal antibody MBC 257.4, whose epitope
was in the N-terminal region of GPIb. N-terminal truncations of
GPIb were expressed in mammalian cells. N-terminal truncations of
GPIb, missing the first 14, 26, or 31 amino acids, were
surface-expressed but did not enable coexpressed GPIX to be surface
expressed, suggesting that the site of interaction with GPIX was
modified by these deletions. GPIb and GPIX chimeras corresponding to
predicted boundaries were used to define the sites of interaction of
GPIb with GPIX. Replacing the N-terminal disulfide loops of
GPIb (amino acids 1-14) with the corresponding disulfide loops of
GPIX (amino acids 1-22) resulted in surface expression of coexpressed
wildtype GPIX. However, when the N terminus of GPIb was replaced to
residue 32 with the N terminus of GPIX (amino acids 1-36), GPIX did not surface express with this chimera. These results suggest that the
cysteine knot region of GPIb in the N terminus is critical for the
conformation of GPIb that interacts with GPIX and further suggests
that a critical interaction of GPIb with GPIX involve residues 15 through 32 of GPIb.
(Blood. 2002;99:4428-4433)
© 2002 by The American Society of Hematology.
| |
Introduction |
The platelet membrane glycoprotein Ib-IX-V
(GPIb-IX-V) complex has a critical role in platelet adhesion mediating
hemostasis. The complex is composed of 4 type 1 membrane-spanning
proteins: GPIb, GPIb, GPIX, and GPV. Each of these glycoproteins
is encoded by a single copy gene. The genes for GPIb and GPIb are
located on chromosomes 17 and 22, respectively,1,2
while the genes for GPIX and GPV are located on chromosome
3.3,4 GPIb is disulfide linked to
GPIb5,6; GPIX and GPV are noncovalently associated with
the complex.7
It is known that GPIb and GPIX are essential for the surface
expression of the complex from experiments in cell lines and naturally
occurring mutations8,9 and that the interaction of GPIb
with GPIX is essential for the surface expression of GPIb. There are
no data on how GPIb interacts with GPIX for the ordered surface
expression of the complex. The von Willebrand factor (VWF)
binds to the extracellular N-terminal domain of GPIb (His1-Glu282),10,11 which contains 7 tandem leucine-rich
repeats (LRRs) and has flanking disulfide looped sequences. GPIb and GPIX are related to GPIb and are very similar to GPIb in their extracellular domains. Both GPIb and GPIX have a single LRR. The
amino- and carboxyl-terminal sequences flanking the LRR of GPIb and
GPIX are very similar to each other and to GPIb. In both of these
regions, cysteines are conserved, suggesting conserved disulfide-loop
structures. However, GPIb and GPIX have 4 cysteines N-terminal to
the LRR, as compared with 2 in GPIb. On the basis of homology with
other LRR proteins, it has been suggested that these 4 cysteines form 2 disulfide loops with a loop-within-a-loop structure.5 To
explore the site(s) of interaction between GPIX and GPIb, we
developed a novel series of antibodies to GPIb. We used
site-directed mutagenesis to produce N-terminal truncations of GPIb
as well as GPI-IX chimeras to study the surface expression of
the complex in mammalian cell lines.
| |
Materials and methods |
Monoclonal antibodies and reagents
Antibodies were produced as previously
described.12 Briefly, BALB/c mice were immunized with
acrylamide slices excised from sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) gels containing reduced
denatured platelet GPIb immunopurified as a disulfide-linked complex
with GPIb by means of the monoclonal antibody (MoAb) AP-1. The
anti-GPIb antibody AP-1 blocks VWF binding to GPIb. From one
fusion, a panel of 6 clones was obtained from which 4 were chosen since
they reacted strongly with reduced platelet GPIb. The MoAb MBC 257.4 immunoblots both reduced and nonreduced platelet GPIb and was used
in the studies described below.
