|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Departments of Medicine, Biochemistry, and
Pediatrics, Duke University Medical Center, Durham, NC; and Department
of Pediatrics, Section of Allergy and Immunology, King Faisal
Specialist Hospital and Research Center, Riyadh, Saudi Arabia.
Four patients from 3 Saudi Arabian families had delayed onset of
immune deficiency due to homozygosity for a novel intronic mutation,
g.31701T>A, in the last splice acceptor site of the adenosine
deaminase (ADA) gene. Aberrant splicing mutated the last 4 ADA amino acids and added a 43-residue "tail" that rendered the
protein unstable. Mutant complementary DNA (cDNA) expressed in
Escherichia coli yielded 1% of the ADA activity obtained
with wild-type cDNA. The oldest patient, 16 years old at diagnosis, had
greater residual immune function and less elevated erythrocyte deoxyadenosine nucleotides than his 4-year-old affected sister. His T
cells and Epstein-Barr virus (EBV) B cell line had 75% of normal ADA
activity and ADA protein of normal size. DNA from these cells and his
whole blood possessed 2 mutant ADA alleles. Both carried g.31701T>A,
but one had acquired a deletion of the 11 adjacent base pair,
g.31702-12, which suppressed aberrant splicing and excised an unusual
purine-rich tract from the wild-type intron 11/exon 12 junction. During
ADA replacement therapy, ADA activity in T cells and abundance of the
"second-site" revertant allele decreased markedly. This finding
raises an important issue relevant to stem cell gene therapy.
(Blood. 2002;99:1005-1013) Deficiency of adenosine (Ado) deaminase (ADA), a
41-kd monomeric zinc enzyme that catabolizes Ado and deoxyadenosine
(dAdo), accounts for about 15% of cases of severe combined
immunodeficiency (SCID).1,2 Typical patients are diagnosed
by age 6 months and rarely survive beyond 1 to 2 years unless immune
function is restored by stem cell transplantation or enzyme replacement therapy. About 20% of patients have some residual immune function and
present later in childhood or beyond ("delayed" or "late/adult" onset), and some healthy children and adults with "partial" ADA deficiency have been identified by screening. Fibroblasts or
lymphoblastoid cell lines (LCLs) from "partials" have 5% to 70%
of normal ADA activity versus less than 1% to 2% in cell lines from
immunodeficient patients. The level of total dAdo nucleotides (dAXP) in
erythrocytes is elevated by 300- to 2000-fold in SCID, 30- to 300-fold
in delayed/late onset, and 0- to 30-fold in "partial"
deficiency.2,3
About 70 known mutations, the majority missense, span the 32-kb, 12 exon ADA gene on chromosome 20q.2,3 The
association of certain mutations with milder phenotypes, and the
correlation with dAXP level, suggested that alleles providing more than
some critical level of functional ADA can ameliorate
phenotype.4,5 When expressed in Escherichia
coli, 28 ADA complementary DNAs (cDNAs) with missense mutations
from immunodeficient patients yielded less than 0.005% to 0.6% of the
ADA activity obtained with wild-type cDNA versus 1% to 28% for
5 mutations from healthy "partials."6,7 Of 31 patients
with SCID, 28 had genotypes composed of alleles that expressed 0.05%
or less of wild-type activity, compared with only 2 of 21 patients with
milder phenotypes.6 ADA splicing mutations have been
associated with relatively mild or variable severity, because normal
splicing is not always disrupted completely.5,8
Because of selection, any mechanism that increases ADA expression in
lymphoid cells can potentially moderate phenotype. This is exemplified
by the reversion of an inherited ADA missense mutation in B LCLs from a
patient who had undergone a spontaneous clinical remission.9 A similar phenomenon involving the cytokine
receptor common We have discovered somatic reversion by a unique "second-site
suppression" mechanism in a progenitor of T and B lymphocytes in
1 of 4 ADA-deficient patients homozygous for a novel splicing mutation.
Our findings highlight the unusual purine-rich character of the
terminal splice acceptor site of the ADA gene, and
uncertainty about the structure and function of the C-terminus of the
ADA protein. Other observations provide insight into an issue of
importance to gene therapy, the influence of ADA replacement therapy on
selection for rare ADA-expressing T lymphocytes.
