| |
|
|
|
|
|
|
|||
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Departments of Cardiovascular Physiology and
Immunology, University of Goettingen, Germany.
Given the significance of CD40-CD40 ligand interactions in chronic
inflammatory diseases including atherosclerosis, the transcriptional regulation of CD40 expression as a potential therapeutic target was
investigated in human umbilical vein cultured endothelial cells.
Exposure to interferon- CD40 (or TNFR5) is a cell-surface receptor
belonging to the tumor necrosis factor (TNF) receptor superfamily that
is principally expressed by B cells, but also by other
antigen-presenting cells and, in addition, by a variety of nonimmune
cells such as smooth muscle cells, fibroblasts, and endothelial
cells.1,2 The corresponding ligand (CD40L or CD154) has
been cloned and identified as a CD4+ T-cell activation
antigen.3 CD40-CD154 interactions play a critical role in
the regulation of both humoral and cellular immunity.4 In
endothelial cells, CD40 stimulation causes a TNF- These aforementioned events also seem to be important for the
development of atherosclerosis, and all of the principal cells present
in human atherosclerotic lesions, such as endothelial cells,
macrophages, smooth muscle cells, and T-helper cells, express CD40,
CD154, or both.9,10 Moreover, anti-CD154 antibodies are
capable of reducing the size of atherosclerotic lesions in hyperlipidemic mice11 and limiting heart-transplant
atherosclerosis in the same species.12 However, because of
adverse side effects, the use of such antibodies may be limited in
patients with chronic inflammatory diseases.13 Moreover,
as yet no low-molecular-weight antagonist for CD40 has been developed,
and anti-CD40 antibodies stimulate rather than inhibit CD40 signaling
in cells expressing the receptor.14 Suppression of CD40
expression in CD154 target cells may thus provide a feasible
therapeutic alternative.
Cytokine-inducible expression of CD40 in rat vascular smooth
muscle cells is mediated by the transcription factors nuclear factor- Cell culture
The human monocytic cell line THP-1 (American Type Culture Collection,
Rockville, MD) and the mouse myeloma cell line P3xTB.A7 (stably
transfected with human CD154) were cultured in RPMI 1640 medium (Life
Technologies) containing 10% FBS and antibiotics, as described
before.7
RT-PCR analysis
Western blot analysis Analysis of CD40 receptor and IRF-1 protein expression in HUVECs or THP-1 cells was performed as described.18 Protein extracts (30 µg protein per lane) were separated by denaturing 10% polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate, according to standard protocols, and then transferred to a BioTrace polyvinylidene fluoride transfer membrane (Pall, Dreieich, Germany). Transferred proteins were probed by a polyclonal rabbit antihuman CD40 antibody (1:2000 dilution; Research Diagnostics, Flanders, NJ) or a polyclonal anti-IRF-1 antibody (1:2000 dilution; Santa Cruz Biotechnology, Heidelberg, Germany). Visualization of the protein bands was achieved by using a secondary antirabbit antibody conjugated to horseradish peroxidase (1:3000 dilution; Sigma-Aldrich) and the SuperSignal chemiluminescent substrate (Pierce Chemical, Rockford, IL) followed by exposure to autoradiography film (Hyperfilm MP; Amersham Pharmacia Biotech, Freiburg, Germany). Loading and transfer of equal amounts of protein in each lane were verified by reprobing the membrane with a monoclonal anti- -actin antibody from
mouse ascites fluid and an anti-mouse IgG (whole molecule) peroxidase
conjugate (both antibodies obtained from Sigma-Aldrich; 1:3000
dilution), followed by densitometry.18
Electrophoretic mobility shift analysis Preparation of nuclear extracts from the cultured cells and subsequent nondenaturing 4% polyacrylamide gel electrophoresis were performed as described previously.15 The double-stranded gel shift oligodeoxynucleotides (ODNs; Santa Cruz Biotechnology) for STAT-1 (5'-CATGTTATGATTCCTGTAAGTG-3'), Sis-inducible element (5'-GTGCATTTCCCGTAAATCTTGTCTACA-3'), NF- B
(5'-AGTTGAGGGGACTTTCCCAGGC-3'), and IRF-1 (5'-GGAAGCGAAAATGAAATTGAC-3')
were end-labeled with [ -32P]ATP by using the 5'-end
labeling kit from Amersham Pharmacia Biotech. Typically, the binding
mixture contained 5 µg nuclear extract, 20 000 cpm of the
32P-labeled oligonucleotide probe (0.5 ng), 1 µg
poly[d(I-C)], and 1.33 mM DL-dithiothreitol in a total volume of 15 µL binding buffer. For supershift analyses, 2 µL of the appropriate
gel supershift antibody (2 mg/mL; Santa Cruz Biotechnology) per 6 µL
of nuclear extract was preincubated at room temperature for 60 minutes
before the EMSA was performed.