Anti-GPIX MoAbs FMC 25 and GRP were purchased from Harlan Bioproducts
(Indianapolis, IN). AK1, a MoAb that recognizes an epitope on GPIX that
requires the intact GPIb-IX complex,13 was a generous gift
of Dr Michael C. Berndt (Baker Medical Research Institute, Central
Melbourne, Victoria, Australia). We have previously shown that this
antibody requires the presence of GPIb in cells stably transfected
with GPIb and GPIX to recognize the complex.14
Construction of expression vectors
We have previously described a Bernard-Soulier syndrome
(BSS) patient who had a deletion of nucleotide 336 in GPIb causing a
frameshift and premature termination (GPIb-trunc).9
This patient has no detectable GPIb on the surface of his platelets and has the classical BSS phenotype. We used recombinantly expressed protein containing this mutation to identify the epitope for MBC 257.4. Full-length expression vectors containing GPIb and full-length GPIX
have previously been described.9 N-terminal truncations of
GPIb were created by means of a strategy based on the type IIS
restriction enzyme BsmBI.15,16 Since BsmBI creates a
staggered cut on opposite strands of double-stranded DNA at 1 and 5 bases, respectively, 3' of its nonpalindromic recognition
sequence (CGTCTC), any desired 4-base overhang can be created by
placing sites at the 5'-end of polymerase chain reaction (PCR) primers.
The nonhomologous recognition sequence is removed when digested. Thus
left- and right-half pairs of PCR products designed with uniquely
compatible cohesive ends can be merged seamlessly.
Full-length GPIb was used as the amplification template in creating
N-terminal truncations. The left-half PCR extended 3' from the flanking
pCIneo sequence (pCIneo961 5'CTTGCGTTTCTGATAGGCACCT) through the signal
peptide of GPIb. The right-half PCR extended from the point of the
desired truncation through the remainder of GPIb and into the other
side of pCIneo (pCI1158 5'-ATTAACCCTCACTAAAGGGAAG (Table
1). The numbering system used in the
tables and "Results" refers to the first amino acids following the
signal peptide.
PCR products were ligated into PCRII and sequenced to confirm fidelity.
Then right- and left-half constructs were digested with XhoI and BsmBI
and subcloned into the pCIneo expression vector at the XhoI/XbaI site,
in a 3-fragment ligation.
GPIX/GPIb chimeras were created with the use of
wildtype plasmids as templates in a strategy in which 2 overlapping first-round PCRs are combined as templates for second-round
reamplification to allow extension of a full-length complementary
DNA. The first-round PCR products were amplified as follows:
the N-terminal portion of the chimera was amplified from GPIX by means
of a plasmid primer paired with a chimeric antisense primer containing
approximately 20 bases of GPIX sequence followed by approximately 20 bases of GPIb sequence, to produce a first-round product consisting
of GPIX sequence up to the desired splice point, followed by a 20-base GPIb overhang. The 3' (C-terminal) portion was amplified from a
GPIb plasmid in a similar manner with the use of a chimeric sense
primer containing approximately 20 bases of GPIX overhang followed by
GPIb sequence complementary to the 20-base pair overhang produced
in the previous PCR. The 2 first-round products anneal at the
overlapping chimeric GPIX/ overhangs to serve as templates for
second-round amplification. The final construct is amplified by means
of flanking plasmid primers to produce a chimera consisting of GPIX and
GPIb (Table 2).
Transient expression
For transient expression studies, HEK293T cells were used. The
parent HEK293T cell line is a human renal epithelial cell, transformed
with simian virus-40 large T antigen.17 HEK293T cells
were maintained at 37°C in a 5% CO2 humidified chamber
in modified Eagle media (Sigma, St Louis, MO) supplemented with 10% fetal calf serum. Expression plasmids were transfected into HEK293T cells in the presence of Lipofectamine and Lipfectamine Plus (GIBCO BRL, Rockville, MD) as described.9
Flow cytometry studies
Transfected cells were detached from tissue-culture plates with
3 mM EDTA, centrifuged at 250g, and resuspended in Hanks
Balanced Salt Solution with 2% bovine serum albumin. Then,
3 × 105 cells were transferred to each well of a 96-well
V-bottom plate (Dynatech, Chantilly, VA) and incubated with either
anti-GPIb MoAb 257.4 (5 µg/mL); the anti-GPIX MoAbs FMC-25 or GRP
(5 µg/mL); or the complex-specific MoAb AK1 (ascites 1:1200). The
cells were then centrifuged, resuspended, and incubated for an
additional 30 minutes in a darkened room with a 1:100 dilution of
phycoerythrin-conjugated affinity-purified F(ab')2 donkey
anti-mouse immunoglobulin-G (IgG) (Jackson Immunoresearch
Laboratories, West Grove, PA). The cells were then centrifuged and
resuspended in 2% paraformaldehyde, allowed to incubate at least 1 hour at 4°C, and analyzed in a Becton Dickinson (San Jose, CA)
FACScan flow cytometer.
