| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From the Shinshu University, Graduate School of
Medicine, Department of Infectious Immunology and Pediatrics,
Matsumoto, Japan.
The relationship between class switch recombination (CSR) and
somatic hypermutation has been unclear. By using human
CD27 B-lineage cells undergo characteristic
changes in their immunoglobulin (Ig) genes during differentiation. In
bone marrow, B-cell precursors bring together heavy- and light-chain
variable (VH and VL) region genes
by means of V(D)J recombination between the V, diversity (D), and
joining (J) regions. After they succeed in generating a functional
antigen receptor, they are released into the B-cell pool as naive B
cells. The differentiation of naive B cells into memory B cells occurs
within the germinal centers (GCs) in secondary lymphoid organs, where
activated naive B cells undergo vigorous proliferation, somatic
hypermutation of Ig V-region genes, isotype switching, interaction
with antigens, antigen-driven selection, and differentiation into
memory B cells and plasma cells.1,2
The CD27 molecule belongs to the nerve growth factor
receptor/tumor necrosis factor receptor family3 and plays
an important role in Ig production.4 Adult peripheral
blood (PB) B cells can be divided into at least 2 subtypes on the basis
of the expression of CD27 antigen. CD27+ B cells have been
recently identified as memory B cells by virtue of their Ig production,
morphology, and increased CD27 expression with age5,6 as
well as the fact that they carry somatically mutated V-region
genes.6-8 The absence of switched
IgD However, the characteristics of naive B cells have remained unclear
because of the absence of true naive B-cell markers.
IgD+CD27 Activation-induced cytidine deaminase (AID), a novel number of the RNA
editing cytidine deaminase family, was identified by use of
complementary DNA (cDNA) subtraction from murine lymphoma cells to
understand the molecular mechanism of class switch recombination (CSR)
in B cells. Because AID-deficient mice failed to undergo CSR and
somatic hypermutation, AID may be involved in regulation or catalysis
of the DNA modification step of both class switching and somatic
hypermutation.16
In the study presented here, we investigated the features of
IgD+CD27 Antibodies and reagents
Cell preparation
Preparation and fixation of CD32 transfectants CD32 (Fc RII) transfectants (CD32T) were prepared as described
elsewhere.19 Briefly, total RNA was isolated with the
single-step method from the CD32+ human monocytic cell line
U937. After reverse transcriptase-polymerase chain reaction (RT-PCR),
the amplified cDNA was digested and ligated with the mammalian
expression vector BCMGSHyg.20 The resulting plasmid was
transfected into the murine pre-B-cell line 300-19 21 by
electroporation. CD32T was selected by growth in a culture medium with
hygromycin B (Boehringer Mannheim, Mannheim, Germany) at 1 mg/mL. The cell lines highly expressing CD32 were picked up. The
transfectant cells were then incubated with 1% paraformaldehyde in
phosphate-buffered saline (PBS) for 5 minutes. After 3 washings with
PBS, the cells were cultured in RPMI 1640 with 10% fetal calf serum
for 30 minutes and then used for the analysis.
Flow cytometric analysis Activated adult and CB-purified B cells were stained with anti-CD38-FITC and anti-CD20-PE for analyzing the differentiation into plasma cells or with anti-CD20-FITC and biotin-CD27 conjugates followed by streptavidin-PE for the CD27 expression. Two-color analysis of B-cell surface molecules was performed by a FACScan (Becton Dickinson). The antibody-coated cells were gated on living cells by cell size and granularity and then counted by means of flow cytometric analysis.B-cell proliferation assay Highly purified adult CD20+CD27+, CD20+CD27 , and CB B cells were cultured in
the presence of medium alone, SAC + IL-2, anti-CD40 mAb
cross-linked with CD32T (CD40/CD32T), SAC + IL-2 + IL-10 + CD40/CD32T, or IL-4 with or without CD40/CD32T at a final cell density of 2.5 × 105 to 5 × 105/mL in a
volume of 200 µL per well. The cells were cultured in 96-well
round-bottom plates (Nunc, Roskilde, Denmark) for 3 days at 37°C in a
humidified atmosphere with 5% CO2. The cultures were then
pulsed with 0.5 µCi (18.5 Bq) [3H]thymidine.
After 18 hours of incubation, the cells were harvested by an automatic
cell harvester (Packard, Meriden, CT), and [3H]thymidine
incorporation was measured on a liquid scintillation analyzer (Packard).