Decoy ODN technique Double-stranded ODNs were prepared from complementary single-stranded phosphorothioate-bonded ODNs obtained from Eurogentec (Köln, Germany) by melting at 95°C for 5 minutes, followed by a cool-down phase of 3 to 4 hours at ambient temperature. The efficiency of the hybridization reaction was verified with 2.5% agarose gel electrophoresis and usually found to exceed 95%. The sequences of the single-stranded ODNs were as follows (underlined letters denote phosphorothioate-bonded bases): STAT-1, CATGTTATGCATATTCCTGTAAGTG; STAT-1m, CATGTTATGCAGACCGTAGTAAGTG; NF- B,
AGTTGAGGGGACTTTCCCAGGC; IRF-1,
GGAAGCGAAAATGAAATTGAC; IRF-1c,
CAGAAAAGTGAAACCCTG; and IRF-1m,
CAGATGAGTGTAACCCTG. On the basis of previous
EMSA and RT-PCR analyses, the maximally effective concentration and
optimal preincubation time for all decoy ODNs in the cultured cells
were determined to be 10 µM and 4 hours, respectively.18
Decoy ODN uptake was achieved without using any cationic lipid or
liposomal complex.
Antisense ODNs HUVECs were treated with the single-stranded ODNs at approximately 80% confluence. Briefly, the antisense ODNs were premixed with 200 µg/mL Lipofectin reagent (Life Technologies) in normal growth medium without heparin and endothelial cell growth factor at room temperature at the desired concentration (4 µg/well). Medium supplements were added to the premix and incubated with the HUVECs for 4 hours at 37°C. Thereafter, the ODN-containing medium was replaced by fresh medium, and the cells were stimulated with the cytokines for the indicated times. The IRF-1 antisense ODN had the sequence 5'-CGAGTGATGGGCATGTTGGC-3', thus targeting the translation initiation site in the IRF-1 mRNA.19 The sequence of the missense control was 5'-CGAGTGGTAGACGTA-TTGGC-3', and that of the scrambled control was 5'-CGAGTGGTAGACGTATTGGC-3' (underlined letters denote phosphorothioate-bonded bases).Flow cytometry HUVECs harvested by scraping were stained at 0°C to 4°C for 30 minutes with either a phycoerythrin-conjugated mouse anti-human CD40 monoclonal antibody or the corresponding isotype control (BD Biosciences, Heidelberg, Germany). Endothelial cells were identified by staining for PECAM-1 using a fluorescein isothiocyanate-conjugated mouse anti-human CD31 monoclonal antibody (BD Biosciences). Flow cytometry was performed with a Coulter Epics XL flow cytometer (Beckman Coulter, Krefeld, Germany). Data are expressed as mean fluorescence intensity.Nuclear run-on analysis PCR-based run-on analysis of the de novo expression of CD40 and EF-1 mRNA in isolated nuclei of HUVECs was performed as described previously.15 HUVECs in 100-mm Petri dishes were exposed to either a cytokine mixture or vehicle for 6 hours. Thereafter, the cells were harvested with a cell scraper and the nuclei were isolated. Half of the nuclei were immediately lysed, and the other half were incubated for 30 minutes at 30°C and then lysed. Total RNA was isolated and RT-PCR was performed as described before, except for the use of random primers instead of oligo-dT primers in the reverse transcription step.Data analysis Unless indicated otherwise, results are expressed as means ± SEM of n observations. One-way analysis of variance followed by a Dunnett multiple-comparisons test was used to determine differences between the means and the corresponding control value, with P < .05 considered statistically significant.
