| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From The Jackson Laboratory, Bar Harbor, ME.
Relative proportions of peripheral blood (PB) B lymphocytes
(B220%) as well as CD4 (CD4%) and CD8 (CD8%) T lymphocytes
differ significantly among inbred mouse strains: B220% is high in
C57BL/6J (B6) and C57BR/cdJ, intermediate in BALB/cByJ (BALB) and
DBA/2J (D2), and low in NOD/LtJ (NOD) and SJL/J (SJL) mice, whereas
CD4% and CD8% are high in NOD and SJL mice and low in the other 4 strains. By following segregating genetic markers linked to these
traits in (B6 × D2) recombinant inbred (BXD RI) mice, the study
defined 2 quantitative trait loci (QTLs) for the B220% phenotype:
Pbbcp1 (peripheral blood B cell percentage 1, logarithm of
odds [LOD] 4.1, P < .000 01) and Pbbcp2
(LOD 3.7, P < .000 04) on chromosome 1 (Chr 1) at about
63 cM and 48 cM; one suggestive locus for the CD4% phenotype (LOD 2.6, P < .000 57) on Chr 8 at about 73 cM; and one QTL for
the CD8% phenotype: Pbctlp1 (peripheral blood cytotoxic T
lymphocyte percentage 1, LOD 3.8, P < .000 02) on Chr
19 at about 12 cM. The study further segregated PB lymphocyte proportions in B6SJLF2 mice by using DNA markers adjacent to these mapped QTLs and found that the Pbbcp1 locus (LOD 5.6, P < .000 01) was also important in this mouse
population. In both BXD RI and B6SJLF2 mice, QTLs regulating B-cell
proportions showed no significant effect on T-cell proportions and vice
versa. Thus, PB B- and T-lymphocyte proportions are regulated
separately by different genetic elements.
(Blood. 2002;99:561-566) Mature leukocytes in mouse and human
peripheral blood (PB) express specific cell surface molecules (markers)
that can be detected by fluorescence-activated cell staining (FACS)
using specific antibodies.1,2 The major categories of PB
leukocytes include B lymphocytes that express B220, T-helper
lymphocytes that express CD4, cytotoxic T lymphocytes that express CD8,
and granulocytes that express Gr1. Under physiologic conditions,
proportions of PB leukocyte subsets are relatively constant in mice
from a particular genotype, showing a precise regulation of
hematopoietic lineage commitment, differentiation, maturation,
recruitment, and elimination.3 Proportions of PB leukocyte
subsets can be dramatically altered by spontaneous and induced
mutations; for example, a mutation in the DNA-dependent protein kinase
gene in severe combined immune-deficient mice results in the absence of
mature B and T lymphocytes in blood circulation.4-6 In
addition, stromal cells, cytokines, receptors, ligands, signaling
molecules, and transcription factors have been shown to affect levels
of B and T lymphocytes.7-10
Previous studies identified molecular factors that play important roles
in the regulation of B-and T-cell commitment and balance such as
cytokines interleukin-3 (IL-3) and IL-7, signaling receptor and ligand
Notch and Jagged, paired-box gene
Pax5, and the transcriptional factors E2A and
EBF.3,11-13 Mutations that change the relative levels of other leukocyte subsets may also indirectly affect B- and
T-cell proportions.14 Earlier studies found that the
CD4/CD8 ratio is under genetic control in the mouse as well as in
humans.15-17 A study using inbred mouse strains identified
a quantitative trait locus (QTL) that regulates peripheral B220% on
mouse chromosome 15 (Chr 15).18 Differences in the
percentage of pre-B cells (BP-1+B220+) in
the bone marrow of SL/Kh and NFS/N mice helped to map another regulatory QTL on mouse Chr 3.19 These studies illustrated
that there are specific genetic loci that regulate CD4/CD8
ratio, B-cell apoptosis, and pre-B-cell expansion.
We and others have found significant strain differences in primitive
immunohematopoietic progenitor cell functions between B6, BALB, and D2
mice and have defined QTLs that regulate hematopoietic stem cell
development, proliferation, and senescence.20-23 It is important to also define strain differences in mature blood cell proportions. The current study is focused on the genetic elements that
regulate strain differences in blood cell proportions and tests whether
the same QTL affects both B- and T-cell proportions.
