Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huntly, B. J. P.
Right arrow Articles by Green, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huntly, B. J. P.
Right arrow Articles by Green, A. R.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

arrow to previous article Previous Article  |  Table of Contents  |  Next Article next article arrow

Blood, 15 June 2002, Vol. 99, No. 12, pp. 4547-4553

NEOPLASIA

Derivative chromosome 9 deletions in chronic myeloid leukemia: poor prognosis is not associated with loss of ABL-BCR expression, elevated BCR-ABL levels, or karyotypic instability

Brian J. P. Huntly, Anthony J. Bench, Eric Delabesse, Alistair G. Reid, Juan Li, Mike A. Scott, Lynda Campbell, Jennie Byrne, Eleanor Pinto, Andre Brizard, Deitger Niedermeiser, Elizabeth P. Nacheva, Francois Guilhot, Michael Deininger, and Anthony R. Green

From the Department of Hematology and the Applied Medical Statistics Department, University of Cambridge, United Kingdom; Victorian Cancer Cytogenetic Service, St Vincent Hospital, Fitzroy, Australia; the Department of Hematology, City Hospital, Nottingham, United Kingdom; the Department of Hematology, University Hospital, Poitiers, France; and the Department of Hematology, University Hospital, Leipzig, Germany.


    Abstract
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

Deletions of the derivative chromosome 9 have recently been reported in chronic myeloid leukemia. These deletions are large, occur at the time of the Philadelphia (Ph) translocation, span the translocation breakpoint, and represent a powerful prognostic indicator. However, the molecular mechanisms responsible for the poor prognosis associated with deletions are obscure, and several possible models are investigated here. First, we demonstrate that all derivative chromosome 9 deletions detected by fluorescence in situ hybridization were associated with an absence of ABL-BCR expression. However, loss of ABL-BCR expression also occurred without an overt deletion, suggesting the existence of other mechanisms by which ABL-BCR transcription can be abolished. Furthermore, analysis of survival in 160 patients demonstrated that loss of ABL-BCR expression, in contrast to deletion status, was not an indicator of poor prognosis. Second, we addressed the possibility that concomitant small deletions of the Ph chromosome modulate BCR-ABL transcription. Real-time reverse-transcription polymerase chain reaction was used to demonstrate that derivative chromosome 9 deletions were not accompanied by altered levels of BCR-ABL transcripts. Third, deletions may represent a consequence of genetic instability within the target cell at the time of the Ph translocation, with the poor prognosis reflecting a predisposition to subsequent additional genetic alterations. However, patients with deletions do not exhibit an increased frequency of secondary cytogenetic changes following disease progression. Taken together, these data support a model in which deletions of the derivative chromosome 9 result in rapid disease progression as a result of the loss of one or more genes within the deleted region. (Blood. 2002;99:4547-4553)

© 2002 by The American Society of Hematology.

    Introduction
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

Chronic myeloid leukemia (CML) is characterized by the formation of the BCR-ABL fusion gene, usually as a consequence of the Philadelphia (Ph) translocation between chromosomes 9 and 22.1-3 Transgenic and retroviral transduction studies have shown that the expression of BCR-ABL in murine bone marrow cells results in leukemia, with some cases resembling CML,4-10 and suggest that BCR-ABL fusion is the initiating event. Furthermore, in one recent transgenic model, the leukemia could be reversed by down-regulating BCR-ABL.11

In contrast to the apparent molecular homogeneity of chronic phase CML, the clinical disease is heterogeneous with marked differences between patients in laboratory and clinical characteristics, including the rate of progression to blast crisis. However, we and others have recently reported previously unsuspected deletions of the derivative chromosome 9.12-17 These deletions are large, have varying breakpoints, and occur at the time of the Ph translocation, thus resulting in considerable genetic heterogeneity from the beginning of the disease.17 Importantly, deletion status is a powerful and independent prognostic factor, and one that is considerably more potent than the Sokal18 or Hasford19 scoring systems.17

In many cases, the derivative chromosome 9 deletions span the translocation breakpoint and are, therefore, likely to result in loss of expression of ABL-BCR, the reciprocal fusion gene formed by the Ph translocation. This observation raises the possibility that loss of ABL-BCR might modulate disease progression, a concept reminiscent of the proposed role of the reciprocal fusion gene in acute promyelocytic leukemia.20,21 In contrast to the wealth of information available on the role of BCR-ABL, relatively little attention has been paid to ABL-BCR. ABL-BCR expression has been reported in about 60% of patients with CML22 and did not correlate with cytogenetic response to interferon-alpha .23 However, there are a number of ways in which ABL-BCR might contribute to the biology of CML. The carboxy terminus of BCR, which is present in the predicted ABL-BCR fusion protein, encodes a domain with the ability to activate guanosine 5'-triphosphatases involved in RAS signaling pathways.24 It has also been suggested that BCR can function as a negative regulator of BCR-ABL.25