Cytokine-induced CD40 expression and transcription factor activation In the cultured HUVECs, exposure to IFN- (1000 U/mL) plus
TNF- (100 U/mL) resulted in a marked increase in CD40 expression, which at the mRNA level reached a maximum between 9 and 14 hours (Figure 1A). IFN- (1000 U/mL) and
TNF- (1000 U/mL) alone were less effective (203% ± 23% and
242% ± 42%, respectively, of basal CD40 mRNA after 9 hours;
P < .05, n = 5-8), whereas IL-1 (60 U/mL) or
bacterial lipopolysaccharide (1 µg/mL) had no effect (not shown).
Stimulation of the receptor itself by using the mouse myeloma cell line
P3xTB.A7 stably transfected with human CD154 (2 × 106
cells/well)7 also had no effect on CD40 mRNA expression
(135% ± 24% of basal mRNA abundance after12 hours;
n = 6).
Both blockade by actinomycin D (1 µM; not shown) and nuclear
run-on analyses (Figure 1B) confirmed that up-regulation of CD40 expression induced by IFN- The degree of IRF-1 expression correlates with the level of CD40 expression Expression of IRF-1 and CD40 mRNA in HUVECs stimulated with IFN- plus TNF- clearly exceeded the level of expression of both gene products induced by IFN- alone (Figure
2). Moreover, CD40 expression was
up-regulated faster in the presence of IFN- plus TNF- as compared
with cells stimulated with IFN- alone (Figure 2), whereas IRF-1
expression clearly preceded that of CD40 regardless of the
stimulus.
Effects of different decoy ODNs on CD40 expression To confirm the involvement of NF- B, STAT-1, or IRF-1 in
cytokine-stimulated CD40 expression, we used the decoy ODN technique. Both CD40 mRNA and protein expression after exposure to IFN- plus
TNF- were significantly reduced to approximately 40% of the control
value following pretreatment of the HUVECs with a STAT-1 or IRF-1
consensus decoy ODN (Figure 3). These
effects of the decoy ODN were specific; for example, CD40 mRNA
expression was significantly reduced in cells treated with the IRF-1
consensus but not with a corresponding mutant ODN (Figure
4A; cf. Figure 6B for the STAT-1 decoy
ODN). In contrast, the NF- B-specific decoy ODNs had no significant
effect on either CD40 mRNA (Figure 3A) or protein expression (Figure
3C). Cytokine-stimulated E-selectin mRNA expression, on the other hand,
was markedly inhibited by preincubation with the NF- B decoy ODN,
thus confirming its efficacy (Figure 4B). Moreover, as judged by EMSA,
the IRF-1 decoy ODN clearly affected the nuclear translocation of IRF-1
in IFN- /TNF- -stimulated THP-1 cells (Figure 4C), and
cytokine-stimulated CD40 protein expression in these cells was
significantly reduced after pretreatment with the STAT-1 or IRF-1 decoy
ODN (Figure 3B).
Effects of an IRF-1 antisense ODN To delineate which of the 2 IFN- -stimulated transcription
factors, STAT-1 or IRF-1, was responsible for the cytokine-induced increase in CD40 expression, we used an antisense ODN to suppress IRF-1
protein synthesis. Incubation of the cultured HUVECs with the IRF-1
antisense ODN before IFN- plus TNF- stimulation resulted in a
55% reduction of cytokine-induced IRF-1 protein expression, whereas
the scrambled control ODN had no such effect (Figure
5A). Moreover, the IRF-1 antisense ODN
inhibited IFN- plus TNF- -induced CD40 expression to a similar
extent at both the mRNA (Figure 5B) and protein levels (Figure
6A). However, the antisense ODN did not
seem to exert an effect on CD40 protein expression induced by IFN-
alone (Figure 6A). In line with this finding, the IRF-1 decoy ODN had
no effect on the increase in CD40 mRNA abundance in HUVECs stimulated
with IFN- alone, whereas the STAT-1 decoy ODN was clearly effective
(Figure 6B).