Immunoblotting
Cell lysates were separated by SDS-PAGE on a 4% to 20%
gradient gel according to Laemmli.18 The separated
proteins were electroblotted onto a polyvinylidine difluoride membrane
(Novex, San Diego, CA) as described by Towbin et al,19
blocked in phosphate-buffered saline (PBS) containing 5% powdered
milk, and then incubated overnight with the anti-GPIb MoAb MBC
257.4. The membrane was washed 3 times with PBS containing 5% powdered
milk, incubated with a goat anti-mouse IgG conjugated with horseradish
peroxidase, washed again 3 times, developed with SuperSignal
Chemiluminescent Substrate (Pierce, Rockford, IL), and visualized by
luminescent radiography.
| |
Results |
Characterization of GPIb MoAb MBC 254.7
From one anti-GPIb fusion, a panel of 6 anti-GPIb clones were obtained, of which 4 reacted strongly with
reduced platelet GPIb by Western blot. The MoAb MBC 257.4 was
selected on the basis of its ability to immunoblot both reduced and
nonreduced GPIb. The epitope of MBC 257.4 was evaluated in a series
of experiments expressing known recombinant proteins. In a BSS patient
we have previously characterized, we identified a single nucleotide
deletion within the codon for Ala80 in GPIb. This mutation causes a
translational frameshift, which encodes for 86 altered amino acids and
predicts stop codon 15 amino acids short of the length of the wildtype protein. HEK293T cells were transfected with this construct, lysed, run
on SDS-PAGE, and reacted with MBC 257.4. MBC 257.4 recognized this
expressed protein (Figure 1), suggesting
that the epitope for MBC 257.4 is within the N-terminal 80 amino acids
of GPIb.
View larger version (41K):
[in this window]
[in a new window]
| Figure 1.
MoAb 257.4 recognition of an epitope in the N
terminus 80 residues of GPIb.
The recombinant proteins GPIb and
GPIb-trunc9 were expressed in HEK293T cells. The cells
were lysed, analyzed by SDS-PAGE, and immunobloted with MBC 257.4. Lane
1 shows platelet lysate; lane 2, recombinant wildtype GPIb; lane 3, recombinant GPIb-trunc.9 The epitope for MBC 257.4 is
within the N terminus 80 residues of GPIb.
|
|
To further characterize the antibody, HEK 293T cells were
transfected with a construct for GPIb with sequential N-terminal deletions. The cells were then reacted with MoAb 257.4 and analyzed by
flow cytometry. GPIb constructs truncated at residues 14, 26, or 31 were readily detectable on the surface of cells transfected with the
respective constructs. However GPIb truncated at residues 58 and 65 was not detectable with MoAb 257.4 (Figure
2). When the cells transfected with the
N-terminal deletions 58 and 65 were reacted with an anti-GPIb
polyclonal antibody, there was no increase in surface fluorescence,
further suggesting that these constructs were not surface expressed.
View larger version (23K):
[in this window]
[in a new window]
| Figure 2.
GPIb with N-terminal deletions to residue 31 and
N-terminal deletions of GPIb distal to residue 58.