The pathogenetic consequences of derivative chromosome 9 deletions may reflect loss of one or more other critical genes within the deleted region, particularly since the deletions are large and frequently span several megabases. Alternatively, it is also possible to envisage 2 other mechanisms by which derivative chromosome 9 deletions may affect prognosis. First, a deletion on the derivative chromosome 9 may act as a surrogate marker for smaller intronic deletions on the Ph chromosome, which could influence the level of BCR-ABL expression. Several lines of evidence suggest that the level of BCR-ABL expression is important in determining the phenotype of BCR-ABL-positive leukemias: an extra Ph chromosome is the most common secondary change seen with development of blast crisis in CML26; the p185 BCR-ABL tyrosine kinase associated with acute lymphocytic leukemia has increased kinase activity when compared with the standard CML p210 protein,27 and an increase in p210 BCR-ABL expression precedes progression to accelerated phase or blast crisis in patients with CML.28 Second, deletions may be associated with poor outcome because they represent a consequence of genetic instability within the target cell at the time of the Ph translocation. In this case, the poor prognosis would reflect a predisposition to subsequent additional genetic alterations within the malignant clone. Patients with chronic phase CML do not exhibit genomic instability as assessed by microsatellite analysis,29,30 but these data do not exclude other levels of genetic instability.

In this manuscript, we have examined these various mechanisms. We provide the first direct comparison of ABL-BCR expression with deletions of the derivative chromosome 9. Our results show that not all ABL-BCR-negative patients have a detectable deletion, suggesting the existence of other mechanisms by which ABL-BCR expression may be abolished, and we demonstrate that ABL-BCR expression itself is not a marker of poor prognosis. Furthermore, we show that deletions are not associated with increased levels of BCR-ABL expression and are not accompanied by increased cytogenetic instability during progression to blast crisis.


    Patients, materials, and methods
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

Patient samples, patient data, and cell lines

Peripheral blood, bone marrow, fixed cytogenetic preparations, and peripheral leukapheresis products were obtained from patients in accordance with local institutional ethical protocols. These patients were diagnosed with BCR-ABL-positive CML between December 1984 and March 2001 and attended the Haematology Departments of Addenbrooke's Hospital Cambridge, United Kingdom; The City Hospital Nottingham, United Kingdom; The University Hospital of Poitiers, France; and The University Hospital, Leipzig, Germany. Clinical outcome and laboratory data were available for 160 of these patients. Risk categories were determined by means of standard methods.18,19 Length of chronic phase was defined as the time from diagnosis until progression to accelerated phase or blast crisis, which were determined as previously.31,32 All patients included in the quantitative BCR-ABL analysis were 100% Ph+ on cytogenetic analysis and a 5 cell-type manual differential was performed on the leukapheresis product in 15 of 16 of these. We studied 3 BCR-ABL-positive cell lines: MEG-01, BV173 (which demonstrates no deletions), and MC3 (which carries a deletion). All of these cell lines were pseudodiploid and possessed 2 copies of the Ph chromosome (data not shown).

Expression analysis of ABL-BCR

RNA extraction from peripheral blood granulocytes and bone marrow and complementary DNA (cDNA) preparation were performed as previously described33 with the following modifications: random hexamers were used (25 mM final concentration), and the final concentration of MgCl2 was 3 mM. Multiplex polymerase chain reaction (PCR) amplification of the undiluted cDNA, with dual amplification of a housekeeping gene, nonerythropoietic porphobilinogen deaminase (PBGD), and ABL-BCR was as described33 with the following modifications: final concentrations of MgCl2 and deoxynucleoside 5'-triphosphates were 2.5 mM and 500 µM, respectively, with 1.5 U Amplitaq Gold (Applied Biosystems, Warrington, United Kingdom) used. We performed 35 cycles of PCR at an annealing temperature of 62°C for 45 seconds.

In 65 patients, ABL-BCR PCR was performed with the use of forward primers from both ABL exon 1b, primer 1bAB (CACGAATTCTGGAAAGGGGTACCTA TTA), and ABL exon 1a, primer 1aAB (TACGGAATTCATGTT GGAGATCTGCCTGAA), together with a reverse primer from BCR exon b5/e16, primer e16AB (CACAGTATCCTCAGGGTCTGGGA) (Figure 1). In the remaining 128 patients, PCR was performed only for the ABL1b-BCR transcript, as expression of an ABL1a-BCR transcript was not seen without concomitant expression of ABL1b-BCR, as has previously been described.22,23,34 The primers used were forward primer ABL1b (TACTTGGGGACCAAAGAAGG) and reverse primer BCR b4 (CAGCTGTGTCCCTGTAGACG) from exon b4/e15 (Figure 1). Primers used for PBGD were PBGD-F (GTCTGGTAACGGCAATGCG) from exon 1 and PBGD-R (CAAACTGCAGGCCAGGGTAC) from exon 4. PCR products were visualized on 2.5% agarose gels following ethidium bromide staining.


View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Probe sets and images for the detection of deletions of the derivative chromosome 9.  (A) Structure of the ABL and BCR loci showing the common breakpoints (arrows) and the probes used in the dual-color, dual-fusion detection system. ASS indicates arginine succinate synthetase; Met8604, Met8604 gene; IGLV, immunoglobulin lambda light chain locus. (B) A representative ABL-BCR (1b-b4) rearrangement is shown on the derivative chromosome 9 with the position of the ABL1b, BCRb4, 1bAB, e16AB, and neste16 primers and the FISH fusion signal. (C) Fluorescence in situ hybridization (FISH) analysis of nondeleted and deleted Ph+ metaphase cells. In both cells, the normal chromosome 9 and 22 demonstrate a single red and green signal, respectively, with a fusion signal present on the Ph+ cell. In the nondeleted cell, the derivative chromosome 9 also demonstrates a fusion signal, but this is missing from the derivative chromosome 9 in the deleted cell.