Ig assay by ELISA For the IgG, IgM, and IgA syntheses, highly purified adult CD20+CD27+, CD20+CD27 , and CB B cells were cultured with
medium alone, SAC + IL-2, IL-10 + CD40/CD32T, or SAC + IL-2 + IL-10 + CD40/CD32T with or without various
concentrations (0.1, 1 and 10 ng/mL) of TGF- . The cells were
cultured for 8 to 10 days at 37°C in a humidified atmosphere with 5%
CO2. For the IgE synthesis, the cells were cultured with
medium alone, IL-4, or IL-4 + CD40/CD32T for 14 days under the
same conditions. The final cell density was 2.5 × 105 to
5 × 105/mL in a volume of 200 µL per well. The plates
were coated with goat antihuman Igs (Southern Biotechnology,
Birmingham, AL) for the detection of IgG, IgM, and IgA and with
antihuman IgE (CIA-E 7.12 and CIA-E 4.15, provided by Dr A. Saxon,
Division of Clinical Immunology/Allergy, UCLA School of Medicine, Los
Angeles, CA) for the detection of IgE. The cultured supernatants were
harvested and added to 96-well flat enzyme-linked immunosorbent assay
(ELISA) plates (Nunc). The standard human IgG, IgM, IgA (Sigma), or IgE (Chemicon International, Temecula, CA) was also added to the plates. After an overnight culture at 4°C, the supernatants were discarded and the wells were washed with 0.05% Tween 20 in PBS. Alkaline phosphatase-labeled goat antihuman IgG, IgM, IgA, and IgE (Sigma) at a
dilution of 1:2500 was added for the detection of IgG, IgM, IgA, and
IgE, respectively. After 2 hours of incubation at room temperature,
color detection was performed with
3-[cyclohexylamino]-1-propanesulfonic acid buffer containing
p-Nitrophenyl phosphate (Sigma). Calibration was performed with
PBS at standard zero levels. No cross-reaction among IgG, IgM, IgA, and
IgE occurred in this ELISA system.
RT-PCR of mature , or CB B cells at the cell numbers
of 0.5 × 106 to 1 × 106 cells were
cultured with medium only or 0.01% SAC, 50 U/mL IL-2, 50 ng/mL IL-10,
and 1 µg/mL anti-CD40 mAb cross-linked with CD32T (for indicating
times). Total RNA was extracted by the acid-guanidine thiocyanate-phenol-chloroform method using an RNAzol rapid RNA purification kit (Biotex, Houston, TX). First-strand cDNA copies were
synthesized by using Superscript II Reverse Transcriptase (Life
Technologies, Grand Island, NY) with oligo (dT) (Life Technologies) as
a primer in a total volume of 20 µL, and then PCR was performed. The
following oligonucleotide primers were used for PCR: for germline C 1, sense primer, 5'-ACGAGGAACATGACTGGATGC-3'; antisense primer, 5'-TGTGAGTTTTGTCACAAGATTTGGG-3'; for germline C 2,
5'-TCTCAGCCAGGACCAAGGAC-3' and 5'-ACTCGACACAACATTTGCG-3'; for mature
C 1, 5'-CCTGGTCACCGTCTCCTCA-3' and 5'-TGTGAGTTTTGTCACAAGATTTGGG-3';
for mature C 2, 5'-CCTGGTCACCGTCTCCTCA-3' and
5'-ACTCGACACAACATTTGCG-3'; and for AID, 5'-AGCTGACAATGATGAATCTCA-3' and
5'-CTTGGGGTAGTGAGCGTTGTA-3'. A total of 2 to 5 µL cDNA was amplified
in PCR using each primer and Taq DNA polymerase (Life Technologies).
The amplified products were analyzed on a 1.2% agarose gel containing
ethidium bromide and visualized by UV light illumination. The
2-microglobulin sense primer 5'-GCTATGTGTCTGGGTTTCAT-3' and antisense primer 5'-ATCTTCAAACCTCCATGATG-3' were used as controls.
Sequence analysis of Ig V-region genes Total RNA was isolated from the sorted B cells or plasma cells derived from naive B cells with the aid of the RNAzol rapid RNA purification kit (Biotex) and then reverse transcribed into cDNA using the oligo (dT) primer and Superscript II Reverse Transcriptase (Life Technologies). VH5 genes were amplified by using primers corresponding to the 5' region of the VH5 leader sequence (ATGGGGTCAACCGCCATCCT) and to the 3' Cµ constant region (GTCCTGTGCGAGGCAGCCAA). PCR products were ligated into the pCR2.1 vector (Invitrogen, Carlsbad, CA) and transformed into TOP10F' bacteria (Invitrogen). Individual clones were selected and expressed, and then plasmid DNA was purified. DNA sequencing was performed with a dideoxy termination technique using an ABI 377 sequencer (Perkin-Elmer Applied Biosystems, Weiterstadt, Germany).