We examined PB B220%, CD4%, and CD8% in healthy young mice of 6 inbred strains from 3 separate original stocks and found significant strain differences. We then segregated these strain differences in 35 strains of (C57BL/6 × DBA/2) recombinant inbred (BXD RI) mice and
mapped 2 QTLs for the B220% phenotype, one QTL for the CD8%
phenotype, and one suggestive locus for the CD4% phenotype. We further
analyzed 98 intercross F2 mice derived from C57BL/6J (B6) and SJL/J
(SJL) inbred strains (B6SJLF2) and found that one of the QTLs for the
B220% phenotype was also mapped to the same location in the B6SJLF2
mice. In both studies, PB B- and T-lymphocyte proportions are regulated
separately by different QTLs.
Mice
Sample collection and FACS analysis
Polymerase chain reaction Genomic DNA samples were prepared from mouse tail tips, and DNA markers were analyzed by polymerase chain reaction (PCR) for each of the 98 B6SJLF2 mice. Primers for the Gli2 locus, Gli2-pA: TTCAGGCAGACCAAAGATAGAACATT and Gli2-pB: CACTGACATATGTACCATTTTCAT and primers for the Bcl2 locus, 24.MMBCL2A: CATTATCAATGATGTAC CATG and 24.MMBCL2B: GCAGTAAATAGCTGATTCGAC were purchased from One Trick Pony Oligos (Ramona, CA). Primers for regular Mit DNA microsatellite markers were purchased from Research Genetics (Huntsville, AL). PCRs were carried out in a GeneAmp PCR system 9600 (Perkin Elmer) using Taq DNA polymerase. We used a program with a 97°C touchdown for 30 seconds followed by 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds + 1 second. A 10-minute enlongation at 72°C was added at the end of the reaction. Each sample was amplified in 10 µL volume, electrophoresed in a 3% agarose gel, and stained with ethidium bromide.QTL mapping and statistical analysis Genotype data for the 35 BXD RI mouse strains were retrieved online from the Mouse Genome Database, which is maintained at The Jackson Laboratory (http://www.bioinformatics.jax.org). We used Map Manager QTXb11 software, also available online at the same Web site, for QTL mapping analyses.26 Significance of linkage was judged by using the LOD (logarithm of odds) score in both the RI lines and the B6SJLF2 intercross mice.26-28 The B220%, CD4%, and CD8% of B6SJLF2 mice were also tested by variance analysis, using the JMP statistical discovery software (SAS Institute, Cary, NC) on the Fit Model platform to define allelic difference.29
Strain differences in PB lymphocyte proportions We analyzed PB leukocyte proportions in healthy young (2-3 months) B6, C57BR/cdJ, BALB, D2, NOD, and SJL mice. Data presented in Table 1 show that concentrations of circulating white blood cells (WBCs) were high in B6 and C57BR/cdJ mice, slightly lower in BALB and D2 mice, and significantly lower (P < .01) in NOD and SJL mice. Percentages of B cells (B220%) were significantly different among the 6 inbred strains (P < .01): high in B6 (67%) and C57BR/cdJ (60%) mice, intermediate in BALB (46%) and D2 (46%) mice, and low in NOD (18%) and SJL (16%) mice. Percentages of CD4 (CD4%) and CD8 (CD8%) T lymphocytes were significantly higher (P < .01, P < .01) in NOD (50%, 17%) and SJL (58%, 20%) mice than in the other 4 strains (CD4, 13%-30%; CD8, 6%-11%), whereas percentages of granulocytes (Gr1%) were similar in the 6 strains (Table 1, Figure 1). Thus, there are significant strain differences in mouse PB B220%, CD4%, and CD8%, suggesting that PB lymphocyte proportions are genetically regulated.