GPIb with N-terminal deletions to residue 31 is expressed on
the cell surface and recognized by MoAb 257.4, whereas N-terminal
deletions of GPIb distal to residue 58 are not detected on the cell
surface. HEK293T cells were transfected with wildtype GPIb alone
(panel A) and with GPIb truncated at residue 14 (panel B), 26 (panel
C), 31 (panel D), 58 (panel E), and 65 (panel F). The cells were then
reacted with MoAb 257.4. There is a significant increase in
fluorescence on the cells expressing wildtype GPIb and GPIb
truncated at residues 14, 26, and 31. There is no increase in surface
fluorescence in cells transfected with GPIb truncated at residue 58 or 65 compared with mock-transfected cells. Thus, N-terminal
truncations to residue 31 appear to be expressed while truncations to
58 do not.
|
|
To further define the epitope for 257.4, we analyzed the binding
of 257.4 to a series of GPIb/GPIX chimeras by flow cytometry. Chimeras were created where sequential N-terminal deletions of GPIb
were replaced with the corresponding structural domain of GPIX. This
approach allowed us to more precisely define the binding region for
MoAb 257.4. The cysteine knot at the N terminus of GPIb (residues
1-14) was spliced and replaced with the cysteine knot region of GPIX,
residues 1 through 22, to create chimera GPIX22/15. MoAb 257.4 bound
to this chimera (Figure 3). The N terminus of GPIb was truncated more distally at residue 31 and replaced with the homologous region from GPIX, chimera GPIX36/32. This chimera was detected on the surface of transfected cells with MoAb
257.4 (Figure 3). The N terminus of GPIb was truncated at residue 49 and replaced with the homologous region of GPIX, chimera GPIX53/49.
This chimera was recognized by MoAb 257.4 (Figure 3). Since GPIb was
replaced to residue 49 in these chimeras and the MoAb 257.4 reacted
strongly with this chimera, this suggests that the epitope for the
antibody lies distal to residue 49. This antibody also recognizes a
recombinant mutant GPIb with a translational frameshift at residue
80. Together, these results suggest that the epitope for MBC 257.4 is
between residues 50 and 80 of GPIb. As discussed above, these
truncations defined the epitope for MBC 257.4 and allowed us to explore
more precisely the interactions of GPIb with GPIX.
View larger version (32K):
[in this window]
[in a new window]
| Figure 3.
Surface expression of chimeras of GPIX and
GPIb.
HEK 293T cells transfected with wildtype GPIb (panel A) or the
chimeras GPIX22ñ 15, (panel B) GPIX36/32 (panel C), and
GPIX53/49 (panel D) were reacted with MoAb 257.4. There is a
significant increase in fluorescence in cells transfected with chimeras
GPIX22ñ 15 and GPIX36/32 and GPIX53/49. Thus, chimeras of
GPIX and GPIb are surface expressed.
|
|
Complex formation of GPIb with GPIX
Expression of GPIX with N-terminal truncations of GPIb.
To investigate the interaction of GPIb with GPIX, plasmids encoding
GPIb and GPIX or wildtype GPIX with serial N-terminal truncations of
GPIb were transiently transfected into HEK293T cells. These cells
were then incubated with an anti-GPIX MoAb, FMC25, followed by a
phycoerythrin-conjugated donkey antimouse antibody, and then analyzed
by flow cytometry.
When wildtype GPIb and wildtype GPIX were simultaneously
cotransfected into HEK 293T cells, GPIX were readily detectable on the
cell surface (Figure 4). However, when
GPIb truncated at residues 14 or 26 was cotransfected into HEK293T
cells, GPIX was not detectable on the cell surface (Figure 4B-C), nor
was there any increase in fluorescence when the cells were reacted with
the complex-specific antibody AK1 (Figure 4E-F). To determine if these
truncations of GPIb interacted with GPIb, GPIb truncated at
residue 26 and wildtype GPIb were simultaneously transfected into
HEK293T cells. The cells were immunoprecipitated with the anti-GPIb
antibody and immunoblotted with MBC 257.4. Since GPI 1-26 is
present, this demonstrates that it is complexed with GPIb (Figure
5).
View larger version (26K):
[in this window]
[in a new window]
| Figure 4.
The role of the N terminus of GPIb in the coexpression of GPIX.
The N terminus of GPIb is essential for the coexpression of GPIX.