Characteristics of CD27 B cells did
not, as previously reported.5,14,22 To clarify the
production of Igs by CD27 B cells, we first attempted to
promote IgG, IgM, and IgA production by CD27 B cells with
various stimuli. For this purpose, we obtained highly purified adult
CD27 B cells by sorting and CB B cells, most of which
were CD27 cells, by anti-CD19 mAb-coated immunomagnetic
bead separation (Figure 1). Sequence
analyses of the Ig VH5 region genes isolated from both the
sorting-purified adult CD27 B cells (average mutation
frequency 0.09%, n = 4, 48 clones) and the purified CB B cells
(average mutation frequency 0.08%, n = 4, 48 clones) produced
evidence of unmutated sequences, indicating that they did not carry
somatic hypermutation and were naive B cells. Adult CD27
B cells did not produce IgG, IgM, and IgA in the presence of medium
alone, of SAC + IL-2, or of IL-10 + CD40/CD32T. In contrast, adult CD27+ B cells produced large amounts of IgG, IgM, and
IgA (Table 1). It was remarkable that
adult CD27 B cells produced large amounts of IgG and IgM
but not IgA in the presence of SAC + IL-10 + IL-2 + CD40/CD32T (Table 1). Similarly, highly purified CB B cells did not
produce IgG or IgA, although they produced marginal levels of IgM, in
the presence of SAC + IL-2 or IL-10 + CD40/CD32T and produced
large amounts of IgG and IgM but not IgA when stimulated with SAC + IL-10 + IL-2 + CD40/CD32T (Table 1). In addition, both
adult CD27 and CB B cells, CD27+ memory B
cells, produced all subclasses of IgG with the same stimuli (data not
shown). Detectable levels of IgG and IgM were also produced by both
naive B cells with SAC + IL-2 + CD40/CD32T as the stimulus
(data not shown). These findings indicate that adult CD27
naive B cells and CB B cells have the ability to produce IgG and IgM
but not IgA in conjunction with SAC as reagents of B-cell receptor
(BCR) engagement and CD40 signaling in the presence of IL-2 and
IL-10.
IgE synthesis by CD27 B cells, and
CB B cells did not produce IgE with medium or IL-4 alone, but these B
cells produced substantial amounts of IgE in the presence of IL-4 + anti-CD40 mAb. The IgE production by CD27+,
CD27 , and CB B cells was greatly enhanced with IL-4 + anti-CD40 mAb cross-linked with CD32 transfectants (Table
2). These data demonstrate that
CD27 naive B cells and CB B cells have the ability to
produce IgE if they obtain substantial levels of CD40
signaling.
Naive B-cell proliferation To define the characteristics of naive B cells, we next investigated the proliferation of adult CD27 naive B
cells and CB B cells in comparison with that of CD27+
memory B cells. CD40/CD32T alone, SAC + IL-2, or IL-4 + CD40/CD32T induced the proliferation of naive B cells as well as of
CD27+ B cells, while SAC + IL-10 + IL-2 + CD40/CD32T induced much higher levels of proliferation. IL-4 could
synergize with CD40 pathway for the naive B-cell proliferation (Table
3). These findings indicate that the
prominent proliferation of naive B cells can be induced by CD40
signaling or SAC + IL-2 and be augmented by a combination of
such stimuli.
The effect of TGF- is a potent cytokine that regulates the IgA synthesis by B cells, as previously demonstrated.15,23-25 Therefore, we
investigated whether TGF- could induce IgA production in the
presence of SAC + IL-10 + IL-2 + CD40/CD32T in highly
purified adult CD27 naive B cells and CB B cells.
Unexpectedly, neither adult CD27 nor CB B cells produced
IgA when TGF- was added in the presence of SAC + IL-10 + IL-2 + anti-CD40 mAb with or without cross-linking by CD32T. On
the other hand, TGF- inhibited the IgG and IgM synthesis induced by
SAC + IL-10 + IL-2 + anti-CD40 mAb with or without CD32T
in a dose-dependent manner (Figure 2). In
addition, the production of IgA as well as of IgG and IgM from
sorting-purified CD27+ memory B cells in the presence of
SAC + IL-2 or of SAC + IL-10 + IL-2 + anti-CD40 mAb
with or without CD32T (Figure 2) was reduced by the addition of TGF-
in a dose-dependent manner. These findings indicate that TGF- cannot
induce IgA production by naive B cells and has a suppressive effect on
IgA, IgM, and IgG synthesis by memory B cells induced by the stimuli.