Lymphoid cells and LCLs
ADA activity and adenine nucleotide content of erythrocytes and
dried blood spots
Analysis of ADA gene mutations These studies were approved by the Duke University Institutional Review Board. ADA cDNA and genomic sequences are as reported,25,26 and preceded by "c." and "g.," respectively. ADA messenger RNA (mRNA; cDNA) numbering is relative to the start of transcription (ie, the ATG start codon begins at c.96). Standard methods were used to prepare, amplify, and clone genomic DNA and cDNA,27,28 using conditions recommended by the suppliers of reagents used in these procedures. Polymerase chain reaction (PCR) products cloned in pCR2.1 (Invitrogen, Carlsbad, CA) were sequenced using the ABI 377 PRISM Instrument. Direct sequencing of PCR products was performed by ddNTP chain termination with Sequenase T7 polymerase (Amersham Pharmacia Biotech, Piscataway, NJ). DdeI restriction enzyme was obtained from New England Biolabs (Beverly, MA). For Northern analysis, 50 µg total cellular RNA prepared using the Tri-Reagent Method (Molecular Research Center, Cincinnati, OH) was electrophoresed, blotted, hybridized, and probed as described.20The ADA cDNA was prepared from cellular RNA using the reverse
transcription (RT)-PCR kit (Amersham Pharmacia Biotech or Qiagen, Valencia, CA). The ADA coding region (c.96-1189) and
"full-length" ADA cDNA (c.35-1498) were amplified as
described.5 The cDNA segment c.904 to 1359 (exon 9-exon
12) was amplified with the primers (+)5'ACACGGAGCATGCAGTCAT and
( Detection of genomic DNA clones carrying the MutA and MutA  11)
(see "Results").
Detection of a 13-nt insertion at the exon 11/exon 12 junction in uncloned and cloned ADA cDNA Uncloned "full-length" ADA cDNA was subjected to nested PCR (primers: (+)5'TCCCAGAAGATGAAAAGAG, ( )5'ATTGAGATCATGGTCTTCTTGG) to
obtain the fragment c.1099-1290 (exon 11-exon 12). The size of PCR
products was analyzed on a 3% agarose/TAE gel. Full-length cDNA was also cloned into pCR2.1 and the segment c.1099-1402 (exon 11-exon 12) was then amplified from random boiled colonies (primers: (+)5'TCCCAGAAGATGAAAAGAG, ()5'ACATAATCAGAGAAGTG). The PCR products were separated on 2.2% agarose gels. In these experiments, standards were run on each gel, consisting of PCR products obtained with authentic wild-type or mutant cDNA clones. Random PCR products were
also sequenced.
Expression in E coli SØ3834 The coding regions of wild-type human ADA cDNA, and of the MutA cDNA (see "Results") were ligated into the NcoI site of pZ.29 pZ/ADA plasmids were used to transform E coli SØ3834, which has a deletion of the bacterial ADA gene.29 The conditions used for constitutive expression and assay of ADA activity are as reported.6,22 Aliquots of lysates containing 30 µg total protein were analyzed by Western blotting with the 1C5 mAb to human ADA.22Three cDNAs encoding other mutations at the C-terminus of human ADA
were also expressed: G360X, with a stop signal at codon 360 to
eliminate the last 4 amino acids; 360-363EPTS, changing the last 4 amino acids from GQNL to EPTS; and 360-363EPTS+20, changing residues
360-363 to EPTS and adding codons 364-383 of the MutA cDNA, encoding
RAEPLKTPLLQAFTLWSHPN (single-letter amino acid codes). PCR mutagenesis
was performed essentially as described.6,30 The forward
primer for all 3 mutations was
(+)5'CGCGCGAATTCGGGCACCATGGCCCAGACGCCCGCCTTCGAC. Reverse
primers were: for G360X,
( In vitro transcription-translation [35S]Methionine-labeled ADA was generated in vitro from ADA cDNA constructs in pBluescript, using the TNT Coupled Rabbit Reticulocyte Lysate System (Promega, Madison, WI). Translation products were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and fluorography, and were also electrophoresed on cellulose acetate and stained for ADA activity in situ, as described.20
Case presentations Family 1.
The 4-year-old proband, Sib A was the fifth child of second cousins
from Saudi Arabia. Prior to age 3 years she had frequent bronchitis and
one episode of pneumonia, but neither thrush nor chronic diarrhea. In
her fourth year she had bacterial meningitis without sequelae and was
hospitalized for extensive, but uncomplicated varicella. Her height and
weight were in the 75th and 50th percentiles, respectively, for age.
She had no tonsils or palpable lymph nodes; lungs were clear.
Lymphopenia and other abnormalities suggesting combined
immunodeficiency (Table 1) prompted
testing for ADA deficiency (Table 2).