Wildtype GPIb and wildtype GPIX were simultaneously cotransfected
into HEK 293T cells (panels A, D). GPIb truncated at residues 14 (B,
E) or 26 (C, F) were cotransfected into HEK293T cells with
GPIX. Cells were then reacted with the anti-GPIX antibody FMC
25 (panels A-C) or the complex-specific antibody AK1 (panels
D-F). N-terminal truncations of GPIb do not bring GPIX to
the surface.
|
|
View larger version (30K):
[in this window]
[in a new window]
| Figure 5.
GPIb1-26 complexed with GPIb.
GPIb truncated at residue 26 and wildtype GPIb were
simultaneously transfected into HEK293T cells. The cells were
immunopreciptated with an anti-GPIb antibody and immunoblotted with
an anti-GPIb polyclonal antibody. This demonstrated that
GPI1-26 is complexed with GPIb.
|
|
Expression of GPIX with GPIb/GPIX chimeras.
Since N-terminal truncations of GPIb allowed the surface
expression of GPIb alone but did not bring GPIX to the surface, we
explored the interaction of GPIb with GPIX with a series of GPIb/GPIX chimeras. To control for potential conformational changes induced by deleting the N terminus of GPIb, we generated a series of
chimeras between GPIb and GPIX at defined boundaries. The cysteine
knot at the N terminus of GPIb (residues 1-14) was spliced and
replaced with the cysteine knot region of GPIX (residues 1-22) to
create chimera GPIX22/15. This chimeric construct was cotransfected simultaneously with wildtype GPIX. The cells were then reacted with the
complex-specific antibody AK1. Chimera GPIX22/15 expressed on the
cell surface (Figure 3). When chimera GPIX22/15 was cotransfected into HEK293T cells simultaneously with GPIX, there was a significant increase in fluorescence when the cells were reacted with the complex-specific antibody AK1, suggesting that chimera GPIX22/15 interacts with GPIX to bring GPIX to the surface (Figure
6).
View larger version (31K):
[in this window]
[in a new window]
| Figure 6.
N-terminal 14 amino acids of GPIb and surface expression of GPIX.
The N-terminal 14 amino acids of GPIb are essential for the surface
expression of GPIX. The chimeras GPIX22/15, GPIX36/32, and
GPIX53/49 were cotransfected with GPIX into HEK293T cells and reacted
with the anti-GPIX antibody FMC 25 (panels A-D) or the complex-specific
antibody AK1 (panels E-H). Panels A and E are wildtype beta and
wildtype IX. Panels B and F are the chimera GPIX22/15, which brings
GPIX to the surface and is complexed to GPIX22/15 since there is a
significant increase in surface fluorescence in these cells when
reacted with the antibody AK1 as compared with mock-transfected cells.
In contrast, when cells simultaneously transfected with chimeras
GPIX36/32 (panels C, G) and GPIX53/49 (panels D, H) and GPIX are
reacted with either the anti-GPIX (panels C, D) antibody or AK1 (panels
G, H), there is no increase in fluorescence compared with
mock-transfected cells. Thus, the N-terminal 14 residues of GPIb are
essential for the surface expression of GPIX.
|
|
In another chimeric construct, the N terminus of GPIb was
truncated more distally at residue 31 (N terminus to the LRR region) and replaced with the homologous region from GPIX, chimera
GPIX36/32. This chimera surface expresses (Figure 3), but does
not interact with, GPIX (Figure 6) since it is not detected with AK1.
The N terminus of GPIb was truncated at residue 49 (middle of
the leucine-rich motif) and replaced with the homologous
region of GPIX, chimera GPIX53/49; this chimera did surface express (Figure 3), but did not complex with, GPIX (Figure 6), as shown by the
negative response when the cells are reacted with AK1. Thus, the
residues 15 through 32 of GPIb are critical for the interaction with GPIX.
| |
Discussion |
It has previously been shown, in experiments using
recombinant expression in mammalian cell lines and in naturally
occurring mutations, that the interaction of GPIb with GPIX is
essential for the normal surface expression of GPIb.8,9
The precise sites of interaction of GPIb and GPIX are not known. To
define the sites of interaction of GPIb with GPIX, we made a new
series of antibodies, which recognize GPIb. We demonstrated that one of these antibodies recognizes an epitope between residues 50 and 80 of
GPIb. We then constructed a series of truncations of GPIb at the
amino terminus. These experiments suggested that the amino terminus was
important for the interaction between GPIb and GPIb. We then
generated a series of chimeras, replacing the N terminus of GPIb
with the corresponding domain of GPIX, and demonstrate that the
cysteine knot region of GPIb is critical for the conformation of
GPIb that interacts with GPIX. Furthermore, we have shown that
residues 15 through 32 of GPIb are critical for the interaction of
GPIb with GPIX.