TGF- could inhibit the B-cell proliferation in a dose-dependent
manner by various stimuli in both of memory and naive B cells (data
not shown).
The expression of mature and CB B cells produced
IgG, IgM, and IgE, we ascertained whether CSR in transcriptional levels
is also induced by the naive B cells. The germline 1 and 2
messenger RNA (mRNA) was expressed spontaneously from resting
CD27+ and CD27 B cells. Spontaneous
expression of mature 1 and 2 transcripts also be found in adult
CD27+ memory B cells but not in naive B cells (Figure
3). The enhancement of mature 1 and
2 transcripts was observed by CD27+ memory B cells in
the presence of SAC + IL-2 + IL-10 + CD40/CD32T, and the
induction of mature 1 and 2 transcripts was obtained by adult
CD27 and CB B cells with the stimuli (Figure 3). These
results clearly indicate that CSR can be induced by naive B
cells.
AID expression in naive B cells AID is the essential component for both CSR and somatic hypermutation.16 Therefore, we investigated whether AID is inducible by naive B cells. Experiments were conducted in which naive B cells were stimulated, and the expression of AID mRNA was investigated in comparison to that of CD27 mRNA. AID mRNA was not found in resting CD27+ and CD27 B cells. The expression of AID
mRNA was induced by adult CD27 and CB B cells as well as
CD27+ B cells with SAC + IL-2 + IL-10 + CD40/CD32T, whereas its expression by CD27+ B cells was
earlier than that by naive B cells (Figure
4). In parallel with AID mRNA expression,
CD27 mRNA expression was also induced by naive B cells (Figure 4).
These findings indicate that AID is induced by naive B cells by the
stimuli probably before CSR.
Analysis of somatic hypermutation in CD27+ B cells induced from naive B cells Because the CD40-CD154 interaction and BCR engagement can promote the B-cell activation, we attempted to induce the CD27 expression and somatic hypermutation from human naive B cells. Because CD40 stimulation by anti-CD40 mAb + CD32T enhanced the B-cell proliferation and IgE synthesis, we used this cross-linking system via CD40 for the B-cell stimulation. Upon CD40/CD32T or SAC + IL-2, CD27+ B cells were generated from CB B cells, most of which were CD27 B cells, and underwent unmutated sequences of
VH5 genes before stimulation (Figure
5A). However, CD27+ B cells
generated from naive B cells by the stimuli underwent no to low levels
of somatic hypermutation, like CD27 B cells (Figure 5B).
Somatic hypermutation was not induced even by SAC + IL-2 + IL-10 + CD40/CD32T, although the CD27 expression was remarkably
induced by the stimuli (data not shown). In regard to CD27 expression
and somatic hypermutation after the activation of naive B cells, the
same results were obtained when we used adult CD27 B
cells (data not shown). The findings demonstrate that somatic hypermutation cannot be induced in vitro by the CD40 engagement or BCR
engagement despite the remarkable induction of the CD27 expression.
Generation of plasma cells from CD27
B cells produced large amounts of Igs in response to a combination of
the stimuli, which prompted us to ascertain whether plasma cells can be
generated from CD27 naive B cells. We therefore studied
the effects of various stimuli on the generation of plasma cells from
CD27 naive B cells. Flow cytometric analyses with
anti-CD38 and anti-CD20 identified noticeable levels of the
differentiation of adult CD27 B cells into plasma cells
in the presence of SAC + IL-10 + IL-2 + CD40/CD32T and
mild to moderate levels of differentiation in the presence of SAC + IL-2, IL-10 + CD40/CD32T, or IL-4 + CD40/CD32T (Figure
6). Similar results were observed in CB B
cells (data not shown). These results clearly demonstrate that the
differentiation of naive B cells into plasma cells can be induced in
parallel with Ig synthesis as a result of engagement with the B-cell Ig receptor and CD40 signaling in the presence of IL-2 and IL-10.