The involvement of CD40-CD154 interactions in both Th1- and Th2-cell-mediated chronic inflammatory diseases, such as rheumatoid arthritis or asthma (for review see Van Kooten and Bancheraeu1), as well as in atherosclerosis or transplant vasculopathy,21 has been well documented. Apart from CD154-neutralizing antibodies, low-molecular-weight antagonists for CD40 are not yet available, and antibodies against CD40 activate rather than inhibit CD154 signaling.22 Targeting CD40 gene expression in inflammatory conditions by neutralizing the principal transcription factors involved therein may thus represent an alternative therapeutic approach. This decoy ODN strategy has already been successfully applied to block the expression of different target genes both in vitro and in vivo (for reviews see Morishita et al23 and Mann and Dzau24). STAT-1 is a key transcription factor in cytokine-induced CD40 expression in rodents,15,16 and preliminary evidence from this laboratory suggests that treatment with the corresponding decoy ODN exerts profound therapeutic effects in mouse or rat models of allergen-induced asthma, antigen-induced arthritis, or transplant rejection. However, species differences with respect to the transcriptional regulation of a given gene are rather frequent. To appropriately use the decoy ODN approach in humans, therefore, the aim of the present study was to identify the key transcription factor(s) involved in cytokine-stimulated CD40 expression in human cells. Human endothelial cells express CD40 constitutively, and this basal
expression can be markedly enhanced after exposure to certain
proinflammatory cytokines, namely the combination of TNF- The combination of IFN- In contrast to NF- The notion that de novo synthesis of IRF-1 is a prerequisite for
IFN- Whereas decoy ODN neutralization of STAT-1 was as effective as that of
IRF-1 under the chosen experimental conditions (IFN- Collectively, the aforementioned findings suggest that in cultured
HUVECs, combined treatment with IFN-
We are indebted to Nicole Gottlieb for expert technical assistance and Bianca Lienenlüke for performing the experiments with the mouse myeloma cell line P3xTB.A7.
Submitted February 20, 2001; accepted September 11, 2001.
Supported by the Deutsche Forschungsgemeinschaft (SFB 402/C9).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Markus Hecker, Dept of Cardiovascular Physiology, University of Goettingen, Humboldtallee 23, D-37073 Goettingen, Germany; e-mail: hecker{at}veg-physiol.med.uni-goettingen.de.
1. Van Kooten C, Bancheraeu J. CD40-CD40 ligand. J Leukoc Biol. 2000;67:2-17[Abstract]. 2. Schönbeck U, Libby P. The CD40/CD154 receptor/ligand dyad. Cell Mol Life Sci. 2001;58:4-43[CrossRef][Medline] [Order article via Infotrieve]. 3. Armitage RJ, Fanslow WC, Strockbine L, et al. Molecular and biological characterization of a murine ligand for CD40. Nature. 1992;357:80-82[CrossRef][Medline] [Order article via Infotrieve]. 4. Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol. 1998;16:111-135[CrossRef][Medline] [Order article via Infotrieve].
5.
Hollenbaugh D, Mischel-Petty N, Edwards CP, et al.
Expression of functional CD40 by vascular endothelial cells.
J Exp Med.
1995;182:33-40
6.
Yellin MJ, Brett J, Baum D, et al.
Functional interactions of T cells with endothelial cells: the role of CD40L-CD40-mediated signals.
J Exp Med.