The secondary structures of GPIX and GPIb have not yet been
defined. It has been suggested that these regions are homologous to
GPIb.5 GPIb has an N-terminal flank with a single
cysteine loop, 7 LRRs, and a C-terminal flanking region
containing 2 disulfide loops. GPIb and GPIX have similar structural
domains, with each containing a single LRR. It is interesting that the
flanking amino acids on both sides of the LRR are homologous in the
proteins of this group. It has been suggested by Hickey et
al20 that the flanking amino acid sequences on both sides
of the region containing the LRR may represent the product of an
ancestral oligonucleotide sequence in which the flanking segments
remained constant and the central LRR underwent duplication. The
results of the present investigation demonstrate a critical role for
the N terminus-flanking region of GPIb with GPIX.
Molecular characterization of the defects in BSS has helped
define critical regions in the GPIb-IX complex. Our previous
investigations have demonstrated that GPIb is essential for the
normal surface expression of GPIX. There are 4 published reports of
mutations within GPIb that cause the BSS
phenotype.9,14,21,22 To date, there have been no
descriptions of point mutations within the N-terminal flanking region
of GPIb that cause the syndrome. In contrast, 2 mutations that cause
BSS have been described within the C-terminal flanking region of
GPIX.23,24 It is unclear why point mutations in
the N-terminal flanking region of GPIX give rise to the BSS phenotype.
One explanation is that the mutation produces an unstable protein that
fails to express. Alternatively, if this region of GPIX can no longer
interact with GPIb, neither GPIb nor GPIX would be detectable on
the platelet surface. In the patient described by Rivera et
al,23 a homozygous T C transition changed
Cys8Arg. The results of our experiments suggest that this region of
GPIX might no longer interact with GPIb, and hence GPIb would not
be expressed on the cell surface. Interestingly, Rivera et al noted
circulating glycocalicin in their patient's plasma. This suggests that
GPIb was being made, yet not inserted in the plasma membrane. We
have noted a similar finding in another BSS patient with a mutation in
GPIb.14 Wright et al24 described 3 patients who were doubly heterozygous for mutations within GPIX. One
mutation was an AG transition in codon 21, and the other was an AG change in codon 45. These mutations changed an Asp to Gly
in the N terminus-flanking region of GPIX and an Asn to Ser within the
LRR. Again, it was not clear how these mutations caused the BSS
phenotype although the authors proposed that these mutations disrupted
the stable assembly of the complex. Our results support their
hypothesis. Mutations in GPIX that result from changes in the codons
for cysteines on either flanking region of the LRR resulted in
BSS.23,25 This mutation probably disrupts the disulfide bonding pattern in the amino terminus and hence altered the secondary structure of GPIX, which disrupts the proper assembly and anchoring of
the complex.23 In the present investigation, we used
chimeras where the cysteine knots of both GPIb and GPIX were
preserved within each of the subunits by swapping precise structural
domains. These results demonstrate the critical importance of this
region for the precise insertion of the whole complex in the plasma membrane.
Dong et al26 investigated assembly and transport of
the entire GPIb complex using transfected mammalian cells. They showed that the full complex was formed within minutes in the endoplasmic reticulum. Surprisingly, they noted that GPIb, even in the complexed form, was highly susceptible to degradation. When GPIb was expressed as a partial complex with either GPIb or GPIX, more than 60% of
GPIb was degraded. In contrast, the partial complex consisting of
GPIb and GPIX was relatively stable. From our previous
investigations on patients with BSS, we have shown that it is the
critical interaction of GPIb with GPIX that brings GPIb to the
surface. The present investigation extends our previous work and the
analysis of complex assembly by Dong et al.26
GPIX mutations appear to disrupt the GPIb/IX structure, as
evidenced by exposure of a cryptic site on GPIb23 and
decreased expression of GPIX thorough its failure to interact with
GPIb.24 Previous investigations on the role of GPIb
have been limited by a paucity of GPIb antibodies. In this
investigation, we made and characterized a novel anti-GPIb antibody.