Samples showing no PCR product after one round of amplification were further analyzed by nested PCR (the initial 65 patients), with the use of the same forward primer and a nested reverse primer, also from exon b5/e16, neste16 (CACAGTATCCTC AGGGTCTGGGA) (Figure 1), or by Southern hybridization (remaining 128 patients) by means of standard methods35 and an ABL-BCR probe generated by PCR from the cell line MEG-1 cDNA with primers ABL1b and BCRb4.

Quantitative reverse-transcription PCR for BCR-ABL

Quantitative reverse-transcription PCR (RT-PCR) for BCR-ABL was performed by means of the Taqman method on a 7700 sequence detection system (Applied Biosystems). Total RNA was extracted from peripheral blood leukapheresis samples and cell lines with the use of TRI-reagent, as above. Then, 2 µg RNA was reverse transcribed with the use of 25 mM random hexamers and 200 U M-MLV RT at 42°C for 45 minutes. Real-time PCR was then performed in a final volume of 25 µL containing 2 µL cDNA, 1.3 µM each primer, 400 nM the fluorescent internal probe, and 1 × Taqman universal master-mix (Applied Biosystems). Primers and probe for BCR-ABL were BCR-F (TGACCAACTCGTGTGTGAAACTC), ABL-R (GGGTCCAGCGAGAAGGTTTT), and ABL-P (AGCGGCCAGTAGCATCTGACTTTGAGC), respectively. Primers and probe for the control gene beta 2-microglobulin, B2M, were B2M-F (CCTGCCGTGTTGAACCATGT), B2M-R (CGGCATCTTCAAACCTCCAT), and B2M-P (ACATGTCTCGATCCCACTTAACTATCTTGGGCT), respectively. The threshold was set at a Delta Rn value of 0.2, between 3 and 12 cycles, for each Taqman plate.

To correct for potential differences in the cDNA, BCR-ABL expression in each sample was compared with the expression of the control gene B2M for that sample by subtracting the threshold cycle, CT, of the control gene from that of BCR-ABL to obtain the Delta  CT. This allowed the quantification of BCR-ABL transcripts, expressed as a percentage relative to the control gene, by the equation, % of control gene = (1 + E)-Delta CT, where E equals the efficiency of the PCR reaction (which was deduced from a K562 standard curve and was 0.93). Each sample value was determined in triplicate for BCR-ABL and in duplicate for B2M.

Fluorescence in situ hybridization detection of deletions and cytogenetic comparison of secondary changes occurring with blast crisis

Fluorescence in situ hybridization (FISH) detection of deletions was performed and interpreted as previously described17 with the use of the BCR/ABL dual-color, dual-fusion probe (Vysis, Downers Grove, IL) (Figure 1) following the manufacturer's instructions. Cytogenetic analysis, performed on a minimum of 20 metaphases by means of conventional methods,36 was available for a total of 84 patients at the time of their progression to blast crisis. The deletion status of these patients was known, with 37 patients taken from the above cohort of 193 patients and the remaining 47 from our previously reported cohort.17

Statistical analysis

All calculations were performed with the SPSS (Chicago, IL) statistical package. Survival time was calculated, with a median follow-up of 39 months (range, 3-206 months), with patients censored as previously.17 Survival data and length of chronic phase comparisons were as previously used.17

In the patients for whom cytogenetic analysis was available at the time of progression to blast crisis, the proportion of patients with secondary changes who carried deletions and the proportion with changes lacking deletions were compared by Fisher exact test. The mean and median number of total secondary changes and double-stranded breaks, along with the interquartile range, were calculated for patients with and without deletions. Any differences were compared by the Mann-Whitney U test. For BCR-ABL expression, the proportion of CD34+ cells, blasts, promyelocytes, or myelocytes in the leukapheresis product were compared by the Mann-Whitney U test between patients who carried or lacked deletions. The median and mean levels of BCR-ABL transcripts, along with the interquartile range, were calculated for patients with deletions and for those who lacked them. Any differences in expression levels were compared by the Mann-Whitney U test.


    Results
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

Comparison of ABL-BCR expression with deletion of the derivative chromosome 9

Expression of the ABL-BCR transcript was determined by RT-PCR in samples from 193 patients with CML (56% in chronic phase, 27% in accelerated phase, and 17% in blast crisis). Patients with a major or complete cytogenetic remission were excluded from analysis. BCR-ABL transcripts were detected in each sample. Expression of ABL-BCR was detected in 128 patients (66%) and was absent in 65 patients (34%) (Figure 2), a prevalence similar to previous results.22,23 All ABL-BCR samples negative on first-round PCR were confirmed either by Southern blotting of the PCR products (Figure 2) or by a second round of PCR with nested primers.


View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. Detection of the ABL-BCR transcript by RT-PCR and Southern blotting. Ethidium bromide-stained agarose gels (panel A) and Southern blots (panel B) from the same patients were run on different gels. Lanes 4-11 show nondeleted patients; lanes 16-23, deleted patients. Lanes 1 and 13 show HL6O (BCR-ABL-negative) cell line; lanes 2 and 14, Meg-1 cell line; lanes 3 and 15, LAMA cell line, lanes 12 and 24, water control. 1b-b3 indicates ABL1b-BCRb3 transcript; 1b-b4, ABL1b-BCRb4 transcript; PBGD, porphobilinogen deaminase transcript.