1995;182:1857-1864 7. Lienenlüke B, Germann T, Kroczek RA, Hecker M. CD154 stimulation of interleukin-12 synthesis in human endothelial cells. Eur J Immunol. 2000;30:2864-2870[CrossRef][Medline] [Order article via Infotrieve]. 8. Trinchieri G. Proinflammatory and immunoregulatory functions of interleukin-12. Int Rev Immunol. 1998;16:365-396[Medline] [Order article via Infotrieve]. 9. Hakkinen T, Karkola K, Yla-Herttuala S. Macrophages, smooth muscle cells, endothelial cells, and T-cells express CD40 and CD154 in fatty streaks and more advanced human atherosclerotic lesions. Colocalization with epitopes of oxidized low-density lipoprotein, scavenger receptor, and CD16. Virchows Arch. 2000;437:396-405[CrossRef][Medline] [Order article via Infotrieve]. 10. Mach F, Schönbeck U, Libby P. CD40 signaling in vascular cells: a key role in atherosclerosis? Atherosclerosis. 1998;137(suppl):S89-S95. 11. Mach F, Schönbeck U, Sukhova GK, Atkinson E, Libby P. Reduction of atherosclerosis in mice by inhibition of CD40 signalling. Nature. 1998;394:200-203[CrossRef][Medline] [Order article via Infotrieve].
12.
Shimizu K, Schönbeck U, Mach F, Libby P, Mitchell RN.
Host CD40 ligand deficiency induces long-term allograft survival and donor-specific tolerance in mouse cardiac transplantation but does not prevent graft arteriosclerosis.
J Immunol.
2000;165:3506-3518 13. Kawai T, Andrews D, Colvin RB, Sachs DH, Cosimi AB. Thromboembolic complications after treatment with monoclonal antibody against CD40 ligand. Nat Med. 2000;6:114[Medline] [Order article via Infotrieve]. 14. Sakata N, Hamelmann E, Siadak AW, et al. Differential regulation of CD40-mediated human B cell responses by antibodies directed against different CD40 epitopes. Cell Immunol. 2001;201:109-123.
15.
Krzesz R, Wagner AH, Cattaruzza M, Hecker M.
Cytokine-inducible CD40 gene expression in vascular smooth muscle cells is mediated by nuclear factor
16.
Nguyen VT, Benveniste EN.
Involvement of STAT-1 and ets family members in interferon- 17. Rudert F, Visser E, Forbes L, Lindridge E, Wang Y, Watson J. Identification of a silencer, enhancer, and basal promoter region in the human CD95 (Fas/APO-1) gene. DNA Cell Biol. 1995;14:931-937[Medline] [Order article via Infotrieve].
18.
Wagner AH, Krzesz R, Gao D, Schroeder C, Cattaruzza M, Hecker M.
Decoy oligodeoxynucleotide characterization of transcription factors controlling endothelin-B receptor expression in vascular smooth muscle cells.
Mol Pharmacol.
2000;58:1333-1340
19.
Sato T, Selleri C, Young NS, Maciejewski JP.
Hematopoietic inhibition by interferon-
20.
Pine R.
Convergence of TNF 21. Libby P, Mach F, Schönbeck U, Bourcier T, Aikawa M. Regulation of the thrombotic potential of atheroma. Thromb Haemost. 1999;82:736-741[Medline] [Order article via Infotrieve]. 22. Clark LB, Foy TM, Noelle RJ. CD40 and its ligand. Adv Immunol. 1996;63:43-78[Medline] [Order article via Infotrieve].
23.
Morishita R, Higaki J, Tomita N, Ogihara T.
Application of transcription factor "decoy" strategy as means of gene therapy and study of gene expression in cardiovascular disease.
Circ Res.
1998;82:1023-1028 24. Mann MJ, Dzau VJ. Therapeutic applications of transcription factor decoy oligonucleotides. J Clin Invest. 2000;106:1071-1075[Medline] [Order article via Infotrieve].
25.
Karmann K, Hughes CC, Schechner J, Fanslow WC, Pober JS.
CD40 on human endothelial cells: inducibility by cytokines and functional regulation of adhesion molecule expression.
Proc Natl Acad Sci U S A.
1995;92:4342-4346 26. Francisco JA, Kiener PA, Moran-Davis P, Ledbetter JA, Siegall CB. Cytokine activation sensitizes human monocytic and endothelial cells to the cytotoxic effects of an anti-CD40 immunotoxin. J Immunol. 1996;157:1652-1658[Abstract].
27.
Mach F, Schönbeck U, Sukhova GK, et al.
Functional CD40 ligand is expressed on human vascular endothelial cells, smooth muscle cells, and macrophages: implications for CD40-CD40 ligand signaling in atherosclerosis.