While the results of this investigation further define the role of
GPIb in assembly of the complex, additional studies are required to
further define the functional role of GPIb.
| |
Footnotes |
Submitted October 31, 2001; accepted February 6, 2002.
Supported by National Institutes of Health grants HL56027,
HL44612, and HL33721 and grants from the Higher Education Authority and
Enterprise Ireland.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Dermot Kenny, MACC Fund Research Center Dept of
Pediatrics, Medical College of Wisconsin, 8701 Watertown Plank Rd, PO
Box 26509, Milwaukee, WI 53226-0509; e-mail: dkenny{at}rcsi.ie.
| |
References |
1.
Wenger RH, Wicki AN, Kieffer N, Adolph S, Hameister H, Clemetson KJ.
The 5' flanking region and chromosomal localization of the gene encoding human platelet glycoprotein Ib.
Gene.
1989;85:517-524[CrossRef][Medline]
[Order article via Infotrieve].
2.
Yagi M, Edelhoff S, Disteche CM, Roth GJ.
Structural characterization and chromosomal location of the gene encoding human platelet glycoprotein Ib.
J Biol Chem.
1994;269:17424-17427[Abstract/Free Full Text].
3.
Hickey MJ, Deaven LL, Roth GJ.
Human platelet glycoprotein IX: characterization of cDNA and localization of the gene to chromosome 3.
FEBS Lett.
1990;274:189-192[CrossRef][Medline]
[Order article via Infotrieve].
4.
Lanza F, Morales M, de La Salle C, et al.
Cloning and characterization of the gene encoding the human platelet glycoprotein V.
J Biol Chem.
1993;268:20801-20807[Abstract/Free Full Text].
5.
López JA.
The platelet glycoprotein Ib-IX complex.
Blood Coagul Fibrinolysis.
1994;5:97-119[Medline]
[Order article via Infotrieve].
6.
López JA, Chung DW, Fujikawa K, Hagen FS, Davie EW, Roth GJ.
The and chains of human platelet glycoprotein Ib are both transmembrane proteins containing a leucine-rich amino acid sequence.
Proc Natl Acad Sci U S A.
1988;85:2135-2139[Abstract/Free Full Text].
7.
Modderman PW, Admiraal LG, Sonnenberg A, von dem Borne AE.
Glycoproteins V and Ib-IX form a noncovalent complex in the platelet membrane.
J Biol Chem.
1992;267:364-369[Abstract/Free Full Text].
8.
López JA, Weisman S, Sanan DA, Sih T, Chambers M, Li CQ.
Glycoprotein (GP) Ib is the critical subunit linking GP Ib and GP IX in the GP Ib-complex.
J Biol Chem.
1994;269:23716-23721[Abstract/Free Full Text].
9.
Kenny D, Morateck PA, Gill JC, Montgomery RR.
The critical interaction of glycoprotein Ib with GPIX: a genetic cause of Bernard-Soulier syndrome.
Blood.
1999;93:2968-2975[Abstract/Free Full Text].
10.
Murata M, Ware J, Ruggeri ZM.
Site-directed mutagenesis of a soluble recombinant fragment of platelet glycoprotein Ib demonstrating negatively charged residues involved in von Willebrand factor binding.
J Biol Chem.
1991;266:15474-15480[Abstract/Free Full Text].
11.
Vincente V, Houghten RA, Ruggeri ZM.
Identification of a site in the alpha chain of platelet glycoprotein Ib that participates in von Willebrand factor binding.
J Biol Chem.
1990;265:274-280[Abstract/Free Full Text].
12.
Ruggeri ZM, Marco LD, Gatti L, Bader R, Montgomery RR.
Platelets have more than one binding site for von Willebrand factor.
J Clin Invest.
1983;72:1-12[Medline]
[Order article via Infotrieve].
13.