Patients Y (family 2) and R (family 3). Soon after the diagnosis of patients in family 1, 2 other children with suggestive histories, each born to parents who were second-degree relatives and distantly related to family 1, were evaluated and found to be ADA deficient (Tables 1 and 2). Patient Y (family 2), aged 5.5 years, had been hospitalized several times for respiratory infections and thrombocytopenia. Growth parameters were less than third percentile and she had severe restrictive lung disease. Patient R (family 3) had repeated respiratory infections and diarrhea, but was first hospitalized at age 1 year, shortly before diagnosis of ADA deficiency, for myoclonic seizures attributed to viral encephalitis. A brother with a history of chest infections from 1 year of age, who had been diagnosed with common variable immunodeficiency, and a sister with a history of chest infections and diarrhea from age 4 months, had both died at age 7 years. Patients Y and R were lymphopenic, but had normal or low normal serum immunoglobulins; patient R had elevated IgE (Table 1). Whole blood dAXP levels were elevated, but substantially lower than in SCID (Table 2). Both patients have received marrow transplants from HLA-identical siblings, performed at King Faisal Specialist Hospital, after conditioning with busulphan and cyclophosphamide. Despite good engraftment, patient Y continues to have respiratory symptoms related to chronic lung disease, and patient R continues to have seizures.ADA activity in lymphocytes of Sib A and Sib B Erythrocytes and whole blood of both patients in family 1 showed a similar degree of ADA deficiency, but dAXP levels were substantially lower in Sib B (Table 2). This suggested that greater residual ADA activity in a nonerythroid lineage of Sib B might be limiting the dAdo available for forming red blood cell dAXP. This proved to be the case (Table 3). ADA activity was less than 1% to 5% of normal in cultured T cells, T LCL, and B LCL from Sib A. By contrast, ADA activity was about 75% of normal in pretreatment T cells from Sib B, and also in a B LCL established after he had received PEG-ADA for 7 months. However, PBLs, T cells, and a T LCL derived from Sib B after 7 months of therapy had substantially less ADA activity, 19%, 8.5%, and 4% of normal, respectively.
Genotype analysis We initially found that 6 ADA cDNA clones prepared from a B LCL derived from Sib A had a 13-nt insertion at the junction of exons 11 and 12 (Figure 1A). The insert corresponds to g.31703-31715, the last 13 base pair (bp) of IVS 11. This finding led to the discovery of a novel mutation of the last splice acceptor site of the ADA gene, a T>A transversion at g.31701, located in IVS 11, 15 bp upstream of the start of exon 12 (Figure 1B). Presumably by changing a TG dinucleotide to AG, this mutation activates splicing at g.31703 instead of the normal g.31716.
Only the mutant A was found at g.31701 on direct sequencing of the fragment g.31016-31920 (spanning IVS 10-exon 12) amplified from DNA isolated from buccal brushings of Sib A and Sib B in family 1, as well as from buccal DNA of the distantly related patients Y and R (Figure 1B). Consistent with homozygosity, buccal DNA of all 4 patients also showed complete digestion at a new DdeI restriction site in IVS 11 created by the g.31701T>A mutation (not shown). Patients Y and R were not studied further because they had received marrow transplants shortly after diagnosis. Complex genotype of Sib B of family 1 Direct sequencing (Figure 2A) and DdeI digestion (Figure 2B) of the IVS 10-exon 12 fragment amplified from whole blood DNA of Sib A also indicated homozygosity for g.31701T>A. Each parent was heterozygous (maternal sequence, Figure 2A; DdeI digest for both parents, Figure 2B). Unlike results with Sib A, direct sequencing of the g.31016-31920 fragment from blood DNA of Sib B gave a "double ladder" in the vicinity of the IVS 11-exon 12 boundary (Figure 2A), and his DdeI digest indicated heterozygosity for g.31701T>A (Figure 2B, lane 3). To resolve the ambiguous results with Sib B, we amplified and cloned the g.31016-31920 fragment from DNA of his PBLs. Of 6 clones sequenced, 3 showed only the g.31701T>A mutation; the other 3 had "A" at g.31701, but each also had a deletion of 11 nt immediately downstream, that is, g.31702-31712 (Figure 3). For clarity, g.31701T>A is hereafter designated "MutA," and the compound mutation g.31701T>A; g.31702-31712del11 is designated "MutA11."
The presence of both MutA and MutA Northern analysis revealed no obvious differences from normal controls
in the amount or size of ADA mRNA from T or B LCLs from Sib A and Sib B
(data not shown). To better evaluate the region of interest, we
amplified the exon 11/12 junction from uncloned cDNA prepared from
their lymphoid cells (Figure 4A). Post-PEG-ADA treatment B LCLs and pre-PEG-ADA T cells from Sib B gave
2 products, a major band of the size obtained with cloned authentic
MutA cDNA as template and a minor band of the size obtained with cloned
wild-type ADA cDNA as template (Figure 4A, lanes 2 and 4). The T LCLs
derived from Sib B after PEG-ADA treatment, which had low ADA activity,
and T cells and T and B LCLs of Sib A, showed only the larger MutA
product (Figure 4A, lanes 3 and 5-7).
In the experiment with uncloned cDNA (Figure 4A), the smaller,
wild-type PCR product is underestimated because a heteroduplex forms
that migrates with the larger MutA product (these were resolved on a
4% agarose gel, not shown). Therefore, we analyzed cloned genomic DNA
and cDNA PCR products to better estimate the relative abundance of the
MutA and MutA
Recombinant MutA cDNA expression Exon 12 of human ADA includes 2 bp of codon 360, codons 361-363, the TGA stop codon, and the 3' untranslated region (UTR). The MutA-induced 13-nt insertion is predicted to change residues 360-363 from GQNL to EPTS, and to extend the reading frame by 43 additional codons, to give a 406-residue protein of 45 540 Da (dalton) instead of the normal 40 724 Da (Figures 1A and 5). Only ADA protein of normal size was detected by Western analysis in extracts of the pretreatment T cells and posttreatment B LCL from Sib B, whereas no ADA of either size was detected in his posttreatment T cells or in T cells and B LCL from Sib A (Figure 4B).