Somatic hypermutation in plasma cells generated from naive B cells Because large amounts of IgM, IgG, and IgE were produced from naive B cells by the appropriate stimuli, we finally investigated whether plasma cells generated from naive B cells carried somatic hypermutation. We obtained highly pure plasma cells, generated from CB B cells with SAC + IL-10 + IL-2 + CD40/CD32T, with a basophilic cytoplasm with a pale Golgi zone and an eccentric nucleus (Figure 7A). Naive B cells before the stimulation displayed the germline in VH5 genes (data not shown). In contrast, adult CD27+ B cells carried mutated V-region genes with amino acid changes (frequency of nucleotide changes 4.8%). As shown in the amino acid sequence of the VH5 genes in plasma cells generated from CB B cells, no noticeable induction of somatic hypermutation was observed, and the same was true for CD20+CD38 B cells (Figure 7B). The
frequency of amino acid changes of CD20+CD38 B
cells and CD20 CD38+ cells in experiment 1 is
shown in Figure 7B. This frequency was above the background PCR error.
Table 4 shows the frequency of nucleotide
changes and number of nucleotide changes inducing amino acid
replacement and silent mutations. No statistical significance was
obtained in the frequency of nucleotide changes in the Ig V region
between resting CB B cells and
CD20+CD38 /CD20 CD38+
cells after the stimulation (Table 4). Similar results were obtained by
using adult CD27 B cells (data not shown). These findings
suggest that the antibodies produced from naive B cells in our system
may be low-affinity antibodies.
The characteristics of naive B cells have remained obscure. Our study demonstrates that naive B cells, which do not express CD27 and carry the unmutated sequences of the Ig V-region gene, can induce CSR, AID, and all Ig isotypes but IgA. The naive B cells, like CD27+ memory B cells, were found to proliferate and differentiate into plasma cells without noticeable somatic hypermutation, suggesting the produced antibodies are low affinity. The production of IgG and IgM but not IgA from naive B cells could be induced in our experiment by the stimulation of Ig receptors by SAC and CD40 signaling in conjunction with such cytokines as IL-2 and IL-10. Several investigators15,26 have reported that IgD+ B cells used as naive B cells produced Igs, even though the population contains CD27+ B cells. Their results indicate that tonsillar surface IgD+ B cells produce IgG1, IgG2, and IgM in the presence of SAC + IL-10 + CD40/CD32T27 and possess the unique tendency to generate IgM in response to simultaneous cross-linking of surface Igs and CD40.15 Both IL-4 and CD40 signalings are necessary for IgE
synthesis.27-29 We previously reported13 that
CD27 TGF- B-cell Ig synthesis is preceded by transcription of the germline mRNA,
and mature mRNA was expressed after CSR. CSR replaces the Ig heavy
chain constant region genes to be expressed from Cµ to other
CH genes. CSR take places between 2 broad areas surrounding S
regions, resulting in looped-out deletion of an intervening DNA
segment.16 Because naive B cells in our study produced
IgG, IgM, and IgE, we further investigated the inducibility of CSR by
naive B cells after stimulation. The findings that naive B cells
expressed germline and mature AID Because somatic hypermutation may occur in GCs, in which B cells
are activated and proliferating, and CD40 or BCR signaling significantly promotes the B-cell proliferation, the CD40-CD154 or
BCR-antigen interaction still remains as a candidate for the inducer of
somatic hypermutation. In addition, cross-linking of CD40 by anti-CD40
mAb + CD32T with or without IL-4 greatly enhanced the B-cell
proliferation and IgE production as compared with anti-CD40 mAb alone.
To clarify effects of the CD40-CD154 interaction and BCR engagement on
the induction of somatic mutation, we used CB B cells and adult PB
CD27 During clinically relevant infections, neutralizing antibodies are soon generated, and such antibodies are devoid of somatic hypermutation in their Ig V-region genes.36 The analysis of genealogically related antigen-specific antibodies indicates that their binding avidities can be enhanced by as much as a factor of 30 through somatic mutation.37 The question thus arises whether the antibodies produced by naive B cells in our in vitro system have high binding avidities. We therefore analyzed somatic hypermutation in Ig V-region genes obtained from plasma cells generated from naive B cells with SAC + IL-10 + IL-2 + CD40/CD32T stimulation. The sequencing analysis of the Ig V-region genes disclosed that plasma cells generated from naive B cells in our system were mostly composed of unmutated compartments, which suggests that they produce low-affinity antibodies (Table 4). We also studied somatic hypermutation of induced plasma cells after 14 days of stimulation in culture. In this experiment, the frequency of mutations of plasma cells induced from activated CB B cells was not different between 8-day culture and 14-day culture (data not shown). Several reports demonstrated that somatic hypermutation of B cells and some B-lymphoma cells are inducible in vitro with T-cell help and upon the BCR engagement.38-40 A hypothetical scheme of CSR, somatic hypermutation, and plasma
cell generation from naive B cells is shown (Figure
8). Naive B cells undergo CSR and somatic
hypermutation in GCs in vivo. However, independent regulation of class
switching and somatic hypermutation has been shown in various systems,
by using such things as a Burkitt lymphoma cell line,41
human GC B cells,42 or mouse in vitro
system.36,43 In our present study, we highlighted the
ability to induce class switching and somatic hypermutation by using
human IgD+CD27
The authors thank Drs S. Nonoyama, T. Kobata, S. Ito, and C. Morimoto for their support.