Proc Natl Acad Sci U S A.
1997;94:1931-1936
28.
Ohmori Y, Schreiber RD, Hamilton TA.
Synergy between interferon-
29.
Quandt K, Frech K, Karas H, Wingender E, Werner T.
MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res.
1995;23:4878-4884
30.
Agresti C, Bernardo A, Del Russo N, et al.
Synergistic stimulation of MHC class I and IRF-1 gene expression by IFN-
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
A. H. Wagner, O. Kautz, K. Fricke, M. Zerr-Fouineau, E. Demicheva, B. Guldenzoph, J. L. Bermejo, T. Korff, and M. Hecker Upregulation of Glutathione Peroxidase Offsets Stretch-Induced Proatherogenic Gene Expression in Human Endothelial Cells Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1894 - 1901. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Warfel and F. D'Agnillo Anthrax Lethal Toxin Enhances I{kappa}B Kinase Activation and Differentially Regulates Pro-inflammatory Genes in Human Endothelium J. Biol. Chem., September 18, 2009; 284(38): 25761 - 25771. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moschonas, M. Kouraki, P. G. Knox, E. Thymiakou, D. Kardassis, and A. G. Eliopoulos CD40 Induces Antigen Transporter and Immunoproteasome Gene Expression in Carcinomas via the Coordinated Action of NF-{kappa}B and of NF-{kappa}B-Mediated De Novo Synthesis of IRF-1 Mol. Cell. Biol., October 15, 2008; 28(20): 6208 - 6222. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vila-del Sol, C. Punzon, and M. Fresno IFN-{gamma}-Induced TNF-{alpha} Expression Is Regulated by Interferon Regulatory Factors 1 and 8 in Mouse Macrophages J. Immunol., October 1, 2008; 181(7): 4461 - 4470. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Warfel and F. D'Agnillo Anthrax Lethal Toxin Enhances TNF-Induced Endothelial VCAM-1 Expression via an IFN Regulatory Factor-1-Dependent Mechanism J. Immunol., June 1, 2008; 180(11): 7516 - 7524. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Prontera, N. Martelli, V. Evangelista, E. D'Urbano, S. Manarini, A. Recchiuti, A. Dragani, C. Passeri, G. Davi, and M. Romano Homocysteine Modulates the CD40/CD40L System J. Am. Coll. Cardiol., June 5, 2007; 49(22): 2182 - 2190. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Holschermann, T. H.W. Stadlbauer, A. H. Wagner, H. Fingerhuth, H. Muth, S. Rong, F. Guler, H. Tillmanns, and M. Hecker STAT-1 and AP-1 decoy oligonucleotide therapy delays acute rejection and prolongs cardiac allograft survival Cardiovasc Res, August 1, 2006; 71(3): 527 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Geraldes, S. Gagnon, S. Hadjadj, Y. Merhi, M. G. Sirois, I. Cloutier, and J.-F. Tanguay Estradiol blocks the induction of CD40 and CD40L expression on endothelial cells and prevents neutrophil adhesion: An ER{alpha}-mediated pathway Cardiovasc Res, August 1, 2006; 71(3): 566 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Passioura, A. Dolnikov, S. Shen, and G. Symonds N-Ras-Induced Growth Suppression of Myeloid Cells Is Mediated by IRF-1 Cancer Res., February 1, 2005; 65(3): 797 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Wagner, B. Guldenzoph, B. Lienenluke, and M. Hecker CD154/CD40-Mediated Expression of CD154 in Endothelial Cells: Consequences for Endothelial Cell-Monocyte Interaction Arterioscler Thromb Vasc Biol, April 1, 2004; 24(4): 715 - 720. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Wagner, M. Gebauer, B. Guldenzoph, and M. Hecker 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase-Independent Inhibition of CD40 Expression by Atorvastatin in Human Endothelial Cells Arterioscler Thromb Vasc Biol, November 1, 2002; 22(11): 1784 - 1789. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. Dzau Transcription Factor Decoy Circ. Res., June 28, 2002; 90(12): 1234 - 1236. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||