When expressed in vitro in rabbit reticulocytes, MutA cDNA gave rise to a 35S-protein of the predicted size (Figure 4C). After nondenaturing electrophoresis of equal amounts of translation product on cellulose acetate, ADA activity was detected by in situ assay of the wild-type, but not the MutA protein (Figure 4D). Although this assay is relatively insensitive, the MutA in vitro translation product, though stable, is clearly much less active than the wild-type. We also expressed the MutA cDNA, and some related constructs, in
E coli SØ3834. This strain lacks the bacterial
ADA gene, permitting quantitation of as little as 0.005% of
the ADA activity obtained with wild-type human ADA cDNA. When expressed
under defined conditions, and normalized to total extract protein,
MutA-transformed cells had 1% of the ADA activity obtained with
wild-type cDNA (Table 5). Immunoreactive
MutA protein (Figure 4E, lane 2) was estimated by Western blot to be
about 3% of wild- type human ADA protein, based on comparison with
serial dilutions of the wild-type extract, and by blotting with a
polyclonal antiserum to human ADA as well as with the 1C5 mAb (data
not shown).
Wild-type levels of ADA activity (Table 5) and ADA protein (Figure 4E) were expressed with human ADA cDNA modified so as to delete the last 4 amino acids, or to change them from GQNL to EPTS, as in the MutA protein. A MutA cDNA truncated to encode only the first 24 of the 43 MutA-determined residues, yielded 5% of wild-type activity and 10% to 15% of the amount of ADA protein. These results show that the MutA-induced C-terminal extension, rather than mutation of residues 360-363, is responsible for instability and loss of catalytic activity. In other studies not presented we found that recombinant MutA ADA had a
Km for Ado of 70 µM, compared with 40 µM for
wild-type ADA, and it showed neither greater thermolability than the
wild-type enzyme, nor evidence of aggregation by size exclusion
chromatography. The MutA protein formed a stable complex with the
CD26/dipeptidyl peptidase IV glycoprotein, indicating that the CD26
binding site at the carboxy-end of the peripheral
We report data on 4 ADA-deficient patients from 3 families within a large kindred, each with a delayed onset of combined immunodeficiency. These are the first patients from Saudi Arabia in whom ADA genotype has been examined, and possibly the first in whom ADA deficiency has been demonstrated. Buccal DNA of all 4 patients, and DNA from blood, T cells, and T and B LCLs of Sib A, the proband in family 1, showed homozygosity for a novel mutation, g.31701T>A (MutA), the most distal ADA mutation identified to date. By converting a TG to AG, MutA activates a cryptic splice site, inserting the last 13 nt of IVS 11 into ADA mRNA. This changes and extends the reading frame to mutate the last 4 amino acids of the ADA protein and add a 43-residue C-terminal tail (Figure 5A). No normally spliced ADA mRNA was detected in lymphoid cells of Sib A, and although a low level of ADA activity was measurable, neither the mutant protein nor ADA of normal size could be detected immunologically. Expression of MutA cDNA in vitro and in E coli showed that
instability and loss of catalytic activity are due to the C-terminal tail, not to mutation of amino acids 360-363, which were dispensable. This is not surprising because murine ADA, which is 83% identical in
overall sequence, lacks the last 11 residues found in human ADA.31 Moreover, the murine ADA C-terminus (residues
337-351), though conserved, forms a peripheral helix that is not only
remote from the active site, but makes few contacts with more proximal elements of the main Expressing MutA cDNA under standardized conditions in E coli SØ3834 yielded 1% of the activity obtained with wild-type ADA cDNA. In previous studies, this was at the border between ADA activity expressed by mutant alleles from patients with a late/adult-onset phenotype and alleles from healthy subjects with "partial ADA deficiency."6,7 In vivo, the steady-state level of ADA activity due to the MutA protein is insufficient for developing and sustaining normal immune function, but it prevents ADA substrates from rising to a level that causes the profound lymphopenia and lack of T- and B-cell function associated with SCID. Mosaicism for a second-site suppressor of the effects of MutA on splicing The natural history of the delayed-onset phenotype is more variable than for SCID, but progressive deterioration is expected. (4 undiagnosed children in 2 of the families studied, who also had histories compatible with delayed onset ADA deficiency, had died by age 7 years). Despite serious sequelae of early infections, Sib B in family 1 apparently stabilized at some time during childhood; he is one of only a few ADA-deficient patients to have survived, undiagnosed and without specific therapy, beyond the first decade.5,30,33 At 16 years, his lymphocyte function was abnormal, but better preserved than in the other 3 patients when they were diagnosed at ages 1.3 to 5.5 years. dAXP in his erythrocytes were also less elevated, and among the lowest reported, other than in healthy subjects with "partial" ADA deficiency. These atypical features in Sib B are likely related to the greater ADA activity expressed by his lymphoid cells, owing to an unusual, previously unreported, form of somatic reversion: second-site suppression of a cryptic splice site. Reversion was evident in T cells and a B LCL, and must therefore have occurred in a common progenitor of both T and B lymphocytes. In previous reports of somatic reversion in ADA deficiency, only the T or B lineage has been involved.9,34DNA from blood, T cells, and T and B LCLs of Sib B showed, to varying