To compare ABL-BCR expression with the presence of derivative chromosome 9 deletions, FISH analysis was performed on all cytogenetic preparations available from patients lacking ABL-BCR expression (n = 55) and also on samples from 50 ABL-BCR-positive patients by means of a dual-color system that detects both reciprocal translocation products (Figure 1). Of the 55 ABL-BCR-negative patients, 19 (35%) exhibited deletions detectable by FISH, whereas 36 (65%) lacked such deletions. Fourteen patients demonstrated deletions of both chromosome 9 and chromosome 22 sequences; 3 patients had deletions of only 9 sequences; and 2 patients had deletions of only 22 sequences (data not shown). By contrast, of 50 ABL-BCR-positive patients, none had a deletion detectable by FISH. The presence of ABL-BCR transcripts can therefore be used to identify patients lacking such deletions (negative predictive value, 100%; 95% confidence interval [CI], 93%-100%).

Lack of expression of ABL-BCR does not explain the poor prognosis associated with deletions

All patients with a derivative chromosome 9 deletion lacked ABL-BCR expression, which might account for the poor prognosis associated with such deletions. To address this issue directly, we compared the survival and length of chronic phase of ABL-BCR-negative and ABL-BCR-positive patients. Clinical outcome data were available for 160 patients (103 ABL-BCR positive and 57 ABL-BCR negative). The clinical and laboratory characteristics at diagnosis are shown in Table 1 and are similar for the 2 groups. The only significant difference is in the proportion of patients with splenomegaly, which is greater in those who did not express the transcript (P = .006). However, this difference did not translate into a significant increase in the number of patients classified as high risk by either the Sokal or the Hasford scoring systems.

                              
View this table:
[in this window]
[in a new window]
 
Table 1. Patient characteristics at diagnosis and at end of study

Consistent with previous reports,15-17 in the 149 patients for whom the deletion status was known (or inferred from the presence of ABL-BCR transcripts), there was a significant difference in the survival of the patients with deletions compared with those lacking a detectable deletion (Figure 3A). The estimated median survival for patients with a deletion was 67 months (95% CI, 53-73 months) whereas the median survival for patients without a deletion could not be calculated, as more than 50% of patients were still alive. This difference was significant by log-rank analysis (P = .03). By contrast, the estimated median survival for patients who did not express the ABL-BCR transcript was 131 months (95% CI, 64-198 months), while the estimated median survival for patients who expressed the transcript could not be calculated, as more than 50% were still alive. This difference was not significant by log-rank analysis (P = .42) (Figure 3B).


View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Kaplan-Meier analysis of survival and length of chronic phase comparing patients by deletion status and ABL-BCR expression. For ABL-BCR expression, calculations were performed for survival and length of chronic phase with the use of data for 160 and 159 patients, respectively; for deletion status, calculations were performed for 149 and 148 patients, respectively. The significance of any survival difference was assessed by log-rank analysis. Patients who underwent allogeneic stem cell transplantation and patients who died of causes unrelated to CML were censored at the time of the procedure or death, respectively. Separate Kaplan-Meier graphs are shown for survival according to deletion status (panel A) or ABL-BCR expression (panel B) and for length of chronic phase according to deletion status (panel C) or ABL-BCR expression (panel D).

The estimated median length of chronic phase for patients with deletions was 44 months (95% CI, 14-73 months), compared with 84 months (95% CI, 65-103 months) for patients without deletions. This difference was significant by log-rank analysis (P = .02) (Figure 3C). By contrast, the estimated median length of chronic phase was 65 months (95% CI, 55-75 months) for ABL-BCR-negative patients and 79 months (95% CI, 63-94 months) for ABL-BCR-positive patients (Figure 3D). This difference was not significant by log-rank analysis (P = .23). Exclusion of patients with a deletion from the latter comparison resulted in an increase in the estimated length of chronic phase in ABL-BCR-negative patients to 92 months (95% CI, 53-130 months).

These results demonstrate that lack of ABL-BCR expression itself is not an indicator of poor prognosis and therefore suggest that deletions of the derivative chromosome 9 confer a poor prognosis by an alternative mechanism.

Derivative chromosome 9 deletions are not associated with increased levels of BCR-ABL transcripts

BCR-ABL transcripts were quantitated in diagnostic samples and compared between patients according to deletion status. Real-time RT-PCR was used to measure BCR-ABL and B2M transcript levels in 3 cell lines (1 deleted and 2 nondeleted) and in samples obtained from 16 patients (4 deleted and 12 nondeleted). There was no significant difference between samples from deleted and nondeleted patients in the proportion of CD34+ cells, blasts, promyelocytes, or myelocytes (Mann-Whitney U test, P = .90, P = .84, P = .43, and P = .56, respectively). As shown in Table 2 the levels of BCR-ABL transcripts were not increased in the cell line carrying a derivative 9 deletion compared with the 2 cell lines that lacked a deletion. Moreover, there was no significant difference in the levels of BCR-ABL transcripts (expressed as a percentage of the control gene) or in the Delta CT values obtained for patients with a deletion compared with those lacking a deletion by Mann-Whitney U test (P = 1.00) (Table 2). These results demonstrate that deletion of the derivative chromosome 9 is not consistently accompanied by an increase in BCR-ABL expression.

                              
View this table:
[in this window]
[in a new window]
 
Table 2. There are no differences in expression of the BCR-ABL transcript between patients with and without deletions

Derivative chromosome 9 deletions are not associated with increased karyotypic instability

To address the possibility of an increased karyotypic instability accompanying derivative chromosome 9 deletions, we have analyzed the karyotype of 84 patients following progression to blast crisis (16 patients with deletions and 68 patients without deletions). A summary of the results is presented in Table 3. The proportion of patients with secondary cytogenetic changes was 51 of 68 (75%) for patients without deletions and 12 of 16 (75%) for patients with deletions (Fisher exact test, P = 1.00). There was also no difference in the prevalence of individual specific chromosomal changes (Table 3), although the numbers in each case are small. The mean and median total number of changes per patient was 2.2 and 1.0, respectively (interquartile range, 0.25-3.0), for patients without deletions and 1.9 and 2.0, respectively (interquartile range, 0.25-2.75) for patients with deletions. There was no significant difference by Mann-Whitney U test (P = .86). The mean and median number of double-stranded breaks was 0.9 and 1.0 (interquartile range, 0-1) for patients without deletions and 1.1 and 1.0 (interquartile range, 0-1) for patients with deletions. Again, there was no significant difference by Mann-Whitney U test (P = .62). These data therefore suggest that patients with deletions do not have an increased tendency to develop additional cytogenetic alterations.

                              
View this table:
[in this window]
[in a new window]
 
Table 3. Incidence of chromosomal abnormalities in patients with and without deletions upon development of blast crisis


    Discussion
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

Large deletions of the derivative chromosome 9 occur at the time of the Ph translocation,17 usually span the translocation breakpoint,15 and represent a powerful indicator of poor prognosis.16,17 In this paper, we have investigated several potential mechanisms by which such deletions might result in rapid disease progression.

Our results demonstrate that all patients with a deletion detectable by dual-fusion FISH lacked expression of ABL-BCR. This result is consistent with our previous demonstration that deletions span the translocation breakpoint on the derivative chromosome 9.15 However, our data also show that 65% of patients lacking ABL-BCR expression do not have a deletion detectable by FISH. This observation suggests the existence of other mechanisms by which ABL-BCR transcription can be abolished. It is likely that small deletions occur that would abolish ABL-BCR transcription but that would be below the threshold of detection for the dual-fusion FISH and other, similar FISH-based techniques that use large probes. This would be consistent with previous evidence for small deletions adjacent to the translocation breakpoints in CML and other leukemias.37-42 In addition, approximately 10% of patients have a breakpoint on the derivative chromosome 9 that is upstream of ABL exon 1b, and that therefore removes both sites at which ABL transcription is normally initiated.43,44 Finally, some patients with a variant Ph translocation have 5' ABL and 3' BCR sequences present on separate chromosomes, suggesting that an ABL-BCR transcript would not be formed.45

We also show that loss of ABL-BCR transcription is not associated with reduced survival or reduced length of chronic phase. This demonstrates that lack of ABL-BCR expression is not sufficient for the poor prognosis associated with overt derivative chromosome 9 deletions. However, our results do not exclude the possibility that lack of ABL-BCR expression may be necessary for deletions to confer a poor outcome. It is conceivable that the ABL-BCR protein could directly or indirectly modulate activity of the BCR-ABL protein.24,25 However, existence of a stable ABL-BCR protein product has not yet been demonstrated.46

One important practical aspect of our results is that it demonstrates that all patients with ABL-BCR transcripts lack a deletion detectable by dual fusion FISH. RT-PCR for ABL-BCR can therefore be used as a rapid and inexpensive screen, with a high predictive value, to identify the majority of patients who lack an overt derivative chromosome 9 deletion and who therefore fall into a good prognostic category. FISH could be subsequently used to study the 30% to 40% of patients who lack ABL-BCR transcripts, in order to identify the subset who have an overt deletion and who therefore have a poor prognosis.

In addition to loss of ABL-BCR expression, we have also investigated 2 other potential mechanisms that could account for the association between derivative chromosome 9 deletions and rapid disease progression. First, it is possible that translocations that result in deletions on the derivative chromosome 9 will also be accompanied by deletions of the Ph chromosome. Such deletions would need to be small enough to permit formation of a BCR-ABL transcript but could nonetheless remove regulatory elements and thereby modulate BCR-ABL transcription. There are several examples of small deletions adjacent to the breakpoint of reciprocal translocations in CML and other leukemias,37-42 and small deletions on both derivative chromosomes have also been shown in constitutional reciprocal translocations.47 Moreover, increased levels of BCR-ABL transcripts are associated with progression to blast crisis.26,28 However, our results argue against this model since patients with and without deletions do not have discernibly different levels of BCR-ABL transcripts.

Second, it is also possible that large deletions may represent the consequence of a translocation occurring in a target cell with an inherent predisposition to chromosome rearrangements. In this model, the deletion would not represent the cause of the poor prognosis but would reflect the underlying chromosome instability. The fact that deletions occur in a subset of patients could reflect heterogeneity within the stem cell compartment and/or differences among individuals. However, our results do not provide any evidence for increased chromosome instability in patients with derivative chromosome 9 deletion.

Taken together, the results presented here strongly suggest that derivative chromosome 9 deletions are associated with a poor prognosis as a consequence of the loss of one or more genes within the deleted region. The biological consequence of the deletion could be a direct effect of haploinsufficiency or a consequence of one or more "second hits" affecting the remaining normal alleles. The deletions are large, extending up to 5.5 megabase (Mb) on the chromosome 9 side of the translocation breakpoint, and up to 17 Mb on the chromosome 22 side. Existing data do not allow us to ascertain whether the critical region involves chromosome 9 sequences, chromosome 22 sequences, or both. Each of these regions is gene rich, and between them, the regions contain approximately 300 genes. Our data therefore lay the foundation for a systematic search for critical target genes in the corresponding regions of chromosome 9 and 22.


    Acknowledgments

We are grateful to Emma Frith, Kevin Jestice, Ian Carter, Kate Martin, Francoise Brizard, Laurence Daheron, and Eveline Hennig for assistance with samples.


    Footnotes

Submitted October 30, 2001; accepted February 5, 2002.

Supported by a Medical Research Council (United Kingdom) Clinical Training Fellowship (B.J.P.H.); the Association pour la Recherche sur le Cancer (E.D.), the Fondation de France (Comite Leucemie) (E.D.); and the Pre-Leukaemia Society (E.D.); work in the authors' laboratories is funded by the Leukemia Research Fund and the Kay Kendall Leukemia Fund.

The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.

Reprints: Anthony R. Green, Dept of Hematology, University of Cambridge, Wellcome Trust/MRC Bldg, Hills Rd, Cambridge, CB2 2XY, United Kingdom; e-mail: arg1000{at}cam.ac.uk.


    References
Top
Abstract
Introduction
Patients, materials, and...
Results
Discussion
References

1. Rowley JD. A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature. 1973;243:290-293[CrossRef][Medline] [Order article via Infotrieve].

2. Bartram C, de Klein A, Hagemeijer A. Translocation of c-abl oncogene correlates with the presence of the Philadelphia chromosome in chronic myelocytic leukaemia. Nature. 1983;306:277-280[CrossRef][Medline] [Order article via Infotrieve].

3. Groffen J, Stephenson J, Heisterkamp N, de Klein A, Bartram C, Grosveld G. Philadelphia chromosome breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell. 1984;36:93-99[CrossRef][Medline] [Order article via Infotrieve].

4. Daley G, Van Etten R, Baltimore D. Induction of chronic myelogenous leukemia in mice by the p210bcr/abl gene of the Philadelphia chromosome. Science. 1990;247:824-830[Abstract/Free Full Text].

5. Heisterkamp N, Jenster G, ten Hoeve J, Zovich D, Pattengale P, Goffen J. Acute leukemia in bcr-abl transgenic mice. Nature. 1990;344:251-253[CrossRef][Medline] [Order article via Infotrieve].

6. Elefanty A, Hariharan I, Cory S. BCR-ABL, the hallmark of chronic myeloid leukaemia in man, induces multiple haemopoietic neoplasms in mice. EMBO J. 1990;9:1069-1078[Medline] [Order article via Infotrieve].

7. Voncken J, Kaartinen V, Pattengale P, Germeraad W, Groffen J, Heisterkamp N. BCR/ABL p210 and p190 cause distinct leukemia in transgenic mice. Blood. 1995;86:4603-4611[Abstract/Free Full Text].

8. Zhang X, Ren R. Bcr-abl efficiently induces a myeloproliferative disease and production of excess interleukin-3 and granulocyte-macrophage colony-stimulating factor in mice: a novel model for chronic myelogenous leukaemia. Blood. 1998;92:3829-3840[Abstract/Free Full Text].

9. Pear W, Miller J, Xu L, et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving p210 bcr/abl transduced bone marrow. Blood. 1998;92:3780-3792[Abstract/Free Full Text].

10. Honda H, Oda H, Takahiro S, et al. Development of acute lymphoblastic leukemia and myeloproliferative disorder in transgenic mice expressing p210bcr/abl: a novel transgenic model for human Ph1-positive leukemias. Blood. 1998;91:2067-2075[Abstract/Free Full Text].

11. Huettner C, Zhang P, Van Etten R, Tenen D. Reversibility of acute B-cell leukemia induced by BCR-ABL1. Nat Genet. 2000;24:57-60[CrossRef][Medline] [Order article via Infotrieve].

12. Grand F, Kulkarni S, Chase A, Goldman JM, Cross NCP. Frequent deletion of hSNF5/INI1, a component of the SWI/SNF complex, in chronic myeloid leukaemia. Cancer Res. 1999;59:3870-3874[Abstract/Free Full Text].

13. Dewald G, Wyatt W, Silver R. Atypical BCR and ABL D-FISH patterns in chronic myeloid leukemia and their possible role in therapy. Leuk Lymphoma. 1999;34:481-491[Medline] [Order article via Infotrieve].

14. Herens C, Tassin F, Lemaire V, et al. Deletion of the 5'-ABL region: a recurrent anomaly detected by flourescence in situ hybridisation in about 10% of Philadelphia-positive chronic myeloid leukaemia patients. Br J Haematol. 2000;110:214-216[CrossRef][Medline] [Order article via Infotrieve].

15. Sinclair PB, Nacheva EP, Laversha M, et al. Large deletions at the t(9;22) breakpoint are common and may identify a poor-prognosis subgroup of patients with chronic myeloid leukaemia. Blood. 2000;95:738-744[Abstract/Free Full Text].

16. Kolomietz E, Al-Maghrabi J, Brennan S, et al. Primary chromosomal rearrangements of leukemia are frequently accompanied by extensive submicroscopic deletions and may lead to altered prognosis. Blood. 2001;97:3581-3588[Abstract/Free Full Text].

17. Huntly B, Reid A, Bench A, et al. Deletions of the derivative chromosome 9 occur at the time of the Philadelphia translocation and provide a powerful and independent prognostic factor in chronic myeloid leukaemia. Blood. 2001;98:1732-1738[Abstract/Free Full Text].

18. Sokal J, Cox E, Baccarini M. Prognostic discrimination in "good risk" chronic granulocytic leukemia. Blood. 1984;63:789-799[Abstract/Free Full Text].

19. Hasford J, Pfirrmann M, Hehlmann R, et al. A new prognostic score for survival of patients with chronic myeloid leukemia treated with interferon alpha. J Natl Cancer Inst. 1998;90:850-858[Abstract/Free Full Text].

20. He L, Bhaumik M, Tribioli C, et al. Two critical hits for promyelocytic leukemia. Mol Cell. 2000;6:1131-1141[CrossRef][Medline] [Order article via Infotrieve].

21. Pollock JL, Westervelt P, Kurichety AK, Pelicci PG, Grisolano JL, Ley TJ. A bcr-3 isoform of RARalpha-PML potentiates the development of PML-RARalpha-driven acute promyelocytic leukemia. Proc Natl Acad Sci U S A. 1999;96:15103-15108[Abstract/Free Full Text].

22. Melo J, Gordon D, Cross N, Goldman J. The ABL-BCR fusion gene is expressed in chronic myeloid leukemia. Blood. 1993;81:158-165[Abstract/Free Full Text].

23. Melo J, Hochhaus A, Yan X-H, Goldman J. Lack of correlation between ABL-BCR expression and response to interferon-alpha in chronic myeloid leukaemia. Br J Haematol. 1996;92:684-686[CrossRef][Medline] [Order article via Infotrieve].

24. Diekmann D, Brill S, Garrett MD. BCR encodes a GTPase-activating protein for p21rac. Nature. 1991;351:400-402[CrossRef][Medline] [Order article via Infotrieve].

25. Wu Y, Ma G, Lu D, et al. Bcr: a negative regulator of the Bcr-Abl oncoprotein. Oncogene. 1999;18:4416-4424[CrossRef][Medline] [Order article via Infotrieve].

26. Bernstein R. Cytogenetics of chronic myelogenous leukemia. Semin Hematol. 1988;25:20-34[Medline] [Order article via Infotrieve].

27. Clark SS, McLaughlin J, Timmons M, et al. Expression of a distinctive BCR-ABL oncogene in Ph1-positive acute lymphocytic leukemia (ALL). Science. 1988;239:775-777[Abstract/Free Full Text].

28. Gaiger A, Henn T, Horth E, et al. Increase of bcr-abl chimeric mRNA expression in tumor cells of patients with chronic myeloid leukemia precedes disease progression. Blood. 1995;86:2371-2378[Abstract/Free Full Text].

29. Wada C, Shionoya S, Fujino Y, et al. Genomic instability of microsatellite repeats and its association with the evolution of chronic myelogenous leukemia. Blood. 1994;83:3449-3456[Abstract/Free Full Text].

30. Silly H, Chase A, Mills K, et al. No evidence for microsatellite instability or consistent loss of heterozygosity at selected loci in chronic myeloid leukaemia blast crisis. Leukemia. 1994;8:1923-1928[Medline] [Order article via Infotrieve].

31. Kantarjian HM, Keating MJ, Talpaz M, et al. Chronic myelogenous leukemia in blast crisis: analysis of 242 patients. Am J Med. 1987;83:445-454[CrossRef][Medline] [Order article via Infotrieve].

32. Kantarjian HM, Dixon D, Keating MJ, et al. Characteristics of accelerated disease in chronic myelogenous leukemia. Cancer. 1988;61:1441-1446[CrossRef][Medline] [Order article via Infotrieve].

33. Bench A, Nacheva E, Hood T, et al. Chromosome 20 deletions in myeloid malignancies: reduction of the common deleted region, generation of a PAC contig and identification of candidate genes. Oncogene. 2000;19:3902-3913[CrossRef][Medline] [Order article via Infotrieve].

34. Uphoff CC, Habig S, Fombonne S, Matsuo Y, Drexler HG. ABL-BCR expression in BCR-ABL-positive human leukemia cell lines. Leuk Res. 1999;23:1055-1060[CrossRef][Medline] [Order article via Infotrieve].

35. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.

36. Nacheva E, Grace C, Holloway TL, Green AR. Comparative genomic hybridization in acute myeloid leukaemia: a comparison with G-banding and chromosome painting. Cancer Genet Cytogenet. 1995;82:9-16[CrossRef][Medline] [Order article via Infotrieve].

37. Shtalrid M, Talpaz M, Kurzrock R, et al. Analysis of breakpoints within the bcr gene and their correlation with the clinical course of Philadelphia-positive chronic myelogenous leukemia. Blood. 1988;72:485-490[Abstract/Free Full Text].

38. Popenoe D, Schaefer-Rego K, Mears J, Bank A, Leibowitz D. Frequent and extensive deletion during the 9;22 translocation in CML. Blood. 1986;68:1123-1128[Abstract/Free Full Text].

39. Zhang JG, Goldman JM, Cross NC. Characterization of genomic BCR-ABL breakpoints in chronic myeloid leukaemia by PCR. Br J Haematol. 1995;90:138-146[Medline] [Order article via Infotrieve].

40. Marlton P, Claxton D, Liu P, et al. Molecular characterisation of 16p deletions associated with inversion 16 defines the critical fusion for leukemogenesis. Blood. 1995;85:772-779[Abstract/Free Full Text].

41. Kuss B, Deeley R, Cole S, et al. Deletion of a gene for multidrug resistance in acute myeloid leukaemia with inversion in chromosome 16: prognostic implications. Lancet. 1994;343:1531-1534[CrossRef][Medline] [Order article via Infotrieve].

42. Shimizu K, Miyoshi H, Kozu T. Consistent disruption of the AML-1 gene occurs within a single intron in the t(8;21) chromosomal translocation. Cancer Res. 1992;52:6945-6948[Abstract/Free Full Text].

43. Jiang XY, Trujillo JM, Liang JC. Chromosomal breakpoints within the first intron of the ABL gene are nonrandom in patients with chronic myelogenous leukemia. Blood. 1990;76:597-601[Abstract/Free Full Text].

44. Chissoe SL, Bodenteich A, Wang YF, et al. Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation. Genomics. 1995;27:67-82[CrossRef][Medline] [Order article via Infotrieve].

45. Reid A, Gribble SM, Huntly BJ, et al. Variant Philadelphia translocations in chronic myeloid leukaemia can mimic typical blast crisis chromosome abnormalities or classic t(9;22): a report of two cases. Br J Haematol. 2001;113:439-442[CrossRef][Medline] [Order article via Infotrieve].

46. Melo J. BCR-ABL gene variants. In: Goldman J, ed. Chronic Myeloid Leukaemia. London, United Kingdom: Baillière Tindall; 1997:203-222.

47. Edelmann L, Spiteri E, Koren K, et al. AT-rich palindromes mediate the constitutional t(11;22) translocation. Am J Hum Genet. 2001;68:1-13[CrossRef][Medline] [Order article via Infotrieve].

© 2002 by The American Society of Hematology.
 

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
S. Kreil, M. Pfirrmann, C. Haferlach, K. Waghorn, A. Chase, R. Hehlmann, A. Reiter, A. Hochhaus, N. C. P. Cross, and for the German Chronic Myelogenous Leukemia (CML)
Heterogeneous prognostic impact of derivative chromosome 9 deletions in chronic myelogenous leukemia
Blood, August 15, 2007; 110(4): 1283 - 1290.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. P. Radich
The Biology of CML Blast Crisis
Hematology, January 1, 2007; 2007(1): 384 - 391.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. White, V. Saunders, A. B. Lyons, S. Branford, A. Grigg, L. B. To, and T. Hughes
In vitro sensitivity to imatinib-induced inhibition of ABL kinase activity is predictive of molecular response in patients with de novo CML
Blood, October 1, 2005; 106(7): 2520 - 2526.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Delabesse, S. Ogilvy, M. A. Chapman, S. G. Piltz, B. Gottgens, and A. R. Green
Transcriptional Regulation of the SCL Locus: Identification of an Enhancer That Targets the Primitive Erythroid Lineage In Vivo
Mol. Cell. Biol., June 15, 2005; 25(12): 5215 - 5225.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Quintas-Cardama, H. Kantarjian, M. Talpaz, S. O'Brien, G. Garcia-Manero, S. Verstovsek, M. B. Rios, K. Hayes, A. Glassman, B. N. Bekele, et al.
Imatinib mesylate therapy may overcome the poor prognostic significance of deletions of derivative chromosome 9 in patients with chronic myelogenous leukemia
Blood, March 15, 2005; 105(6): 2281 - 2286.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. J. P. Huntly, F. Guilhot, A. G. Reid, G. Vassiliou, E. Hennig, C. Franke, J. Byrne, A. Brizard, D. Niederwieser, J. Freeman-Edward, et al.
Imatinib improves but may not fully reverse the poor prognosis of patients with CML with derivative chromosome 9 deletions
Blood, September 15, 2003; 102(6): 2205 - 2212.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. J. P. Huntly, A. Bench, and A. R. Green
Double jeopardy from a single translocation: deletions of the derivative chromosome 9 in chronic myeloid leukemia
Blood, August 15, 2003; 102(4): 1160 - 1168.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
T S K Wan, S K Ma, W Y Au, and L C Chan
Derivative chromosome 9 deletions in chronic myeloid leukaemia: interpretation of atypical D-FISH pattern
J. Clin. Pathol., June 1, 2003; 56(6): 471 - 474.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huntly, B. J. P.
Right arrow Articles by Green, A. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huntly, B. J. P.
Right arrow Articles by Green, A. R.
Related Collections
Right arrow Neoplasia
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020