Submitted April 30, 2001; accepted August 10, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Kazunaga Agematsu, Shinshu University, Graduate School of Medicine, Dept of Infectious Immunology and Pediatrics, Asahi 3-1-1, Matsumoto 390-8621, Japan; e-mail: agemats{at}gipac.shinshu-u.ac.jp.
1. Kelsoe G. The germinal center reaction. Immunol Today. 1995;16:324-326[CrossRef][Medline] [Order article via Infotrieve].
2.
Liu Y-J.
Reuse of B lymphocytes in germinal centers.
Science.
1997;278:238-239 3. Camerini D, Walz G, Loenen WAM, Borst J, Seed B. The T cell activation antigen CD27 is a member of the nerve growth factor/tumor necrosis factor receptor gene family. J Immunol. 1991;147:3165-3169[Abstract].
4.
Kobata T, Jacquot S, Kozlowski S, Agematsu K, Schlossman SF, Morimoto C.
CD27 5. Agematsu K, Nagumo H, Yang FC, et al. B cell subpopulations separated by CD27 and crucial collaboration of CD27+ B cell and helper T cell in the immunoglobulin production. Eur J Immunol. 1997;27:2073-2079[Medline] [Order article via Infotrieve]. 6. Agematsu K, Hokibara S, Nagumo H, Komiyama A. CD27: a memory B-cell marker. Immunol Today. 2000;21:204-206[CrossRef][Medline] [Order article via Infotrieve].
7.
Tangye SG, Liu Y-J, Aversa G, Phillips JH, de Vries JE.
Identification of functional human splenic memory B cells by expression of CD148 and CD27.
J Exp Med.
1998;188:1691-1703
8.
Klein U, Rajewsky K, Kuppers R.
Human immunoglobulin (Ig)M+IgD+ peripheral blood B cells expressing the CD27 cell surface antigen carry somatically mutated variable region genes: CD27 as a general marker for somatically mutated (memory) B cells.
J Exp Med.
1998;188:1679-1689
9.
Agematsu K, Nagumo H, Shinozaki K, et al.
Absence of IgD
10.
Weller S, Faili A, Garcia C, et al.
CD40-CD40L independent Ig gene hypermutation suggests a second B cell diversification pathway in humans.
Proc Natl Acad Sci U S A.
2001;98:1166-1170
11.
Agematsu K, Nagumo H, Oguchi Y, et al.
Generation of plasma cells from peripheral blood memory B cells: synergistic effect of IL-10 and CD27/CD70 interaction.
Blood.
1998;91:173-180 12. Jacquot S, Kobata T, Iwata S, Morimoto C, Schlossman SF. CD154/CD40 and CD70/CD27 interactions have different and sequential functions in T cell-dependent B cell responses: enhancement of plasma cell differentiation by CD27 signaling. J Immunol. 1997;159:2652-2657[Abstract].
13.
Nagumo H, Agematsu K, Shinozaki K, et al.
CD27/CD70 interaction augments IgE secretion by promoting the differentiation of memory B cells into plasma cells.
J Immunol.
1998;161:6496-6502 14. Maurer D, Fischer GF, Fae I, et al. IgM and IgG but not cytokine secretion is restricted to the CD27+ B lymphocyte subset. J Immunol. 1992;148:3700-3705[Abstract].
15.
Defrance T, Vanbervliet B, Brière F, Durand I, Rousset F, Banchereau J.
Interleukin 10 and transforming growth factor 16. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102:553-563[CrossRef][Medline] [Order article via Infotrieve]. 17. Sugita K, Hirose T, Rothstein DM, Donahue C, Schlossman SF, Morimoto C. CD27, a member of the nerve growth factor receptor family, is preferentially expressed on CD45RA+ CD4 T cell clones and involved in distinct immunoregulatory functions. J Immunol. 1992;149:3208-3216[Abstract]. 18. Morimoto C, Letvin NL, Distaso JA, Aldrich WR, Schlossman SF. The isolation of characterization of the human suppressor inducer T cell subset. J Immunol. 1985;134:1508-1515[Abstract]. 19. Peltz GA, Trounstine ML, Moore KW. Cloned and expressed human Fc receptor for IgG mediates anti-CD3 dependent lymphoproliferation. J Immunol. 1988;141:1891-1896[Abstract].