degrees, evidence of 2 different MutA alleles, one intact and one
modified. The latter (MutA Figure 5B compares the IVS 11/exon12 junctions used in processing the
wild-type, MutA, and MutA We have previously described a rearrangement of the IVS 8/exon 9 junction in which 6 consecutive purines were interposed between nt Relationship of enzyme replacement therapy and relative
abundance of MutA 11 allele and its transcript, than did T cells and a T LCL obtained after
several months of treatment with PEG-ADA. By normalizing systemic
levels of ADA substrates, PEG-ADA therapy permits ADA-deficient lymphoid cells to survive, proliferate, and function.2,43 Given the improvement in his lymphocyte function, an expansion of
homozygous MutA T cells can plausibly account for the apparent decline
in heteroallelic MutA/MutA11 T cells. Our findings in Sib B
are similar to those in an SCID patient with unusually low red blood
cell dAXP, in whom a T LCL established at diagnosis had half-normal ADA
activity due to reversion of an inherited point
mutation.34 ADA-expressing T LCLs could not be established from this patient after starting PEG-ADA therapy, leading to
speculation that revertant T cells had been overgrown by nonrevertants.
(A revertant B LCL was derived from Sib B during treatment. This may
reflect stronger in vitro selection for, and expansion of, ADA-expressing cells [that arose in vivo] during the process of EBV
transformation.)
These findings raise a related issue, namely, whether concomitant PEG-ADA therapy may contribute to the limited success of stem cell-targeted gene therapy for ADA deficiency.44-49 In addressing this question, 2 observations are relevant: (1) there is no evidence that PEG-ADA directly suppresses the growth or viability of either ADA-expressing or ADA-deficient T cells, and (2) to date, ex vivo transduction of human lymphohematopoietic stem cells with retroviral ADA vectors has been very inefficient.48,49 We suspect that, as in the case of somatic revertants, when metabolic toxicity is neutralized by PEG-ADA therapy, rescued ADA-deficient T cells become more abundant than transduced T cells simply because they arise from a much larger progenitor pool. Performing stem cell gene therapy without concomitant use of PEG-ADA would minimize competition from untransduced lymphocytes, but this might or might not enhance clinical benefit. It is not known how long selection must operate before rare transduced stem cells can give rise to protective immune function, or how variable the response might be. Recent success with stem cell gene therapy for X-linked SCID is encouraging.50 However, ADA deficiency is a systemic metabolic disorder with a different pathogenesis. Injury to nonlymphoid organs has been reported in ADA-deficient humans and mice.51-55 PEG-ADA, a few milliliters of which has the ADA activity of 1012 normal T cells, acts in plasma to protect organs as well as lymphoid cells from toxic ADA substrates.43,54,56 Whether ADA expression limited to gene-transduced lymphoid cells can be as effective remains to be determined. A sharp rise in erythrocyte dAXP in patients undergoing gene therapy in whom PEG-ADA has been withheld (Kohn et al47 and unpublished observations, February 1999-October 1999), suggests that at the metabolic level, the therapies have to date not been equivalent.
We wish to thank Dr Rebecca Buckley of Duke University Medical Center for information regarding recovery of immune function during treatment with PEG-ADA.
Submitted August 23, 2001; accepted October 3, 2001.
Supported by National Institutes of Health grant RO1 DK20902 (M.S.H.) and a grant from Enzon, Inc. E.R. was supported by Fellowship 98/9329 from Fondo de Investigación Sanitaria, Instituto de Salud Carlos III, Ministerio de Sanidad y Consumo, Spain.
F.X.A-V. and I.S. contributed equally to this work.
M.S.H. is a consultant to Enzon whose product was discussed in the present work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Michael S. Hershfield, Box 3049, Duke University Medical Center, Durham, NC 27710; e-mail: msh{at}biochem.duke.edu.
1. Giblett ER, Anderson JE, Cohen F, Pollara B, Meuwissen HJ. Adenosine deaminase deficiency in two patients with severely impaired cellular immunity. Lancet. 1972;2:1067-1069[Medline] [Order article via Infotrieve]. 2. Hershfield MS, Mitchell BS. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. In: Valle D, ed. The Metabolic and Molecular Bases of Inherited Disease. 8th ed. New York, NY: McGraw-Hill; 2001:2585-2625. 3. Hirschhorn R. Immunodeficiency disease due to deficiency of adenosine deaminase. In: Puck JM, ed. Primary Immunodeficiency Diseases: A Molecular and Genetic Approach. New York, NY: Oxford; 1999:121-139.