To define the pattern of inheritance, we measured B220%, CD4%, CD8%, Gr1%, and total WBCs in B6D2F1 and CByB6F1 hybrid mice. Interestingly, both hybrid F1 stocks had leukocyte proportions similar to those of B6 mice (Table 1), indicating that B6 genetic elements are dominant to those of the BALB or D2 genetic elements in the regulation of PB lymphocyte proportions. Mapping QTLs for PB lymphocyte proportions in BXD RI mice To segregate the genetic factors that regulate lymphocyte proportions, we measured B220%, CD4%, and CD8% in PB of healthy young mice from 35 BXD RI strains. Individuals from the same RI strain share the same genotype and are homozygous at almost all (> 99.99%) loci, with about half of the loci carrying alleles from each parental strain.30,31 Many polymorphic loci and DNA markers have been analyzed in the BXD RI strains, and the allele information is available online through the Mouse Genome Database. The mean B220%, CD4%, and CD8% values for the 35 BXD RI strains shown in Table 2 were used in mapping analyses, which relied heavily on data from BXD 1-32 (Table 2) because many marker loci have not been defined in BXD 33-42.
For the B220% phenotype, we mapped 2 QTLs. One of these QTLs showed
linkage to the 62- to 64-cM segment of Chr 1 with the strongest
linkage to the D1Mit188 marker at 63.1 cM (LOD 4.1, P < .000 01). We have provisionally designated this
locus peripheral blood B cell percentage 1, or Pbbcp1
(Figure 2A). The other locus also mapped
to Chr 1 with the strongest linkage to the D1Ncvs45 marker
at 48.4 cM (LOD 3.7, P < .000 04). We designated this
locus Pbbcp2 (Figure 2A). Both P values passed
the P < .0001 threshold and are considered significant in
genome-wide mapping analyses.27,32 The Bcl2
locus is located in between the 2 QTLs at 59.8 cM.
For the CD4% phenotype, we found a putative linkage to a DNA marker D8Mit156 (LOD 2.6, P < .000 57) at 73 cM on Chr 8 (Figure 2B). This P value is considered suggestive and reportable but not fully significant.27,32 For the CD8% phenotype, we mapped a QTL to the 9- to 24-cM region of Chr 19 with the strongest linkage to the D19Mit28 marker at 12 cM (LOD 3.8, P < .000 02). We have designated this locus peripheral blood cytotoxic T lymphocyte percentage 1, or Pbctlp1 (Figure 2C). From the mapping analyses, we noted that the QTL for the B220% phenotype showed no linkage to either the CD4% or the CD8% phenotype. However, the Pbbctlp1 locus had no linkage to the B220% phenotype either. Thus, B- and T-cell proportions are regulated by different QTLs in the BXD RI mice. Mapping of the Pbbcp1 locus to the same location in B6SJLF2 mice The existence of RI lines with preanalyzed genotype data provides a good resource for QTL mapping. However, other genetic methods should be used to test QTLs defined by RI lines. Toward this end, we produced a panel of B6SJLF2 mice and measured PB B220%, CD4%, and CD8% at 2 to 3 months of age. We then tested DNA markers on each mouse near each putative locus defined earlier by using the BXD RI lines. When a marker of interest was not polymorphic between B6 and SJL mice, a nearby polymorphic marker was analyzed.We first tested the hypothesis that Pbbcp1 and
Pbbcp2 are important loci in the regulation of B220%
difference between B6 and SJL mice. This test was done by analyzing 12 polymorphic markers in the 41- to 70-cM region of Chr 1 on 98 B6SJLF2
mice, followed by a mapping analysis. Three markers adjacent to the
Pbbcp1 locus, D1Mit387 (62 cM), Gli2
(63 cM), and D1Mit419 (63.1 cM), all showed strong linkage
to the B220% phenotype (LOD 5.4, 5.6, and 5.6, all at
P < .000 01), whereas the linkages to the B220% were
lower but still significant at Bcl2 (59.8 cM, LOD 4.9).
D1Mit139 (65 cM, LOD 5.4), D1Mit286 (67 cM, LOD
5.2), and D1Mit446 (70 cM, LOD 4.9) loci (Figure
3). Note that the Gli2 and
D1Mit419 loci overlap on Figure 3. At the Gli2
locus where Pbbcp1 showed the strongest linkage (LOD 5.6),
B220% was significantly higher (P < .01) in the carriers
of the B6 (36.6% ± 1.8%) and F1 (32.6% ± 1.0%) alleles than in
the carriers of the SJL (6.3% ± 1.3%) allele. Thus, we mapped the
Pbbcp1 locus to the same 60- to 70-cM Chr 1 location in the
B6SJLF2 intercross mouse population. It is of particular interest to
note that the Pbbcp1 locus had no effect on either the CD4%
or the CD8% phenotype in B6SJLF2 mice, further indicating that PB B-
and T-lymphocyte proportions are regulated by different genetic
elements.
The other 5 Chr 1 markers we have tested on B6SJLF2 mice that cover the Pbbcp2 locus region showed decreasing significance levels in the linkage analysis: D1Mit135 (59.7 cM, LOD 4.5, P < .000 01), D1Mit48 (54.0 cM, LOD 3.5, P < .000 05), D1Mit216 (49.7 cM, LOD 2.5, P < .000 87), D1Mit46 (43.1 cM, LOD 2.3, P < .001 18), and D1Mit24 (41.0 cM, LOD 2.0, P < .002 30). Thus, on the basis of the markers we have tested, Pbbcp2 was not an independent locus for the B220% phenotype in the B6SJLF2 mouse population. For the suggestive CD4% locus, we tested 12 standard Mit markers in the 69- to 73-cM region of Chr 8: D8Mit140 and D8Mit324 at 69 cM; D8Mit122 at 70 cM; D8Mit42, D8Mit52, D8Mit92, D8Mit279, and D8Mit325 at 71 cM; D8Mit93, D8Mit245, and D8Mit326 at 72 cM; and D8Mit156 at 73 cM. None of these markers showed detectable polymorphism between B6 and SJL mice by using our assay. For the Pbctlp1 locus, we tested 5 polymorphic markers in the 8- to 41-cM region of mouse Chr 19 on B6SJLF2 mice: D19Mit69 (8 cM), D19Mit61 (9 cM), D19Mit106 (22 cM), D19Mit40 (25 cM), D19Mit11 (41 cM), and we performed a mapping analysis. None of the 5 tested markers was linked to the CD8% phenotype in the B6SJLF2 intercross mouse population. It is possible that the SJL strain may not differ from the B6 strain at the Pbctlp1 locus. Overall, we mapped 2 QTLs for the B220% phenotype, one QTL for the
CD8% phenotype and one suggestive locus for the CD4% phenotype by
using the BXD RI mice (Table 3). The
Pbbcp1 locus was also mapped to the same Chr 1 region in the
B6SJLF2 intercross mouse population.
Genetic regulation of PB lymphocyte proportions Mouse PB B220%, CD4%, and CD8% are genetically regulated, as shown by the consistent differences among inbred mouse strains derived from different original stocks (Table 1). The B6 and C57BR/cdJ inbred strains both originated from the mating of female 57 with male 52 from Miss Abbie Lathrop's stock,24 and both have high levels of B cells and low levels of CD4 and CD8 T cells. The BALB and D2 inbred strains both originated from Castle mice received from Lathrop,24 and both have intermediate levels of B cells and low levels of CD4 and CD8 cells. The NOD and SJL inbred strains both originated from Swiss mice at the Pasteur Institute. NOD was derived from outbred ICR/Jcl mice in the 1970s, and SJL was derived from noninbred Swiss Webster mice in the 1960s.33 Both of these Swiss-derived strains have low levels of B cells and high levels of CD4 and CD8 cells (Table 1). With low concentrations of circulating WBCs (Table 1), NOD and SJL mice have significantly lower levels of circulating B cells than the other 4 strains.Importance in the regulation of PB lymphocyte proportions Regulation of PB lymphocyte proportions may have biomedical significance. B6 and C57BR/cdJ mice have high B220%, low CD4% and CD8%, and low tumor incidences.34-39 BALB and D2 mice have intermediate B220%, CD4%, and CD8% and intermediate tumor incidences.34,35,39,40 SJL mice have low B220%, high CD4% and CD8%, and high tumor incidences, especially of the type B-reticulum cell sarcoma.41-43 NOD mice also have low B220% and high CD4% and CD8%. They develop many types of tumors when fed a specific diet to prevent diabetes.44 Thus, mouse PB B220%, CD4%, and CD8% measured early in life may be associated with tumor incidences later in life.Regulation of PB lymphocyte proportion may also be related to average
life span. In 22 strains of inbred mice and 5 F1 hybrids, we found that
mean life span is positively correlated with B220% (r = 0.67, P < .0001), negatively correlated
with CD4% (r = QTL mapping Our mapping analyses on the BXD RI mice used 3 phenotypes; thus, the threshold P value for significant linkage on genome-wide scan should be adjusted to .000 03 for each phenotype (.0001 3). Judging by this adjusted P value, the Pbbcp1
and Pbctlp1 loci are still significant, whereas the
Pbbcp2 locus is marginally significant. Because the
Pbbcp1 locus was also mapped to the same chromosomal region
by using the B6SJLF2 mice, this locus regulates B220% in both the
B6-D2 and B6-SJL genetic combinations.
The Pbbcp2 locus had the strongest linkage to the D1Ncvs44 marker at 48.4 cM on Chr 1 in the BXD RI mice.46 Interestingly, another locus, Ncl, also located at 48.4 cM on Chr 1,47,48 showed no linkage to the B220% phenotype in the same BXD RI strains (data not shown) because 8 of the 26 BXD RI strains showed crossover between the D1Ncvs44 locus and the Ncl locus. Whether or not the D1Ncvs44 locus is polymorphic between B6 and SJL mice is yet to be defined. Thus, further analyses are needed to clarify whether Pbbcp2 is a real locus, and whether the Pbbcp2 locus is really located at 48.4 cM on mouse Chr 1. The fact that neither the Pbctlp1 nor the suggestive CD4% locus were found in the B6SJLF2 intercross mice indicates that the B6 and SJL mice are probably not polymorphic at these loci. It is possible that the suggestive CD4% locus may not be a real locus. It is also possible, although less likely, that the Pbctlp1 locus is a false-positive QTL for regulating the CD8% phenotype. Importantly, in both the BXD RI and the B6SJLF2 mice, B220%, CD4%, and CD8% are each regulated by different genetic elements. The Pbbcp1 and Pbbcp2 loci had no significant effect on the CD4% and CD8% phenotypes, whereas the Pbctlp1 locus had no significant effect on the B220% and CD4% phenotypes. Potential gene candidates for the Pbbcp1 locus There are many genes in the 60- to 70-cM Chr 1 region that are potential candidates for the Pbbcp1 locus (Table 4); however, we emphasize 2 possibilities: Gli2 at 63 cM and En1 at 64.1 cM, both of which are important genes in the regulation of embryonic development. The Gli2 locus is polymorphic between B6 and D2 and between B6 and SJL mice. It encodes the vertebrate GLI2 zinc finger protein that is a putative transcription factor responding to sonic hedgehog signaling.49,50 Mutant mice lacking Gli2 function exhibit defects in embryonic development.49,51,52 To date, there has been no report showing that Gli2 is involved in lymphohematopoiesis. However, the Gli2 polymorphism marked the B220% phenotype in both BXD RI (LOD 3.7, P < .000 04, Figure 2A) and B6SJLF2 mice (LOD 5.6, P < .000 01, Figure 3), suggesting that Gli2 may be a candidate gene for the Pbbcp1 locus. The En1 locus encodes a homeobox-containing transcriptional factor that controls pattern formation during development of the central nervous system.53-55 En1 showed significant linkage to the Pbbcp1 locus in the BXD RI lines (LOD 3.6, P < .000 05). Other potential candidate genes for the Pbbcp1 locus and their locations and human homologies are listed in Table 4. However, all candidates are very tentative at the current level of genetic resolution.
Overall, the mapping of the Pbbcp1 locus in 2 independent studies suggests that this locus is important in the regulation of PB B220% in both the B6-D2 and B6-SJL genetic combinations. In both studies, B- and T-cell proportions are regulated independently by different QTLs. Such genetically based regulation of PB lymphocyte proportion may be associated with health and longevity. Because the Pbbcp1 locus maps to a well-conserved chromosomal region that harbors genes regulating embryonic development, it is possible that the gene or genes encoded by this locus may regulate cell fate both during embryonic development and during adult lymphohematopoiesis.
We thank Drs Edward H. Leiter and Brian Soper for critical review comments, Dr Stephen Sampson for technical editing, Mr Ted Duffy for technical assistance in FACS analyses, and Ms Elaine Shown for technical assistance in PCR analyses.
Submitted April 16, 2001; accepted August 6, 2001.
Supported by R01 grant HL58820 and a core grant CA34196 from the National Institutes of Health.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Jichun Chen, The Jackson Laboratory, Bar Harbor, ME 04609-1500; e-mail: jchen{at}jax.org.
1. Spangrude GJ, Klein J, Heimfeld S, Aihara Y, Weissman IL. Two monoclonal antibodies identify thymic-repopulating cells in mouse bone marrow. J Immunol. 1989;142:425-430[Abstract]. 2. Wu L, Scollay R, Egerton M, et al. CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus. Nature. 1991;349:71-74[CrossRef][Medline] [Order article via Infotrieve]. 3. Busslinger M, Nutt SL, Rolink AG. Lineage commitment in lymphopoiesis. Curr Opin Immunol. 2000;12:151-158[CrossRef][Medline] [Order article via Infotrieve].
4.
Kirchgessner CU, Patil CK, Evans JW, et al.
DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect.
Science.
1995;267:1178-1183
5.
Blunt T, Gell D, Fox M, et al.
Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the SCID mouse.
Proc Natl Acad Sci U S A.
1996;93:10285-10290
6.
Greiner DL, Hesselton RA, Shultz LD.
SCID mouse models of human stem cell engraftment.
Stem Cells.
1998;16:166-177 7. Obinata M, Okuyama R, Matsuda KI, Koguma M, Yanai N. Regulation of myeloid and lymphoid development of hematopoietic stem cells by bone marrow stromal cells. Leuk Lymphoma. 1998;29:61-69[Medline] [Order article via Infotrieve].
8.
Borge OJ, Adolfsson J, Jacobsen AM.
Lymphoid-restricted development from multipotent candidate murine stem cells: distinct and complimentary functions of the c-kit and flt3-ligands.
Blood.
1999;94:3781-3790
9.
Metcalf D.
Lineage commitment in the progeny of murine hematopoietic preprogenitor cells: influence of thrombopoietin and interleukin 5.
Proc Natl Acad Sci U S A.
1998;95:6408-6412
10.
Colucci F, Di Santo JP.
The receptor tyrosine kinase c-kit provides a critical signal for survival, expansion, and maturation of mouse natural killer cells.
Blood.
2000;95:984-991 11. Thompson A, Brouns GS, Schuurman RK, Borst J, Timmers E. A pro-B-cell stage characterized by germline Ig transcription without surrogate light chain expression. Immunogenetics. 1998;48:305-311[CrossRef][Medline] [Order article via Infotrieve]. 12. Nutt SL, Heavey B, Rolink AG, Busslinger M. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 1999;401:556-562[CrossRef][Medline] [Order article via Infotrieve]. 13. Enver T. B-cell commitment: Pax5 is the deciding factor. Curr Biol. 1999;9:R933-935[CrossRef][Medline] [Order article via Infotrieve].
14.
Dave VP, Allman D, Keefe R, Hardy RR, Kappes DJ.
HD mice: a novel mouse mutant with a specific defect in the generation of CD4+ T cells.
Proc Natl Acad Sci U S A.
1998;95:8187-8192 15. Clementi M, Forabosco P, Amadori A, et al. CD4 and CD8 T lymphocyte inheritance. Evidence for major autosomal recessive genes. Hum Genet. 1999;105:337-342[CrossRef][Medline] [Order article via Infotrieve]. 16. Kraal G, Weissman IL, Butcher EC. Genetic control of T-cell subset representation in inbred mice. Immunogenetics. 1983;18:585-592[CrossRef][Medline] [Order article via Infotrieve]. 17. Amadori A, Zamarchi R, De Silvestro G, et al. Genetic control of the CD4/CD8 T-cell ratio in humans. Nat Med. 1995;1:1279-1283[CrossRef][Medline] [Order article via Infotrieve]. 18. Hoag KA, Clise-Dwyer K, Lim YH, et al. A quantitative-trait locus controlling peripheral B-cell deficiency maps to mouse Chromosome 15. Immunogenetics. 2000;51:924-929[CrossRef][Medline] [Order article via Infotrieve].
19.
Lu LM, Shimada R, Higashi S, Zeng Z, Hiai H.
Bone marrow ptr-B-1 (Bomb1): a quantitative trait locus inducing bone marrow pre-B-cell expansion in lymphoma-prone SL/Kh mice.
Cancer Research.
1999;59:2593-2595 20. Chen J, Astle CM, Harrison DE. Development and aging of primitive hematopoietic stem cells in BALB/cBy mice. Exp Hematol. 1999;27:928-935[CrossRef][Medline] [Order article via Infotrieve]. 21. Chen J, Astle CM, Harrison DE. Genetic regulation of primitive hematopoietic stem cell senescence. Exp Hematol. 2000;28:442-450[CrossRef][Medline] [Order article via Infotrieve].
22.
de Haan G, Van Zant G.
Intrinsic and extrinsic control of hemopoietic stem cell numbers: mapping of a stem cell gene.
J Exp Med.
1997;186:529-536
23.
de Haan G, Nijhof W, Van Zant G.
Mouse strain-dependent changes in frequency and proliferation of hematopoietic stem cells during aging: correlation between lifespan and cycling activity.
Blood.
1997;89:1543-1550 24. Staff of The Jackson Laboratory. Handbook on Genetically Standardized JAX Mice. Bar Harbor, ME: The Jackson Laboratory; 1997. 25. Chen J, Astle CM, Harrison DE. Delayed immune aging in diet-restricted B6CBAT6F1 mice is associated with preservation of naive T cells. J Gerontol Biol Sci. 1998;53A:B330-337[Abstract]. 26. Manly KF, Olson JM. Overview of QTL mapping software and introduction to Map Manager QT. Mamm Genome. 1999;10:327-334[CrossRef][Medline] [Order article via Infotrieve].
27.
Lander ES, Schork NJ.
Genetic dissection of complex traits.
Science.
1994;265:2037-2048 28. Kruglyak L, Lander ES. A nonparametric approach for mapping quantitative trait loci. Genetics. 1995;139:1421-1428[Abstract]. 29. SAS Institute Inc. JMP Statistics and Graphics Guide, Version 3. Cary, NC: SAS Institute; 1998. 30. Taylor BA. Recombinant inbred strains. In: Lyon MF,Rastan S,Brown SDM, eds. Genetic Variants and Strains of the Laboratory Mouse. Vol 2. New York, NY: Oxford University Press; 1996:1597-1633. 31. Bailey DW. Recombinant inbred strains and bilineal congenic strains. In: Foster HL,Small JD,Fox JG, eds. The Mouse in Biomedical Research. Vol I. New York, NY: Academic Press; 1981:223-239. 32. Belknap JK, Mitchell SR, O'Toole LA, Helms ML, Crabbe JC. Type I and type II error rates for quantitative trait loci (QTL) mapping studies using recombinant inbred mouse strains. Behav Genet. 1996;26:149-160[CrossRef][Medline] [Order article via Infotrieve]. 33. Committee on Immunologically Compromised Rodents, Institute of Laboratory Animal Resources, Commission on Life Science, and National Research Council. Immunodeficient Rodents: A Guide to Their Immunobiology, Husbandry, and Use. Washington, DC: National Academy Press; 1989. 34. Hoag WG. Spontaneous cancer in mice. Ann N Y Acad Sci. 1963;108:805-831. 35. Myers DD, Meier H, Huebner RJ. Prevalence of murine C-type RNA virus group specific antigen in inbred strains of mice. Life Sci. 1970;9:1071-1080[CrossRef]. 36. Murphy ED. Characteristic tumors. In: Green EL, ed. Biology of the Laboratory Mouse 2nd ed. New York, NY: McGraw-Hill; 1966:521-562.
37.
Festing MFW, Blackmore DK.
Life span of specified-pathogen-free (MRc category 4) mice and rats.
Lab Anim.
1971;5:179-192
38.
Staats J.
Standardized nomenclature for inbred strains of mice: sixth listing.
Cancer Res.
1976;36:4333-4377 39. Storer JB. Longevity and gross pathology at death in 22 inbred strains of Mice. J Gerontol. 1966;21:404-409. 40. Heston WE. Genetic aspects of experimental animals in cancer research. Jpn Cancer Assoc Gann Monogr. 1968;5:3-15. 41. Crispens CG. Some characteristics of strain SJL/JDg mice. Lab Animal Sci. 1973;23:408-413. 42. Murphy ED. SJL/J, a new inbred strain of mouse with a high, early incidence of reticulum-cell neoplasms. Proc Am Assoc Cancer Res. 1963;4:46.
43.
Fujinaga S, Poel WE, Williams WC, Dmochowski L.
Biological and morphological studies of SJL/J strain reticulum cell neoplasms induced and transmitted serially in low leukemia-strain mice.
Cancer Res.
1970;30:729-742 44. Leiter EH. The NOD mouse meets the "Nerup hypothesis": Is diabetogenesis the result of a collection of common alleles presented in unfavorable combinations? In Shafrir E, ed. Frontiers in Diabetes Research. Lessons from Animal Diabetes III. London: Smith-Gordon; 1990:54-58.
45.
Gelman R, Watson A, Bronson R, Yunis E.
Murine chromosomal regions correlated with longevity.
Genetics.
1988;118:693-704 46. Hughes DC, Allen J, Morley G, et al. Cloning and sequencing of the mouse Gli2 gene: localization to the Dominant hemimelia critical region. Genomics. 1997;39:205-215[CrossRef][Medline] [Order article via Infotrieve]. 47. Aitman TJ, Hearne CM, McAleer MA, Todd JA. Mononucleotide repeats are an abundant source of length variants in mouse genomic DNA. Mamm Genome. 1991;1:206-210[CrossRef][Medline] [Order article via Infotrieve].
48.
Huang H, Acuff CG, Steinhelper ME.
Isolation, mapping, and regulated expression of the gene encoding mouse C-type natriuretic peptide.
Am J Physiol.
1996;271:H1565-H1575 49. Ding Q, Motoyama J, Gasca S, et al. Diminished Sonic hedgehog signaling and lack of floor plate differentiation in Gli2 mutant mice. Development. 1998;125:2533-2543[Abstract]. 50. Borycki AG, Mendham L, Emerson CP Jr. Control of somite patterning by Sonic hedgehog and its downstream signal response genes. Development. 1998;125:777-790[Abstract]. 51. Park HL, Bai C, Platt KA, et al. Mouse Gli1 mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Development. 2000;127:1593-1605[Abstract]. 52. Mo R, Freer AM, Zinyk DL, et al. Specific and redundant functions of Gli2 and Gli3 zinc finger genes in skeletal patterning and development. Development. 1997;124:113-123[Abstract]. 53. Danielian PS, McMahon AP. Engrailed-1 as a target of the Wnt-1 signalling pathway in vertebrate midbrain development. Nature. 1996;383:332-334[CrossRef][Medline] [Order article via Infotrieve].
54.
Joyner AL.
Engrailed, Wnt and Pax genes regulate midbrain 55. Wurst W, Auerbach AB, Joyner AL. Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum. Development. 1994;120:2065-2075[Abstract]. 56. Mouse Genome Database (MGD). Mouse genome informatics Web site, The Jackson Laboratory, Bar Harbor, ME. Available at: http://www.informatics.jax.org. Accessed April 10, 2001.
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. T. Russo, G. De Luca, I. Casorelli, P. Degan, S. Molatore, F. Barone, F. Mazzei, T. Pannellini, P. Musiani, and M. Bignami Role of MUTYH and MSH2 in the Control of Oxidative DNA Damage, Genetic Instability, and Tumorigenesis Cancer Res., May 15, 2009; 69(10): 4372 - 4379. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Petkova, R. Yuan, S.-W. Tsaih, W. Schott, D. C. Roopenian, and B. Paigen Genetic influence on immune phenotype revealed strain-specific variations in peripheral blood lineages Physiol Genomics, August 1, 2008; 34(3): 304 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Fenske, C. McMahon, D. Edwin, J. C. Jarvis, J. M. Cheverud, M. Minn, V. Mathews, M. A. Bogue, M. A. Province, H. L. McLeod, et al. Identification of candidate alkylator-induced cancer susceptibility genes by whole genome scanning in mice. Cancer Res., May 15, 2006; 66(10): 5029 - 5038. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, K. Lipovsky, F. M. Ellison, R. T. Calado, and N. S. Young Bystander destruction of hematopoietic progenitor and stem cells in a mouse model of infusion-induced bone marrow failure Blood, September 15, 2004; 104(6): 1671 - 1678. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Karlsson, X. Zhao, I. Lonskaya, M. Neptin, R. Holmdahl, and A. Andersson Novel Quantitative Trait Loci Controlling Development of Experimental Autoimmune Encephalomyelitis and Proportion of Lymphocyte Subpopulations J. Immunol., January 15, 2003; 170(2): 1019 - 1026. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||