20.
Karasuyama H, Kudo A, Melchers F.
The proteins encoded by the VpreB and 21. Streuli M, Morimoto C, Schrieber M, Schlossman SF, Saito H. Characterization of CD45 and CD45R monoclonal antibodies using transfected mouse cell lines that express individual human leukocyte common antigen. J Immunol. 1988;141:3910-3914[Abstract]. 22. Nagumo H, Agematsu K. Synergistic augmentative effect on IL-10 and CD27/CD70 interactions on B cell immunoglobulin synthesis. Immunology. 1998;94:388-394[CrossRef][Medline] [Order article via Infotrieve].
23.
Coffman RL, Lebman DA, Shrader B.
Transforming growth factor
24.
Sonoda E, Matsumoto R, Hitoshi Y, et al.
Transforming growth factor
25.
Rousset F, Garcia E, Defrance T, et al.
Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes.
Proc Natl Acad Sci U S A.
1992;89:1890-1893
26.
Brière F, Servet-Delprat C, Bridon J, Saint-Remy J, Banchereau J.
Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3.
J Exp Med.
1994;179:757-762
27.
Gauchat JF, Lebman DA, Coffman RL, Gascan H, de Vries JE.
Structure and expression of germline epsilon transcripts in human B cells induced by interleukin 4 to switch to IgE production.
J Exp Med.
1990;172:463-473
28.
Jabara HH, Fu SM, Geha RS, Vercelli D.
CD40 and IgE: synergism between anti-CD40 monoclonal antibody and interleukin 4 in the induction of IgE synthesis by highly purified human B cells.
J Exp Med.
1990;172:1861-1864 29. Gascan H, Gauchat JF, Aversa G, Van Vlasselaer P, de Vries JE. Anti-CD40 monoclonal antibodies or CD4+ T cell clones and IL-4 induce IgG4 and IgE switching in purified human B cells via different signaling pathways. J Immunol. 1991;147:8-13[Abstract]. 30. Saiki O, Tanaka T, Wada Y, et al. Signaling through CD40 rescues IgE but not IgG and IgA secretion in X-linked immunodeficiency with hyper-IgM. J Clin Invest. 1995;95:510-514.
31.
Kehrl JH, Roberts AB, Wakefield LM, Associan RK.
Transforming growth factor
32.
Lee G, Ellingsworth LR, Gillis S, Wall R, Kincade P.
Transforming growth factors are potential regulators B lymphopoiesis.
J Exp Med.
1987;166:1290-1299
33.
Van Vlasselaer P, Punnonen J, de Vries JE.
Transforming growth factor-
34.
Fayette J, Dubois B, Vandenabeele S, et al.
Human dendritic cells skew isotype switching of CD40-activated naive B cells towards IgA1 and IgA2.
J Exp Med.
1997;185:1909-1918 35. Fischer M, Klein U, Kuppers R. Molecular single-cell analysis reveals that CD5-positive peripheral blood B cells in healthy humans are characterized by rearranged Vk genes lacking somatic mutation. J Clin Invest. 1997;100:1667-1676[Medline] [Order article via Infotrieve].
36.
Jacob J, Kelsoe G.
In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl) acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers.
J Exp Med.
1992;176:679-687
37.
Clarke S, Ricket R, Wloch MK, Staudt L, Gerhard WU, Weigert MG.
The BALB/c secondary response to the S
38.
Denepoux S, Fournier N, Peronne C, Banchereau J, Lebecque S.
T cells can induce somatic hypermutation in B cell receptor-engaged BL2 Burkitt's lymphoma cells independently of CD40-CD40 ligand interactions.
J Immunol.
2000;164:1306-1313 39. Kallberg E, Jainandunsing S, Gray D, Leanderson T. Somatic mutation of immunoglobulin V genes in vitro. Science. 1996;271:1285-1289[Abstract]. 40. Razanajaona D, Denepoux S, Blanchard D, et al. In vitro triggering of somatic mutation in human naive B cells. J Immunol. 1997;159:3347-3353[Abstract].
41.
Zan H, Cerutti A, Dramitinos P, Schaffer A, Li Z, Casali P.