4.
Hirschhorn R, Tzall S, Ellenbogen A.
Hot spot mutations in adenosine deaminase deficiency.
Proc Natl Acad Sci U S A.
1990;87:6171-6175 5. Santisteban I, Arredondo-Vega FX, Kelly S, et al. Novel splicing, missense, and deletion mutations in 7 adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease. Contribution of genotype to phenotype. J Clin Invest. 1993;92:2291-2302. 6. Arredondo-Vega FX, Santisteban I, Daniels S, Toutain S, Hershfield MS. Adenosine deaminase deficiency: genotype-phenotype correlations based on expressed activity of 29 mutant alleles. Am J Hum Genet. 1998;63:1049-1059[CrossRef][Medline] [Order article via Infotrieve].
7.
Ariga T, Oda N, Santisteban I, et al.
Molecular basis for paradoxical carriers of adenosine deaminase (ADA) deficiency that show extremely low levels of ADA activity in peripheral blood cells without immunodeficiency.
J Immunol.
2001;166:1698-1702 8. Arredondo-Vega FX, Santisteban I, Kelly S, Schlossman C, Umetsu D, Hershfield MS. Correct splicing despite a G>A mutation at the invariant first nucleotide of a 5' splice site: a possible basis for disparate clinical phenotypes in siblings with adenosine deaminase (ADA) deficiency. Am J Hum Genet. 1994;54:820830. 9. Hirschhorn R, Yang DR, Puck JM, Huie ML, Jiang C-K, Kurlandsky LE. Spontaneous reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency. Nat Genet. 1996;13:290-295[CrossRef][Medline] [Order article via Infotrieve].
10.
Stephan JL, Wahn V, Le Deist F, et al.
Atypical X-linked severe combined immunodeficiency due to possible spontaneous reversion of the genetic defect in T cells.
N Engl J Med.
1996;335:1563-1567 11. Darling TN, Yee C, Bauer JW, Hintner H, Yancey KB. Revertant mosaicism: partial correction of a germ-line mutation in COL17A1 by a frame-restoring mutation. J Clin Invest. 1999;103:1371-1377[Medline] [Order article via Infotrieve]. 12. Ellis NA, Lennon DJ, Proytcheva M, Alhadeff B, Henderson EE, German J. Somatic intragenic recombination within the mutated locus BLM can correct the high sister-chromatid exchange phenotype of Bloom syndrome cells. Am J Hum Genet. 1995;57:1019-1027[Medline] [Order article via Infotrieve].
13.
Gregory JJ Jr, Wagner JE, Verlander PC, et al.
Somatic mosaicism in Fanconi anemia: evidence of genotypic reversion in lymphohematopoietic stem cells.
Proc Natl Acad Sci U S A.
2001;98:2532-2537 14. Jonkman MF, Scheffer H, Stulp R, et al. Revertant mosaicism in epidermolysis bullosa caused by mitotic gene conversion. Cell. 1997;88:543-551[CrossRef][Medline] [Order article via Infotrieve]. 15. Klein CJ, Coovert DD, Bulman DE, Ray PN, Mendell JR, Burghes AH. Somatic reversion/suppression in Duchenne muscular dystrophy (DMD): evidence supporting a frame-restoring mechanism in rare dystrophin-positive fibers. Am J Hum Genet. 1992;50:950-959[Medline] [Order article via Infotrieve]. 16. Kvittingen EA, Rootwelt H, Berger R, Brandtzaeg P. Self-induced correction of the genetic defect in tyrosinemia type I. J Clin Invest. 1994;94:1657-1661.
17.
Wada T, Schurman SH, Otsu M, et al.
Somatic mosaicism in Wiskott-Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism.
Proc Natl Acad Sci U S A.
2001;98:8697-8702 18. Waisfisz Q, Morgan NV, Savino M, et al. Spontaneous functional correction of homozygous Fanconi anaemia alleles reveals novel mechanistic basis for reverse mosaicism. Nat Genet. 1999;22:379-383[CrossRef][Medline] [Order article via Infotrieve].
19.
Ariga T, Kondoh T, Yamaguchi K, et al.
Spontaneous in vivo reversion of an inherited mutation in the Wiskott-Aldrich syndrome.
J Immunol.
2001;166:5245-5249 20. Arredondo-Vega FX, Kurtzberg J, Chaffee S, et al. Paradoxical expression of adenosine deaminase in T cells cultured from a patient with adenosine deaminase deficiency and combined immunodeficiency. J Clin Invest. 1990;86:444-452. 21. Kohn DB, Mitsuya H, Ballow M, et al. Establishment and characterization of adenosine deaminase-deficient human T cell lines. J Immunol. 1989;142:3971-3977[Abstract].