Du X, Beutler L, Ruan C, Castaldi PA, Berndt MC.
Glycoprotein Ib and glycoprotein IX are fully complexed in the intact platelet membrane.
Blood.
1987;69:1524-1527[Abstract/Free Full Text].
14.
Moran N, Morateck P, Deering A, et al.
The surface expression of GPIb is dependent on GPIb: evidence from a novel mutation causing Bernard-Soulier syndrome.
Blood.
2000;96:540-545[Abstract/Free Full Text].
15.
Padgett KA, Sorge JA.
Creating seamless junctions independent of restriction sites in PCR cloning.
Gene.
1996;168:31-35[CrossRef][Medline]
[Order article via Infotrieve].
16.
Szybalski W, Kim SC, Hasan N, Podhajska AJ.
Class-IIS restriction enzymes: a review.
Gene.
1991;100:13-26[CrossRef][Medline]
[Order article via Infotrieve].
17.
DuBridge RB, Tang P, Hsia HC, Leong P-M, Miller JH, Calos MP.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.
Mol Cell Biol.
1987;7:379-387[Abstract/Free Full Text].
18.
Laemmli UK.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature.
1970;227:680-685[CrossRef][Medline]
[Order article via Infotrieve].
19.
Towbin H, Staehelin T, Gordon J.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocelluose sheets: procedure and some applications.
Proc Natl Acad Sci U S A.
1979;76:4350-4354[Abstract/Free Full Text].
20.
Hickey MJ, Williams SA, Roth GJ.
Human platelet glycoprotein IX: an adhesive prototype of leucine-rich glycoproteins with flank-center-flank structures.
Proc Natl Acad Sci U S A.
1989;86:6773-6777[Abstract/Free Full Text].
21.
Ludlow LB, Schick BP, Budarf ML, et al.
Identification of a mutation in a GATA binding site of the platelet glycoprotein Ib promoter resulting in the Bernard-Soulier syndrome.
J Biol Chem.
1996;271:22076-22080[Abstract/Free Full Text].
22.
Kunishima S, Lopez JA, Kobayashi S, et al.
Missense mutations of the glycoprotein (GP) Ib gene impairing the GPIb / disulfide linkage in a family with giant platelet disorder.
Blood.
1997;89:2404-2412[Abstract/Free Full Text].
23.
Rivera CE, Villagra J, Riordan M, Williams S, Lindstrom KJ, Rick ME.
Identification of a new mutation in platelet glycoprotein IX (GPIX) in a patient with Bernard-Soulier syndrome.
Br J Haematol.
2001;112:105-108[CrossRef][Medline]
[Order article via Infotrieve].
24.
Wright SD, Michaelides K, Johnson DJD, West NC, Tuddenham EGD.
Double heterozygosity for mutations in the platelet glycoprotein IX gene in three siblings with Bernard-Soulier syndrome.
Blood.
1993;81:2339-2347[Abstract/Free Full Text].
25.
Noda M, Fujimura K, Takafuta T, et al.
A point mutation in glycoprotein IX coding sequence (Cys73{TGT} to Tyr{TAT}) causes impaired surface expression of GPIb/IX/V complex in two families with Bernard-Soulier syndrome.
Thromb Haemost.
1996;76:874-878[Medline]
[Order article via Infotrieve].
26.
Dong J, Gao S, López JA.
Synthesis, assembly, and intracellular transport of the platelet glycoprotein Ib-IX-V complex.
J Biol Chem.
1998;273:31449-31454[Abstract/Free Full Text].
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
X. Mo, N. Lu, A. Padilla, J. A. Lopez, and R. Li
The Transmembrane Domain of Glycoprotein Ibbeta Is Critical to Efficient Expression of Glycoprotein Ib-IX Complex in the Plasma Membrane
J. Biol. Chem.,
August 11, 2006;
281(32):
23050 - 23059.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Simizu, S. Takagi, Y. Tamura, and H. Osada
RECK-Mediated Suppression of Tumor Cell Invasion Is Regulated by Glycosylation in Human Tumor Cell Lines
Cancer Res.,
August 15, 2005;
65(16):
7455 - 7461.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction