|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Divisions of Clinical Research and Basic
Sciences, Fred Hutchinson Cancer Research Center (FHCRC), Seattle, WA.
A promising and increasingly exploited property of hematopoietic
stem cells is their ability to efflux the fluorescent dye Hoechst
33342. The Hoechst-negative cells are isolated by
fluorescence-activated cell sorting as a so-called side
"population" (SP) of bone marrow. This SP from bone marrow, as well
as other tissues, is reported to contain immature stem cells with
considerable plasticity. Some cell lines also efflux Hoechst and
generate SP profiles. Reverse transcription-polymerase chain reaction
(RT-PCR) and efflux inhibition studies with the lung carcinoma cell
line, A549, implicated the ABCG2 transporter as a Hoechst
efflux pump. Furthermore, it is shown that transient expression
of ABCG2 generates a robust SP phenotype in human embryonic
kidney (HEK293) cells. The results allow the conclusion that
ABCG2 is a potent Hoechst efflux pump. Semiquantitative
RT-PCR was used to characterize the developmental pattern of expression
of ABCG2 in hematopoiesis. It is expressed at relatively
high levels in putative hematopoietic stem cells (isolated as SP,
34+/38 The ability of early hematopoietic progenitors to
efflux certain fluorescent dyes such as rhodamine 123 and Hoechst 33342 has long been appreciated and exploited for the isolation of these cells by fluorescence-activated cell sorting (FACS).1-3
More recently, one method has proven to be especially useful for the isolation of the most primitive bone marrow cells from a number of
different species.4 This method relies on incubating the target cell population with the fluorescent dye Hoechst 33342 and
subsequent FACS analysis of dual-wavelength Hoechst fluorescence with
gating on a specific side population displaying low red and low blue
fluorescence. Hence, the isolated cells are termed side-population (SP)
cells. This low-staining SP is lost after treatment with verapamil,
which has led to the assumption that the MDR1-encoded adenosine triphosphate-binding cassette (ABC) transporter,
P-glycoprotein (P-gp), is responsible for Hoechst dye efflux in these
cells.4
Recently, excitement has been generated by the finding that putative
stem cells from solid tissues may also share this SP phenotype.5-7 Moreover, the degree of efflux activity
seems to correlate with the maturation state, such that cells
exhibiting the highest efflux activity are the most
primitive.8 Aside from its value in stem cell
purification, the dye efflux phenomenon raises 2 important questions:
(1) what are the biochemical mechanisms by which it is produced in SP
cells and (2) what physiologic roles do such export activities play in
stem cells?
The multidrug-resistance gene, MDR1, is the best-studied
member of the ABC transporter super-family of genes. The products of
these genes are transmembrane proteins involved in energy-dependent transport of a wide spectrum of substrates across
membranes.9,10 Currently, more than 30 members have been
identified in humans.11 To date, most drug efflux
phenomena have been ascribed to expression of
MDR1.12 Due to known Hoechst transport activity
of MDR1,13 and to the expression of
MDR1 in early hematopoietic progenitor cells,14,15 the export activity in stem cells has largely
been attributed to MDR1.4,14,16,17
MDR1 is only one of many candidate transporters for Hoechst.
Members of the B, C, and G families of the ABC transport super-family are all associated with multidrug resistance and exhibit overlapping substrate specificities. Of particular importance here, they possess the ability to efflux broad and overlapping ranges of lipophilic molecules, a category that includes Hoechst.18 A careful
review of the literature revealed that the efflux activity of rhodamine in murine hematopoietic stem cells is only partially blocked by the
MDR1 inhibitor, verapamil. In fact, the murine long-term
repopulating cells, considered to be the most primitive stem cells, are
isolated on the basis of rhodamine efflux (Rho Given that the transporter activity causing the efflux phenotype is
important for the isolation of stem cells and hypothetically may play
an important physiologic role in stem cell function, we have addressed
the genetic and biochemical identity of this activity. In this study,
we demonstrate that a strong SP phenotype is exhibited in the A549 cell
line and that the inhibitor profile of this activity correlates better
with the G family member, ABCG2 (ABCP/BCRP/MXR) than
MDR1 activity. Transfection experiments establish that
ABCG2 is necessary and sufficient to generate the SP
phenotype in human embryonic kidney (HEK293) cells. Furthermore, we
show that the expression of ABCG2 is restricted to the most
immature hematopoietic progenitors in human bone marrow and is sharply down-regulated at the committed progenitor level, consistent with an in
vivo role for this transporter in immature cells. Direct comparison of
messenger RNA (mRNA) levels for ABCG2, MDR1, and MRP1 reveals that ABCG2 is the predominant form
in bone marrow SP cells, indicating that it probably plays a major role
in the characteristic Hoechst efflux capacity of these cells.
Cell culture
Hoechst efflux studies
Fluorescent microscopy The 293 cells were transfected with the bicistronic vectors using FUGENE (Roche Molecular Biochemicals, Indianapolis, IN). Forty-eight hours after transfection, cells were trypsinized and plated on fibronectin-coated chamber slides (Nunc, Naperville, IL) and allowed to adhere overnight. Sixty-four hours after transfection, cells were stained with Hoechst under the same conditions as described above and examined using a Deltavision Microscope Zeiss Axiovert 100 (Applied Precision, Issaquah, WA). Images were captured using 360/40 and 457/20 filters (Hoechst), and 490/20 and 529/38 (green fluorescent protein [GFP]), for excitation and emission, respectively. The software used for capturing and viewing images was SoftWoRx 2.50 (Applied Precision). Images were subsequently deconvolved mathematically.21 Data are presented as representative optical sections.Flow sorting of hematopoietic cells Aliquots of normal bone marrow were diverted for research purposes from aspirated marrow collected from 15 healthy adult marrow transplant donors. Informed consent for this research use was obtained as determined by the Institutional Review Board of the FHCRC. After collection, Ficoll density centrifugation was performed to isolate mononuclear cells. For isolation of SP cells, mononuclear cells were counted and resuspended at 106 cells/mL in Iscoves/1 mM HEPES/2% heat-inactivated calf serum warmed to 37°C. Hoechst was added to 5 µg/mL and cells were incubated for 90 minutes in a 37°C water bath with gentle agitation every 20 minutes. After staining, the cells were centrifuged at 300g for 5 minutes, washed once in ice-cold HBSS+, and resuspended in cold HBSS+ containing 2 µg/mL PI. Cells were kept on ice until sorting.For isolation of all other cell populations, mononuclear cells were pre-enriched for CD34+ cells using the Miltenyi (Auburn, CA) Auto-MACS system and subsequently stained with monoclonal antibodies against human surface markers. The antibodies included CD34 (HPCA-2), CD38 (HB-7), CD33 (P67.6), and CD10, all from Becton Dickinson (San Jose, CA). The monoclonal antibody against human vascular endothelial growth factor receptor 2 (KDR) was kindly provided by Dr Chengchao Shou and Dr Donghai Chen (Beijing Institute for Cancer Research and Beijing Cancer Hospital, People's Republic of China). All staining was performed for 30 minutes on ice. Hoechst efflux was measured on a Vantage II SE, essentially as described by Goodell et al,4 using 424/44 BP and 675 LP filters, for detection of Hoechst blue and red, respectively. Dead cells were excluded based on PI uptake. Ten thousand cells of each defined cell population were then sorted directly into lysis buffer (Rneasy kit, Qiagen, Valencia, CA). Analysis of gene expression Total RNA was isolated from cell lines by extraction with Trizol (Gibco BRL, Grand Island, NY), 2 rounds of precipitation with ethanol, and resuspension in RNAase-free distilled water. Total RNA from FACS-sorted cells (usually 10 000 cells) was isolated with the Rneasy Mini Kit (Qiagen), precipitated in ethanol with glycogen carrier (Gibco BRL), and resuspended in 5 µL RNAase-free distilled water. First strand complementary DNA (cDNA) was synthesized from either 40 ng total RNA from cell lines or total RNA from 10 000 sorted cells, using 200 U Superscript II reverse transcriptase (Gibco BRL), and a combination of 5 µM OligodT18 and 10 µM random hexamer primers. Completed reverse transcription (RT) reactions were diluted to 400 µL (about 25 cells/µL) with DNAase-free distilled water and stored at 20°C. Specific cDNAs were amplified from dilutions of the RT
reactions with Advantage 2 polymerase mix (Clontech Laboratories, Palo
Alto, CA) using 30 to 40 cycles of a 2-step program (94°C for 20 seconds, 68°C for 2 minutes). Gene-specific primers for human cDNAs
were as follows: GAPDH: 5'- GGAAGGACTCATGACCACAGTCC; GAPDH: 3'- TCGCTGTTGAAGTCAGAGGAGACC; MDR1: 5'-
CAGAAACAACGCATTGCCATAGCTC. MDR1: 3'-
TGATGATGTCTCTCACTCTGTTCC. MRP1: 5'- GGGGATGCTGAAGAACAAGACGC. MRP1: 3'- GCTGAGGAAGGAGATGAAGAGTCC. ABCG2:
5'-GGGTTCTCTTCTTCCTGACGACC. ABCG2: 3'-
TGGTTGTGAGATTGACCAACAGACC. Amplified products (400-500 base
pairs) were separated by electrophoresis on 1.5% agarose gels, stained
with ethidium bromide, detected by fluorescence-based laser scanning
with a Typhoon 8600 Imager (Amersham Pharmacia, Piscataway, NJ) and
quantitated with ImageQuant software (Amersham Pharmacia). Prior to
analysis of transporter gene expression, all RT reactions were
normalized to GAPDH by first amplifying over a range of
cycle numbers to generate a cycle/signal curve, and then adjusting the
RT dilutions to obtain equivalent GAPDH signals for a given
cycle number.
Semiquantitative reverse transcription-polymerase chain reaction (RT-PCR) of ABCG2, MDR1, and MRP1 transcripts in sorted cell populations was performed by amplification of the GAPDH-normalized RT reactions along with quantitative standards. Standards for each gene were established by quantitating a gel-purified, column-purified cDNA template, containing the target region, by Hoechst 33258 binding,22 using a DyNAQuant 200 fluorometer (Amersham Pharmacia). Standard curves were generated by using serial dilutions of the standards, containing from 1 to 7000 molecules/µL target cDNA as PCR templates. All PCRs were done at several cycle numbers to establish the optimal dynamic range. Amplified product values were normalized to GAPDH for intersample comparisons or to standard curves for intergene comparisons within a given sample. ABCG2 expression construct pG2-IRES-EGFP is a bicistronic construct driving coexpression of human ABCG2 and enhanced green fluorescent protein (EGFP) from the cytomegalovirus immediate early promoter/enhancer. ABCG2 cDNA was amplified by RT-PCR from human CD34+ bone marrow cells. Total RNA was primed with oligo dT and reverse-transcribed with SuperScript II (Gibco BRL). The complete coding sequence of ABCG2 was amplified with Advantage 2 polymerase mix (Clontech) using primers encoding unique 5' NotI and 3' EcoRI sites for cloning (5' primer: GCATTACATGCGGCCGCGATCCTGAGCCTTTGGTTAAGACC, 3' primer: CAGGAGTTTCCAGAATTCAATTCTCC). The cDNA was digested with NotI and EcoRI, and inserted into pIRES-EGFP (Clontech).
The SP phenomenon of A549 is associated with expression of ABCG2 The SP phenotype is characterized by low blue and red fluorescence intensity on a dot-plot displaying dual-wavelength fluorescence of blue versus red detected at 424 and 675 nm, respectively. Figure 1A shows a typical SP profile derived from human bone marrow. The SP cells form a tail, which extends from the main body of stained cells to the origin of a blue/red fluorescence dot-plot. Due to the rarity of these cells in bone marrow and to their inherent metabolic and replicative quiescence, we sought a cell line with SP characteristics for preliminary analysis of the phenomenon. A survey of several cell lines for Hoechst efflux activity revealed mostly negative profiles. Figure 1B illustrates a typical negative example, KG1a cells, which exhibit a main body of stained cells and a streak of highly stained cells representing a dividing population with a DNA content more than 2N. Only A549 cells (Figure 1C) exhibit a significant SP of Hoechstlow cells trailing to the origin of the plot and thus displaying low fluorescence in both the blue and red channels.
To identify the efflux pump responsible for this phenotype, we
interrogated A549 cells and 7 SP To elucidate which of the expressed ABC transporters contribute to the
SP phenotype in this cell line, we conducted inhibition studies on A549
cells (Figure 2). A549 cells that were
allowed to efflux in the absence of any inhibitor demonstrated a large proportion of cells fitting the criteria of an SP (Figure 2A). If A549
cells were depleted of ATP for 20 minutes before the staining and
efflux period, the SP phenotype was markedly reduced, verifying that
this phenomenon is energy dependent (Figure 2B). Incubation at 4°C
conferred the same degree of inhibition of the SP phenotype as did ATP
depletion (data not shown). These observations are consistent with the
role of an ABC transporter in this phenomenon. An inhibitor of
MRP1, probenecid, did not influence the ability to efflux
Hoechst, suggesting that the SP phenomenon is independent of
MRP1 (Figure 2C). Verapamil, at concentrations that are
sufficient to inhibit MDR1, only moderately inhibited efflux
(Figure 2D). These data are consistent with the notion that
MDR1 and MRP1 are not major contributors to the
SP phenotype of A549 cells. However, only 3-fold higher concentrations
of verapamil (75 µg/mL) strongly inhibited efflux activity (Figure
2E). Furthermore, the inhibitor fumitremorgin C, shown to be specific
for ABCG2,26 exerted very potent inhibition of
the SP phenotype in A549 cells (Figure 2F). Robey et al27
have recently established that the fumitremorgin C-inhibitable efflux
of the fluorescent chemotherapy agent mitoxantrone is diagnostic for
ABCG2 activity. We found significant efflux of mitoxantrone
in A549 cells, which was sensitive to inhibition by fumitremorgin C,
corroborating ABCG2 activity (data not shown). Taken
together, these data strongly implicate ABCG2 as the primary contributor to the SP phenomenon in this cell line.
ABCG2 is sufficient to cause the SP phenotype To determine whether ABCG2 is sufficient to generate the SP phenotype in a controlled background, we constructed a bicistronic vector, pG2-IRES-EGFP, expressing the ABC transporter and the GFP reporter (Figure 3A). The parent vector pIRES-EGFP, expressing only GFP, was used as a control. We then transiently transfected these constructs into 293 cells. After 48 hours the cells were incubated with Hoechst 33342 and subsequently analyzed by fluorescent microscopy. As shown in Figure 3B, expression of the control plasmid, lacking ABCG2, resulted in simultaneous green (GFP) and blue (Hoechst) fluorescence, indicating transgene expression but no efflux activity. However, 293 cells transfected with the pG2-IRES-EGFP construct exhibited strong efflux of Hoechst, specifically from the expressing (GFP+) cells (Figure 3E). The nonexpressing (GFP ) cells, which served as internal
controls, acquired the typical blue Hoechst fluorescence in their
nuclei. Thorough analysis of these images indicated an inverse
correlation between the intensity of GFP and Hoechst fluorescence.
These data established that GFP expression could be used as a reliable
reporter for coexpression of ABCG2 efflux activity from the
bicistronic vector. We further analyzed the relationship between
ABCG2 expression and Hoechst efflux by flow cytometry. The
SP phenotype was observed only in the ABCG2-transfected
cells (Figure 3F) and not in the pIRES-EGFP controls (Figure 3C).
Moreover, Figure 3G clearly illustrates a quantitative correlation
between ABCG2 transgene expression as reported by GFP and
efflux activity. Together, these data conclusively demonstrate that
ABCG2 is necessary, and sufficient to efflux Hoechst 33342, and to generate the SP phenotype in 293 cells.
Expression of ABCG2 in hematopoiesis To determine whether the aforementioned observations are pertinent to the biology of human hematopoietic stem cells, that is, whether ABCG2 is expressed in early hematopoietic progenitor/stem cells, we interrogated several relevant flow-sorted hematopoietic cell subpopulations from human bone marrow by RT-PCR. SP cells were isolated as a putative stem cell population. Given the controversial stem cell potential of human bone marrow SP cells,8 we also used the established surface markers, CD34+CD38,28 and the reported
stem cell markers, CD34+KDR+,29 to
purify cell populations enriched for primitive hematopoietic progenitors. CD34+CD38+ cells were isolated to
represent the CD34+ progenitor population depleted of the
CD38 putative stem cell population.
CD34+CD33+ and
CD34+CD10+ populations were isolated to
represent committed myeloid and lymphoid progenitors, respectively.
The FACS gates used to isolate these cells are shown in Figure
4, panel A to E. The relative expression
levels for ABCG2 in these cell populations was analyzed by
semiquantitative GAPDH-normalized RT-PCR. As shown in the
representative gel in Figure 4F,
ABCG2 transcripts are relatively high in SP cells as well as
in CD34+/CD38
To address the potential contributions of ABCG2 and 2 other
well-established multidrug-resistant efflux pumps (MDR1 and
MRP1) to the Hoechst efflux activity of SP cells, we
analyzed the relative expression levels of these 3 genes in bone marrow
SP isolates. To control for differences in amplification
characteristics for different cDNAs and to allow PCR signals to be
directly related to molecules of template, a set of cDNA dilutions was
prepared for each gene. A PCR standard curve for each gene was
generated by amplification of these dilution series (Figure 5A-C), and
the RT-PCR values from the SP samples were normalized to the standard curves (Figure 5D). The results of this analysis show that
ABCG2 transcript levels in SP cells are at least 5-fold
higher than those of MDR1 and 50-fold higher than those of
MRP1. Thus, among the efflux pumps tested, ABCG2
is probably the predominant form in SP cells.
The present study shows direct evidence that human ABCG2 can efflux Hoechst 33342 and that this activity can generate an SP phenotype. Previous studies addressing the mechanism of Hoechst exclusion from cells have relied on a correlation between dye exclusion and high transporter expression in cell lines that were selected for high drug resistance. Given that most cells express an assortment of ABC transporters, and that drug selection can induce genes that are unknown or untested, such a correlation can be misinterpreted. Here we demonstrate that the Hoechst efflux activity of A549 cells correlates with high expression of at least 3 ABC transporters but that its inhibition profile is most consistent with activity of ABCG2. Furthermore, transient expression of ABCG2 in the controlled background of a cell line that does not exhibit Hoechst efflux or the SP phenotype, is sufficient to generate these activities. The RT-PCR analysis of ABCG2 mRNA in early hematopoietic
cells reveals an expression pattern that is appropriate for pluripotent stem cells. We found high expression of ABCG2 in putative
human stem cell populations isolated by 3 independent criteria
including the SP phenotype. The enrichment for ABCG2
transcripts by all 3 isolation protocols suggests that the SP,
34+38 Most studies of dye efflux by hematopoietic stem cells has either implicated14 or assumed4,16 that MDR1 plays the primary role in these activities. MDR1 expression is well established in murine bone marrow stem cells.14,15 However, the verapamil inhibition profile of bone marrow SP cells is not entirely consistent with this model. The concentration needed to inhibit the SP phenomenon in bone marrow is variable, but generally higher than that required to block the MDR1-encoded pump.6,31 In light of these observations, our data are consistent with a model in which ABCG2, or perhaps a combination of transporters including MDR1 and ABCG2, generates the SP phenotype. Because our RT-PCR data indicate that ABCG2 mRNA levels are much higher than those of MDR1 or MRP1 in SP cells, we favor a model in which ABCG2 rather than MDR1 is the predominant cause of the SP phenotype associated with hematopoietic stem cells. The question remains as to why hematopoietic stem cells use these efflux pumps. One possibility, consistent with the broad spectrum of toxic substrates effluxed by these pumps, is that they provide a protective function, because these cells must persist for the lifetime of the individual.32 A second possible function, consistent with the lipophilic substrate range of these pumps, could be the efflux of a variety of small lipophilic regulatory molecules, such as steroids, that could trigger growth, differentiation, or apoptotic pathways. Thus, ABCG2 could function to help maintain the unique properties of these immature cells or play a regulatory role in initiating these pathways. The recent findings of Bunting et al,33 of in vivo and ex vivo expansion of multidrug-resistant overexpressing murine stem cells, suggests that these pumps can play fundamental roles in regulation of stem cells. It is possible that ABCG2, MDR1, and perhaps other transporters share overlapping roles in such a function. This hypothesis is currently under investigation.
The authors would like to thank Jonathan Cooper and Mark Groudine for critical reading of the manuscript; Andrew Burger, Michelle Black, and Brian Hall for their assistance with flow cytometry; Adrian Quintanilla for assistance with the Deltavision microscope; Susan Bates and Rob Robey for providing FTC and many helpful discussions; and Jeff Vierra and Marilyn Cornwell for supplying 293 and A549 cells.
Submitted April 20, 2001; accepted September 24, 2001.
Supported in part by grants HL62923, DK56465 from the National Institutes of Health, Department of Health and Human Services, Bethesda, MD; C.W.S. was also supported by a grant from the Stifterverband fuer die Deutsche Wissenschaft (Kind Philipp).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Beverly Torok-Storb, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N, Mailstop D1-100, Seattle, WA 98109; e-mail: btorokst{at}fhcrc.org.
1. Ploemacher RE, Brons NH. The relative spatial distribution of CFU-S in the mouse spleen. Exp Hematol. 1985;13:1068-1072[Medline] [Order article via Infotrieve]. 2. Pallavicini MG, Summers LJ, Dean PN, Gray JW. Enrichment of murine hemopoietic clonogenic cells by multivariate analyses and sorting. Exp Hematol. 1985;13:1173-1181[Medline] [Order article via Infotrieve].
3.
Spangrude GJ, Johnson GR.
Resting and activated subsets of mouse multipotent hematopoietic stem cells.
Proc Natl Acad Sci U S A.
1990;87:7433-7437
4.
Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC.
Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.
J Exp Med.
1996;183:1797-1806
5.
Jackson KA, Mi T, Goodell MA.
Hematopoietic potential of stem cells isolated from murine skeletal muscle.
Proc Natl Acad Sci U S A.
1999;96:14482-14486 6. Gussoni E, Soneoka Y, Strickland CD, et al. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature. 1999;401:390-394[CrossRef][Medline] [Order article via Infotrieve]. 7. Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA. Pax7 is required for the specification of myogenic satellite cells. Cell. 2000;102:777-786[CrossRef][Medline] [Order article via Infotrieve]. 8. Goodell MA, Rosenzweig M, Kim H, et al. Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species. Nat Med. 1997;3:1337-1345[CrossRef][Medline] [Order article via Infotrieve]. 9. Higgins CF. ABC transporters: from microorganisms to man [review]. Annu Rev Cell Biol. 1992;8:67-113[CrossRef]. 10. Dean M, Allikmets R. Evolution of ATP-binding cassette transporter genes [review]. Curr Opin Genet Dev. 1995;5:779-785[CrossRef][Medline] [Order article via Infotrieve]. 11. Klein I, Sarkadi B, Varadi A. An inventory of the human ABC proteins [review]. Biochim Biophys Acta. 1999;1461:237-262[Medline] [Order article via Infotrieve]. 12. Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I, Gottesman MM. Biochemical, cellular, and pharmacological aspects of the multidrug transporter [review]. Annu Rev Pharmacol Toxicol. 1999;39:361-398[CrossRef][Medline] [Order article via Infotrieve]. 13. Neyfakh AA. Use of fluorescent dyes as molecular probes for the study of multidrug resistance. Exp Cell Res. 1988;174:168-176[CrossRef][Medline] [Order article via Infotrieve]. 14. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell. 1991;66:85-94[CrossRef][Medline] [Order article via Infotrieve]. 15. Zinovyeva MV, Zijlmans JM, Fibbe WE, Visser JW, Belyavsky AV. Analysis of gene expression in subpopulations of murine hematopoietic stem and progenitor cells. Exp Hematol. 2000;28:318-334[CrossRef][Medline] [Order article via Infotrieve].
16.
Zijlmans JM, Visser JW, Kleiverda K, Kluin PM, Willemze R, Fibbe WE.
Modification of rhodamine staining allows identification of hematopoietic stem cells with preferential short-term or long-term bone marrow-repopulating ability.
Proc Natl Acad Sci U S A.
1995;92:8901-8905
17.
Bunting KD, Zhou S, Lu T, Sorrentino BP.
Enforced P-glycoprotein pump function in murine bone marrow cells results in expansion of side population stem cells in vitro and repopulating cells in vivo.
Blood.
2000;96:902-909 18. Litman T, Brangi M, Hudson E, et al. The multidrug-resistant phenotype associated with overexpression of the new ABC half-transporter, MXR (ABCG2). J Cell Sci. 2000;113:2011-2021[Abstract]. 19. Symington FW, Levine F, Braun M, Brown SL, Erlich HA, Torok-Storb B. Differential Ia antigen expression by autologous human erythroid and B lymphoblastoid cell lines. J Immunol. 1985;135:1026-1032[Abstract]. 20. Versantvoort CH, Withoff S, Broxterman HJ, et al. Resistance-associated factors in human small-cell lung-carcinoma GLC4 sub-lines with increasing Adriamycin resistance. Int J Cancer. 1995;61:375-380[Medline] [Order article via Infotrieve].
21.
Carrington WA, Lynch RM, Moore ED, Isenberg G, Fogarty KE, Fay FS.
Superresolution three-dimensional images of fluorescence in cells with minimal light exposure.
Science.
1995;268:1483-1487 22. Labarca C, Paigen K. A simple, rapid, and sensitive DNA assay procedure. Anal Biochem. 1980;102:344-352[CrossRef][Medline] [Order article via Infotrieve]. 23. Borst P, Evers R, Kool M, Wijnholds J. The multidrug resistance protein family. Biochim Biophys Acta. 1999;1461:347-357[Medline] [Order article via Infotrieve].
24.
Doyle LA, Yang W, Abruzzo LV, et al.
A multidrug resistance transporter from human MCF-7 breast cancer cells (published erratum appears in Proc Natl Acad Sci U S A. 1999;96:2569).
Proc Natl Acad Sci U S A.
1998;95:15665-15670
25.
Miyake K, Mickley L, Litman T, et al.
Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone-resistant cells: demonstration of homology to ABC transport genes.
Cancer Res.
1999;59:8-13
26.
Rabindran SK, Ross DD, Doyle LA, Yang W, Greenberger LM.
Fumitremorgin C reverses multidrug resistance in cells transfected with the breast cancer resistance protein.
Cancer Res.
2000;60:47-50
27.
Robey RW, Medina-Perez WY, Nishiyama K, et al.
Overexpression of the ATP-binding cassette half-transporter, ABCG2 (MXR/BCRP/ABCP1), in flavopiridol-resistant human breast cancer cells.
Clin Cancer Res.
2001;7:145-152
28.
Terstappen LWMM, Huang S, Safford M, Lansdorp PM, Loken MR.
Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+ CD38
29.
Ziegler BL, Valtieri M, Porada GA, et al.
KDR receptor: a key marker defining hematopoietic stem cells.
Science.
1999;285:1553-1558
30.
Graf L, Torok-Storb B.
Identification of a novel DNA sequence differentially expressed between normal human CD34+CD38hi and CD34+CD38lo marrow cells.
Blood.
1995;86:548-556
31.
Storms RW, Goodell MA, Fisher A, Mulligan RC, Smith C.
Hoechst dye efflux reveals a novel CD7(+)CD34( 32. Cooper DD, Spangrude GJ. (R)evolutionary considerations in hematopoietic development [review]. Ann N Y Acad Sci. 1999;872:83-93[CrossRef][Medline] [Order article via Infotrieve].
33.
Bunting KD, Galipeau J, Topham D, Benaim E, Sorrentino BP.
Transduction of murine bone marrow cells with an MDR1 vector enables ex vivo stem cell expansion, but these expanded grafts cause a myeloproliferative syndrome in transplanted mice.
Blood.
1998;92:2269-2279
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  R. van de Ven, R. Oerlemans, J. W. van der Heijden, G. L. Scheffer, T. D. de Gruijl, G. Jansen, and R. J. Scheper ABC drug transporters and immunity: novel therapeutic targets in autoimmunity and cancer J. Leukoc. Biol., November 1, 2009; 86(5): 1075 - 1087. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. NOWAK, J. A. MADEJ, and P. DZIEGIEL Expression of Breast Cancer Resistance Protein (BCRP-1) in Canine Mammary Adenocarcinomas and Adenomas In Vivo, September 1, 2009; 23(5): 705 - 709. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hu, H. Li, J. Li, Z. Zhu, S. Yin, X. Hao, M. Yao, S. Zheng, and J. Gu Analysis of ABCG2 expression and side population identifies intrinsic drug efflux in the HCC cell line MHCC-97L and its modulation by Akt signaling Carcinogenesis, December 1, 2008; 29(12): 2289 - 2297. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Zabierowski and M. Herlyn Melanoma Stem Cells: The Dark Seed of Melanoma J. Clin. Oncol., June 10, 2008; 26(17): 2890 - 2894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Martin, A. Ferdous, T. Gallardo, C. Humphries, H. Sadek, A. Caprioli, J. A. Garcia, L. I. Szweda, M. G. Garry, and D. J. Garry Hypoxia-Inducible Factor-2{alpha} Transactivates Abcg2 and Promotes Cytoprotection in Cardiac Side Population Cells Circ. Res., May 9, 2008; 102(9): 1075 - 1081. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Inada, A. Follenzi, K. Cheng, M. Surana, B. Joseph, D. Benten, S. Bandi, H. Qian, and S. Gupta Phenotype reversion in fetal human liver epithelial cells identifies the role of an intermediate meso-endodermal stage before hepatic maturation J. Cell Sci., April 1, 2008; 121(7): 1002 - 1013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Kobayashi, K. Saito, T. Moritomo, K. Araki, F. Takizawa, and T. Nakanishi Characterization and localization of side population (SP) cells in zebrafish kidney hematopoietic tissue Blood, February 1, 2008; 111(3): 1131 - 1137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Irwin, K. Helm, N. Campbell, M. Imamura, K. Fagan, J. Harral, M. Carr, K. A. Young, D. Klemm, S. Gebb, et al. Neonatal lung side population cells demonstrate endothelial potential and are altered in response to hyperoxia-induced lung simplification Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L941 - L951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Lan, D. Cui, K. Nowka, and M. Derwahl Stem Cells Derived from Goiters in Adults Form Spheres in Response to Intense Growth Stimulation and Require Thyrotropin for Differentiation into Thyrocytes J. Clin. Endocrinol. Metab., September 1, 2007; 92(9): 3681 - 3688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhattacharya, A. Das, K. Mallya, and I. Ahmad Maintenance of retinal stem cells by Abcg2 is regulated by notch signaling J. Cell Sci., August 1, 2007; 120(15): 2652 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Robey, S. Shukla, K. Steadman, T. Obrzut, E. M. Finley, S. V. Ambudkar, and S. E. Bates Inhibition of ABCG2-mediated transport by protein kinase inhibitors with a bisindolylmaleimide or indolocarbazole structure Mol. Cancer Ther., June 1, 2007; 6(6): 1877 - 1885. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, L.-P. Guo, L.-Z. Chen, Y.-X. Zeng, and S. H. Lu Identification of Cancer Stem Cell-Like Side Population Cells in Human Nasopharyngeal Carcinoma Cell Line Cancer Res., April 15, 2007; 67(8): 3716 - 3724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. D. Reynolds, H. Shen, P. R. Reynolds, T. Betsuyaku, J. M. Pilewski, F. Gambelli, M. DeGuiseppe, L. A. Ortiz, and B. R. Stripp Molecular and functional properties of lung SP cells Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L972 - L983. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Giangreco, K. R. Groot, and S. M. Janes Lung Cancer and Lung Stem Cells: Strange Bedfellows? Am. J. Respir. Crit. Care Med., March 15, 2007; 175(6): 547 - 553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Turner, J. L. Gump, C. Zhang, J. M. Cook, D. Marchion, L. Hazlehurst, P. Munster, M. J. Schell, W. S. Dalton, and D. M. Sullivan ABCG2 expression, function, and promoter methylation in human multiple myeloma Blood, December 1, 2006; 108(12): 3881 - 3889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Morita, H. Ema, S. Yamazaki, and H. Nakauchi Non-side-population hematopoietic stem cells in mouse bone marrow Blood, October 15, 2006; 108(8): 2850 - 2856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-M. Imbert, G. Belaaloui, F. Bardin, C. Tonnelle, M. Lopez, and C. Chabannon CD99 expressed on human mobilized peripheral blood CD34+ cells is involved in transendothelial migration Blood, October 15, 2006; 108(8): 2578 - 2586. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zong, S. Zhou, S. Fatima, and B. P. Sorrentino Expression of Mouse Abcg2 mRNA during Hematopoiesis Is Regulated by Alternative Use of Multiple Leader Exons and Promoters J. Biol. Chem., October 6, 2006; 281(40): 29625 - 29632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Sarkadi, L. Homolya, G. Szakacs, and A. Varadi Human Multidrug Resistance ABCB and ABCG Transporters: Participation in a Chemoimmunity Defense System. Physiol Rev, October 1, 2006; 86(4): 1179 - 1236. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fischer, M. Schmidt, S. Klingenberg, C. J. Eaves, C. von Kalle, and H. Glimm Short-term repopulating cells with myeloid potential in human mobilized peripheral blood do not have a side population (SP) phenotype Blood, September 15, 2006; 108(6): 2121 - 2123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Vander Borght, L. Libbrecht, A. Katoonizadeh, J. van Pelt, D. Cassiman, F. Nevens, A. Van Lommel, B. E. Petersen, J. Fevery, P. L. Jansen, et al. Breast Cancer Resistance Protein (BCRP/ABCG2) Is Expressed by Progenitor Cells/Reactive Ductules and Hepatocytes and Its Expression Pattern Is Influenced by Disease Etiology and Species Type: Possible Functional Consequences J. Histochem. Cytochem., September 1, 2006; 54(9): 1051 - 1059. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sales-Pardo, A. Avendano, J. Barquinero, J. C. Domingo, P. Marin, J. Petriz, F. D. Camargo, and M. A. Goodell The Hoechst low-fluorescent profile of the side population: clonogenicity versus dye retention. Blood, September 1, 2006; 108(5): 1774 - 1775. [Full Text] [PDF]
|
|
|
|
|
|
I. Szatmari, G. Vamosi, P. Brazda, B. L. Balint, S. Benko, L. Szeles, V. Jeney, C. Ozvegy-Laczka, A. Szanto, E. Barta, et al. Peroxisome Proliferator-activated Receptor {gamma}-regulated ABCG2 Expression Confers Cytoprotection to Human Dendritic Cells J. Biol. Chem., August 18, 2006; 281(33): 23812 - 23823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Dean CANCER STEM CELLS: Redefining the Paradigm of Cancer Treatment Strategies Mol. Interv., June 1, 2006; 6(3): 140 - 148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H.G.P. Raaijmakers, E. P.L.M. de Grouw, B. A. van der Reijden, T. J.M. de Witte, J. H. Jansen, and R. A.P. Raymakers ABCB1 Modulation Does Not Circumvent Drug Extrusion from Primitive Leukemic Progenitor Cells and May Preferentially Target Residual Normal Cells in Acute Myelogenous Leukemia. Clin. Cancer Res., June 1, 2006; 12(11): 3452 - 3458. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-S. Park, C. H. Lim, B.-M. Min, J. L. Lee, H.-Y. Chung, C.-K. Joo, C.-W. Park, and Y. Son The side population cells in the rabbit limbus sensitively increased in response to the central cornea wounding. Invest. Ophthalmol. Vis. Sci., March 1, 2006; 47(3): 892 - 900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Ravandi and Z. Estrov Eradication of Leukemia Stem Cells as a New Goal of Therapy in Leukemia Clin. Cancer Res., January 15, 2006; 12(2): 340 - 344. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Maeshima, H. Sakurai, and S. K. Nigam Adult Kidney Tubular Cell Population Showing Phenotypic Plasticity, Tubulogenic Capacity, and Integration Capability into Developing Kidney J. Am. Soc. Nephrol., January 1, 2006; 17(1): 188 - 198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L.A. Plasschaert, E. S.J.M. de Bont, M. Boezen, D. M. vander Kolk, S. M.J.G. Daenen, K. N. Faber, W. A. Kamps, E. G.E. de Vries, and E. Vellenga Expression of Multidrug Resistance-Associated Proteins Predicts Prognosis in Childhood and Adult Acute Lymphoblastic Leukemia Clin. Cancer Res., December 15, 2005; 11(24): 8661 - 8668. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H S Dua, V A Shanmuganathan, A O Powell-Richards, P J Tighe, and A Joseph Limbal epithelial crypts: a novel anatomical structure and a putative limbal stem cell niche Br J Ophthalmol, May 1, 2005; 89(5): 529 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Budak, O. S. Alpdogan, M. Zhou, R. M. Lavker, M.A. M. Akinci, and J. M. Wolosin Ocular surface epithelia contain ABCG2-dependent side population cells exhibiting features associated with stem cells J. Cell Sci., April 15, 2005; 118(8): 1715 - 1724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H.G.P. Raaijmakers, E. P.L.M. de Grouw, L. H.H. Heuver, B. A. van der Reijden, J. H. Jansen, R. J. Scheper, G. L. Scheffer, T. J.M. de Witte, and R. A.P. Raymakers Breast Cancer Resistance Protein in Drug Resistance of Primitive CD34+38- Cells in Acute Myeloid Leukemia Clin. Cancer Res., March 15, 2005; 11(6): 2436 - 2444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zhou, Y. Zong, P. A. Ney, G. Nair, C. F. Stewart, and B. P. Sorrentino Increased expression of the Abcg2 transporter during erythroid maturation plays a role in decreasing cellular protoporphyrin IX levels Blood, March 15, 2005; 105(6): 2571 - 2576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ozvegy-Laczka, G. Varady, G. Koblos, O. Ujhelly, J. Cervenak, J. D. Schuetz, B. P. Sorrentino, G.-J. Koomen, A. Varadi, K. Nemet, et al. Function-dependent Conformational Changes of the ABCG2 Multidrug Transporter Modify Its Interaction with a Monoclonal Antibody on the Cell Surface J. Biol. Chem., February 11, 2005; 280(6): 4219 - 4227. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ueda, S. Brenner, H. L. Malech, S. M. Langemeijer, S. Perl, M. Kirby, O. A. Phang, A. E. Krouse, R. E. Donahue, E. M. Kang, et al. Cloning and Functional Analysis of the Rhesus Macaque ABCG2 Gene: FORCED EXPRESSION CONFERS AN SP PHENOTYPE AMONG HEMATOPOIETIC STEM CELL PROGENY IN VIVO J. Biol. Chem., January 14, 2005; 280(2): 991 - 998. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Ilaria Jr. Pathobiology of Lymphoid and Myeloid Blast Crisis and Management Issues Hematology, January 1, 2005; 2005(1): 188 - 194. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hirschmann-Jax, A. E. Foster, G. G. Wulf, J. G. Nuchtern, T. W. Jax, U. Gobel, M. A. Goodell, and M. K. Brenner A distinct "side population" of cells with high drug efflux capacity in human tumor cells PNAS, September 28, 2004; 101(39): 14228 - 14233. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Dubin and J. K. Kolls Further defining lung SP cells: their origin and their heterogeneity, now if we only knew their fate! Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L475 - L476. [Full Text] [PDF]
|
|
|
|
|
|