22.
Richard E, Arredondo-Vega FX, Santisteban I, Kelly SJ, Patel DD, Hershfield MS.
The binding site of human adenosine deaminase for CD26/dipeptidyl peptidase IV: the Arg142Gln mutation impairs binding to CD26 but does not cause immune deficiency.
J Exp Med.
2000;192:1223-1235
23.
Hershfield MS, Fetter JE, Small WC, et al.
Effects of mutational loss of adenosine kinase and deoxycytidine kinase on deoxyATP accumulation and deoxyadenosine toxicity in cultured CEM cells.
J Biol Chem.
1982;257:6380-6386
24.
Hershfield MS, Kredich NM, Koller CA, et al.
S-Adenosylhomocysteine catabolism and basis for acquired resistance during treatment of T-cell acute lymphoblastic leukemia with 2'-deoxycoformycin alone and in combination with 9-
25.
Wiginton DA, Adrian GS, Hutton JJ.
Sequence of human adenosine deaminase cDNA including the coding region and a small intron.
Nucl Acids Res.
1984;12:2439-2446 26. Wiginton DA, Kaplan DJ, States JC, et al. Complete sequence and structure of the gene for human adenosine deaminase. Biochemistry. 1986;25:8234-8244[CrossRef][Medline] [Order article via Infotrieve]. 27. Erlich HA. PCR Technology. Principles and Applications for DNA Amplification. New York, NY: Stockton Press; 1989. 28. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. 29. Chang ZY, Nygaard P, Chinault AC, Kellems RE. Deduced amino acid sequence of Escherichia coli adenosine deaminase reveals evolutionarily conserved amino acid residues: implications for catalytic function. Biochemistry. 1991;30:2273-2280[CrossRef][Medline] [Order article via Infotrieve].
30.
Ozsahin H, Arredondo-Vega FX, Santisteban I, et al.
Adenosine deaminase deficiency in adults.
Blood.
1997;89:2849-2855
31.
Yeung C-Y, Ignolia DE, Roth DB, et al.
Identification of functional murine adenosine deaminase cDNA clones by complementation in Escherichia coli.
J Biol Chem.
1985;260:10299-10307
32.
Wilson DK, Rudolph FB, Quiocho FA.
Atomic structure of adenosine deaminase complexed with a transition-state analog: understanding catalysis and immunodeficiency mutations.
Science.
1991;252:1278-1284 33. Shovlin CL, Hughes JMB, Simmonds HA, et al. Adult presentation of adenosine deaminase deficiency. Lancet. 1993;341:1471[CrossRef][Medline] [Order article via Infotrieve].
34.
Ariga T, Oda N, Yamaguchi K, et al.
T cell lines from 2 patients with adenosine deaminase (ADA) deficiency showed the restoration of ADA activity resulted from the reversion of an inherited mutation.
Blood.
2001;97:2896-2899 35. Antonarakis SE, Krawczak M, Cooper DN. The nature and mechanisms of human gene mutation. In: Valle D, ed. The Metabolic and Molecular Bases of Inherited Disease 8th ed. New York, NY: McGraw-Hill; 2001:343-377.
36.
Reed R.
The organization of 3' splice-site sequences in mammalian introns.
Genes Dev.
1989;3:2113-2123
37.
Roscigno RF, Weiner M, Garcia-Blanco MA.
A mutational analysis of the polypyrimidine tract of introns. Effects of sequence differences in pyrimidine tracts on splicing.
J Biol Chem.
1993;268:11222-11229
38.
Shapiro MB, Senapathy P.
RNA splice junction of different classes of eukaryotes: sequence statistics and functional implications in gene expression.
Nucl Acids Res.
1987;15:7155-7174
39.
Bauren G, Belikov S, Wieslander L.
Transcriptional termination in the Balbiani ring 1 gene is closely coupled to 3'-end formation and excision of the 3'-terminal intron.
Genes Dev.
1998;12:2759-2769 40. Dye MJ, Proudfoot NJ. Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II. Mol Cell. 1999;3:371-378[CrossRef][Medline] [Order article via Infotrieve].
41.
Nesic D, Cheng J, Maquat LE.
Sequences within the last intron function in RNA 3'-end formation in cultured cells.
Mol Cell Biol.
1993;13:3359-3369 42. Niwa M, Berget SM. Polyadenylation precedes splicing in vitro. Gene Expr. 1991;1:5-14[Medline] [Order article via Infotrieve]. 43. Hershfield MS, Buckley RH, Greenberg ML, et al. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med. 1987;316:589-596[Abstract].
44.
Bordignon C, Notarangelo L, Nobili N, et al.
Gene therapy in peripheral blood lymphocytes and bone marrow for ADA- immunodeficient patients.
Science.
1995;270:470-475 45. Hoogerbrugge PM, van Beusechem VW, Fischer A, et al. Bone marrow gene transfer in three patients with adenosine deaminase deficiency. Gene Ther. 1996;3:179-183[Medline] [Order article via Infotrieve]. 46. Kohn DB, Weinberg KI, Nolta JA, et al. Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency. Nat Med. 1995;1:1017-1023[CrossRef][Medline] [Order article via Infotrieve]. 47. Kohn DB, Hershfield MS, Carbonaro D, et al. Selective accumulation of T lymphocytes containing a normal ADA gene four years after transplantation of transduced autologous umbilical cord blood CD34+ cells in ADA-deficient SCID neonates. Nat Med. 1998;4:775-780[CrossRef][Medline] [Order article via Infotrieve]. 48. Halene S, Kohn DB. Gene therapy using hematopoietic stem cells: Sisyphus approaches the crest. Hum Gene Ther. 2000;11:1259-1267[CrossRef][Medline] [Order article via Infotrieve]. 49. Parkman R, Weinberg K, Crooks G, Nolta J, Kapoor N, Kohn D. Gene therapy for adenosine deaminase deficiency. Annu Rev Med. 2000;51:33-47[CrossRef][Medline] [Order article via Infotrieve].
50.
Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, et al.
Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease.
Science.
2000;288:669-672 51. Ratech H, Greco MA, Gallo G, Rimoin DL, Kamino H, Hirschhorn R. Pathologic findings in adenosine deaminase-deficient severe combined immunodeficiency. Am J Pathol. 1985;120:157-169[Abstract].
52.
Wakamiya M, Blackburn MR, Jurecic R, et al.
Disruption of the adenosine deaminase gene causes hepatocellular impairment and perinatal lethality in mice.
Proc Natl Acad Sci U S A.
1995;92:3673-3677 53. Migchielsen AA, Breuer ML, van Roon MA, et al. Adenosine deaminase-deficient mice die perinatally and exhibit liver-cell degeneration, atelectasis and small intestinal cell death. Nat Genet. 1995;10:279-287[CrossRef][Medline] [Order article via Infotrieve].
54.
Bollinger ME, Arredondo-Vega FX, Santisteban I, Schwarz K, Hershfield MS, Lederman HM.
Hepatic dysfunction as a complication of adenosine deaminase deficiency.
N Engl J Med.
1996;334:1367-1371 55. Rogers MH, Lwin R, Fairbanks L, Gerritsen B, Gaspar HB. Cognitive and behavioral abnormalities in adenosine deaminase deficient severe combined immunodeficiency. J Pediatr. 2001;139:44-50[CrossRef][Medline] [Order article via Infotrieve].
56.
Blackburn MR, Aldrich M, Volmer JB, et al.
The use of enzyme therapy to regulate the metabolic and phenotypic consequences of adenosine deaminase deficiency in mice: differential impact on pulmonary and immunologic abnormalities.
J Biol Chem.
2000;275:32114-32121 57. Markert ML, Hershfield MS, Wiginton DA, et al. Identification of a deletion in the adenosine deaminase gene in a child with severe combined immunodeficiency. J Immunol. 1987;138:3203-3206[Abstract]. 58. Ohshima Y, Gotoh Y. Signals for the selection of a splice site in pre-mRNA computer analysis of splice junction sequences and like sequences. J Mol Biol. 1987;195:247-259[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  D. A. Carbonaro, X. Jin, D. Cotoi, T. Mi, X.-J. Yu, D. C. Skelton, F. Dorey, R. E. Kellems, M. R. Blackburn, and D. B. Kohn Neonatal bone marrow transplantation of ADA-deficient SCID mice results in immunologic reconstitution despite low levels of engraftment and an absence of selective donor T lymphoid expansion Blood, June 15, 2008; 111(12): 5745 - 5754. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Rieux-Laucat, C. Hivroz, A. Lim, V. Mateo, I. Pellier, F. Selz, A. Fischer, and F. Le Deist Inherited and somatic CD3zeta mutations in a patient with T-cell deficiency. N. Engl. J. Med., May 4, 2006; 354(18): 1913 - 1921. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lainka, M. S. Hershfield, I. Santisteban, P. Bali, A. Seibt, J. Neubert, W. Friedrich, and T. Niehues Polyethylene Glycol-Conjugated Adenosine Deaminase (ADA) Therapy Provides Temporary Immune Reconstitution to a Child with Delayed-Onset ADA Deficiency Clin. Vaccine Immunol., July 1, 2005; 12(7): 861 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Konno, T. Wada, S. H. Schurman, E. K. Garabedian, M. Kirby, S. M. Anderson, and F. Candotti Differential contribution of Wiskott-Aldrich syndrome protein to selective advantage in T- and B-cell lineages Blood, January 15, 2004; 103(2): 676 - 678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Hirschhorn In vivo reversion to normal of inherited mutations in humans J. Med. Genet., October 1, 2003; 40(10): 721 - 728. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
-chain gene in T cells was found in a
patient with X-linked SCID.
2
helix (amino acids 126-143)
barrel structure.