Induction of Ig somatic hypermutation and class switching in a human monoclonal IgM+IgD+ B cell line in vitro: definition of the requirements and modalities of hypermutation.
J Immunol.
1999;162:3437-3447 42. Liu Y-J, Malisan F, de Bouteiller O, et al. Within germinal centers, isotype switching of immunoglobulin genes occurs after the onset of somatic mutation. Immunity. 1996;4:241-250[CrossRef][Medline] [Order article via Infotrieve].
43.
Sohn J, Gerstein RM, Hsieh C-L, Lemer M, Selsing E.
Somatic hypermutation of an immunoglobulin µ heavy chain transgene.
J Exp Med.
1993;177:493-504
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
M. M. Sira, T. Yoshida, M. Takeuchi, Y. Kashiwayama, T. Futatani, H. Kanegane, A. Sasahara, Y. Ito, M. Mizuguchi, T. Imanaka, et al. A novel immunoregulatory protein in human colostrum, syntenin-1, for promoting the development of IgA-producing cells from cord blood B cells Int. Immunol., September 1, 2009; 21(9): 1013 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Avery, V. L. Bryant, C. S. Ma, R. de Waal Malefyt, and S. G. Tangye IL-21-Induced Isotype Switching to IgG and IgA by Human Naive B Cells Is Differentially Regulated by IL-4 J. Immunol., August 1, 2008; 181(3): 1767 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zemlin, G. Hoersch, C. Zemlin, A. Pohl-Schickinger, M. Hummel, C. Berek, R. F. Maier, and K. Bauer The Postnatal Maturation of the Immunoglobulin Heavy Chain IgG Repertoire in Human Preterm Neonates Is Slower than in Term Neonates J. Immunol., January 15, 2007; 178(2): 1180 - 1188. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Fecteau, G. Cote, and S. Neron A New Memory CD27-IgG+ B Cell Population in Peripheral Blood Expressing VH Genes with Low Frequency of Somatic Mutation J. Immunol., September 15, 2006; 177(6): 3728 - 3736. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ettinger, G. P. Sims, A.-M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky IL-21 Induces Differentiation of Human Naive and Memory B Cells into Antibody-Secreting Plasma Cells J. Immunol., December 15, 2005; 175(12): 7867 - 7879. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Parez, A. Garbarg-Chenon, C. Fourgeux, F. Le Deist, A. Servant-Delmas, A. Charpilienne, J. Cohen, and I. Schwartz-Cornil The VP6 Protein of Rotavirus Interacts with a Large Fraction of Human Naive B Cells via Surface Immunoglobulins J. Virol., November 15, 2004; 78(22): 12489 - 12496. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pene, J.-F. Gauchat, S. Lecart, E. Drouet, P. Guglielmi, V. Boulay, A. Delwail, D. Foster, J.-C. Lecron, and H. Yssel Cutting Edge: IL-21 Is a Switch Factor for the Production of IgG1 and IgG3 by Human B Cells J. Immunol., May 1, 2004; 172(9): 5154 - 5157. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Babbage, R. Garand, N. Robillard, N. Zojer, F. K. Stevenson, and S. S. Sahota Mantle cell lymphoma with t(11;14) and unmutated or mutated VH genes expresses AID and undergoes isotype switch events Blood, April 1, 2004; 103(7): 2795 - 2798. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Fecteau and S. Neron CD40 Stimulation of Human Peripheral B Lymphocytes: Distinct Response from Naive and Memory Cells J. Immunol., November 1, 2003; 171(9): 4621 - 4629. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Marafioti, M. Jones, F. Facchetti, T. C. Diss, M.-Q. Du, P. G. Isaacson, M. Pozzobon, S. A. Pileri, A. J. Strickson, S.-Y. Tan, et al. Phenotype and genotype of interfollicular large B cells, a subpopulation of lymphocytes often with dendritic morphology Blood, October 15, 2003; 102(8): 2868 - 2876. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Feldhahn, I. Schwering, S. Lee, M. Wartenberg, F. Klein, H. Wang, G. Zhou, S. M. Wang, J. D. Rowley, J. Hescheler, et al. Silencing of B Cell Receptor Signals in Human Naive B Cells J. Exp. Med., November 18, 2002; 196(10): 1291 - 1305. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. G. Tangye, A. Ferguson, D. T. Avery, C. S. Ma, and P. D. Hodgkin Isotype Switching by Human B Cells Is Division-Associated and Regulated by Cytokines J. Immunol., October 15, 2002; 169(8): 4298 - 4306. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||