R. Summer, D. N. Kotton, X. Sun, K. Fitzsimmons, and A. Fine Origin and phenotype of lung side population cells Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L477 - L483. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lubelski, P. Mazurkiewicz, R. van Merkerk, W. N. Konings, and A. J. M. Driessen ydaG and ydbA of Lactococcus lactis Encode a Heterodimeric ATP-binding Cassette-type Multidrug Transporter J. Biol. Chem., August 13, 2004; 279(33): 34449 - 34455. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Miranville, C. Heeschen, C. Sengenes, C.A. Curat, R. Busse, and A. Bouloumie Improvement of Postnatal Neovascularization by Human Adipose Tissue-Derived Stem Cells Circulation, July 20, 2004; 110(3): 349 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Davis, L. Humeau, V. Slepushkin, G. Binder, L. Korshalla, Y. Ni, E. O. Ogunjimi, L.-F. Chang, X. Lu, and B. Dropulic ABC transporter inhibitors that are substrates enhance lentiviral vector transduction into primitive hematopoietic progenitor cells Blood, July 15, 2004; 104(2): 364 - 373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Krishnamurthy, D. D. Ross, T. Nakanishi, K. Bailey-Dell, S. Zhou, K. E. Mercer, B. Sarkadi, B. P. Sorrentino, and J. D. Schuetz The Stem Cell Marker Bcrp/ABCG2 Enhances Hypoxic Cell Survival through Interactions with Heme J. Biol. Chem., June 4, 2004; 279(23): 24218 - 24225. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Lapidos, R. Kakkar, and E. M. McNally The Dystrophin Glycoprotein Complex: Signaling Strength and Integrity for the Sarcolemma Circ. Res., April 30, 2004; 94(8): 1023 - 1031. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Abe, G. Lauby, C. Boyer, L. Manouilova, S. I. Rennard, and J. G. Sharp Lung Cells Transplanted to Irradiated Recipients Generate Lymphohematopoietic Progeny Am. J. Respir. Cell Mol. Biol., April 1, 2004; 30(4): 491 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Giangreco, H. Shen, S. D. Reynolds, and B. R. Stripp Molecular phenotype of airway side population cells Am J Physiol Lung Cell Mol Physiol, April 1, 2004; 286(4): L624 - L630. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Lassalle, H. Bastos, J. P. Louis, L. Riou, J. Testart, B. Dutrillaux, P. Fouchet, and I. Allemand `Side Population' cells in adult mouse testis express Bcrp1 gene and are enriched in spermatogonia and germinal stem cells Development, January 15, 2004; 131(2): 479 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Steinbach, S. Wittig, G. Cario, S. Viehmann, A. Mueller, B. Gruhn, R. Haefer, F. Zintl, and A. Sauerbrey The multidrug resistance-associated protein 3 (MRP3) is associated with a poor outcome in childhood ALL and may account for the worse prognosis in male patients and T-cell immunophenotype Blood, December 15, 2003; 102(13): 4493 - 4498. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. L. Herzog, L. Chai, and D. S. Krause Plasticity of marrow-derived stem cells Blood, November 15, 2003; 102(10): 3483 - 3493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. A. Plasschaert, D. M. van der Kolk, E. S. J. M. de Bont, W. A. Kamps, K. Morisaki, S. E. Bates, G. L. Scheffer, R. J. Scheper, E. Vellenga, and E. G. E. de Vries The Role of Breast Cancer Resistance Protein in Acute Lymphoblastic Leukemia Clin. Cancer Res., November 1, 2003; 9(14): 5171 - 5177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Mogi, J. Yang, J.-F. Lambert, G. A. Colvin, I. Shiojima, C. Skurk, R. Summer, A. Fine, P. J. Quesenberry, and K. Walsh Akt Signaling Regulates Side Population Cell Phenotype via Bcrp1 Translocation J. Biol. Chem., October 3, 2003; 278(40): 39068 - 39075. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shimano, M. Satake, A. Okaya, J. Kitanaka, N. Kitanaka, M. Takemura, M. Sakagami, N. Terada, and T. Tsujimura Hepatic Oval Cells Have the Side Population Phenotype Defined by Expression of ATP-Binding Cassette Transporter ABCG2/BCRP1 Am. J. Pathol., July 1, 2003; 163(1): 3 - 9. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Lockhart, R. G. Tirona, and R. B. Kim Pharmacogenetics of ATP-binding Cassette Transporters in Cancer and Chemotherapy Mol. Cancer Ther., July 1, 2003; 2(7): 685 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Summer, D. N. Kotton, X. Sun, B. Ma, K. Fitzsimmons, and A. Fine Side population cells and Bcrp1 expression in lung Am J Physiol Lung Cell Mol Physiol, July 1, 2003; 285(1): L97 - L104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bhatia, M. Holtz, N. Niu, R. Gray, D. S. Snyder, C. L. Sawyers, D. A. Arber, M. L. Slovak, and S. J. Forman Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment Blood, June 15, 2003; 101(12): 4701 - 4707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bhattacharya, J. D. Jackson, A. V. Das, W. B. Thoreson, C. Kuszynski, J. James, S. Joshi, and I. Ahmad Direct Identification and Enrichment of Retinal Stem Cells/Progenitors by Hoechst Dye Efflux Assay Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2764 - 2773. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Dontu, W. M. Abdallah, J. M. Foley, K. W. Jackson, M. F. Clarke, M. J. Kawamura, and M. S. Wicha In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells Genes & Dev., May 15, 2003; 17(10): 1253 - 1270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Baum, J. Dullmann, Z. Li, B. Fehse, J. Meyer, D. A. Williams, and C. von Kalle Side effects of retroviral gene transfer into hematopoietic stem cells Blood, March 15, 2003; 101(6): 2099 - 2113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. L. Abbott, A.-M. Colapietro, Y. Barnes, F. Marini, M. Andreeff, and B. P. Sorrentino Low levels of ABCG2 expression in adult AML blast samples Blood, December 15, 2002; 100(13): 4594 - 4601. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zhou, J. J. Morris, Y. Barnes, L. Lan, J. D. Schuetz, and B. P. Sorrentino Bcrp1 gene expression is required for normal numbers of side population stem cells in mice, and confers relative protection to mitoxantrone in hematopoietic cells in vivo PNAS, September 17, 2002; 99(19): 12339 - 12344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. van der Kolk, E. Vellenga, G. L. Scheffer, M. Muller, S. E. Bates, R. J. Scheper, and E. G. E. de Vries Expression and activity of breast cancer resistance protein (BCRP) in de novo and relapsed acute myeloid leukemia Blood, May 15, 2002; 99(10): 3763 - 3770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Allen and A. H. Schinkel Multidrug Resistance and Pharmacological Protection Mediated by the Breast Cancer Resistance Protein (BCRP/ABCG2) Mol. Cancer Ther., April 1, 2002; 1(6): 427 - 434. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
