|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
PLENARY PAPER
From the Division of Hospital Dentistry, University of
Washington, and the Human Biology Division, Fred Hutchinson Cancer
Research Center, Seattle, WA.
The disruption of retinoic acid receptor (RAR) activity that
characterizes human acute promyelocytic leukemia (APL) is associated with a block to granulocytic differentiation indicating that RARs are
critical regulators of normal myeloid differentiation. Nevertheless, how RAR activity might be regulated in the presumably homogenous concentration of retinoids in blood and bone marrow and how these receptors might interact with specific hematopoietic cytokines to
regulate normal myeloid differentiation remain unclear. Here, using
several cytokine-dependent in vitro models of myeloid development, it
was observed that specific hematopoietic cytokines that
normally regulate myeloid lineage commitment and differentiation
(interleukin-3 and granulocyte-macrophage colony-stimulating factor)
trigger the enhancement of both ligand-dependent and ligand-independent transcriptional activity of both endogenous and exogenous (transiently transfected) RARs. This cytokine-mediated enhancement of RAR activity is not associated with any observed changes in expression of the RARs
or their respective coactivators/corepressors. These studies define a
previously unknown cytokine-RAR interaction during myelopoiesis and
suggest that RAR activation might be a critical downstream event
following interleukin-3 and granulocyte-macrophage colony-stimulating factor signaling during myeloid differentiation. This observation of
ligand-independent activation of RARs that is mediated by certain cytokines represents a new paradigm with respect to how RAR activity might be modulated during hematopoiesis and also suggests a molecular basis for the differential sensitivity of human acute myelogenous leukemia cells to retinoids.
(Blood. 2002;99:746-753) Retinoic acid (RA), the natural acidic derivative
of vitamin A (retinol), is an important regulator of embryonic
development and also influences the growth and differentiation of a
wide variety of adult cell types. The biologic effects of RA are
generally mediated through specific ligand-activated nuclear
transcription factors, the RA receptors (RARs). These receptors consist
of 2 distinct families, the RARs and RXRs, with both receptors
exhibiting modular structures harboring distinct DNA-binding and
ligand-binding domains. These receptors likely mediate their biologic
effects by binding as RAR-RXR heterodimers to regulatory elements (ie, retinoic acid response elements [RAREs] that are present in the promoters of their specific target genes).1,2
RARs play a critical role in regulating adult hematopoiesis,
particularly myeloid differentiation. Knockout mice deficient in both
RAR Although the above evidence clearly portrays an important role for RARs
in regulating myelopoiesis, several critical questions remain
unanswered. What is the relationship of RAR activity to other important
regulators of myelopoiesis, particularly those specific cytokines such
as interleukin-3 (IL-3) and granulocyte-macrophage colony-stimulating
factor (GM-CSF) that regulate myeloid progenitor growth and
differentiation? If RAR activity is ligand concentration-dependent, then how is RAR activity regulated in hematopoietic cells that are
exposed to the uniform "physiologic" concentrations of retinoids that are presumably present in blood and bone marrow? Finally, and
perhaps most importantly from a clinical standpoint, why do only the
APLs exhibit a dramatic response to retinoids while the other 90% of
acute myelogenous leukemias do not, even though these other acute
myelogenous leukemias express normal RARs? Indeed, a central
paradox related to this clinical response to all-trans retinoic acid (ATRA) is that the ATRA-sensitive human myelogenous leukemias (ie, APL) harbor aberrant RARs exhibiting dominant negative activity (ie, the translocated PML-RAR Here we describe observations in a number of cytokine-dependent in
vitro models of myeloid differentiation that provide significant insight into these questions. We observe that in the multipotent stem
cell factor (SCF)-dependent EML cells the transcriptional activity of
endogenous RARs is significantly enhanced following a brief exposure to
IL-3. Moreover, GM-CSF also enhances RAR transcriptional activity in
the EML cell cultures to an even greater degree than IL-3. We also
observe that these cytokines significantly enhance RAR activity in
other in vitro models of myeloid differentiation. This
cytokine-mediated enhancement of RAR activity represents a novel and
unexpected point of convergence of 2 critical signal transduction
pathways important for mediating myeloid cell commitment and
differentiation and represents a new paradigm with respect to how RAR
activity might be modulated during hematopoiesis.
Cell cultures and reagents
The EML/GM-CSF cells were derived from the parental EML cells as
follows. Following overnight exposure of the SCF-dependent EML cells to
IL-3 (5 ng/mL) (Peprotech, Rocky Hill, NJ), we washed the cells and
resuspended them in culture medium containing murine recombinant GM-CSF
alone (2-4 ng/mL) (Peprotech). Within 24 to 48 hours following this
hematopoietic growth factor switch, GM-CSF-dependent cells (referred
to as EML/GM-CSF cells) were rapidly and reproducibly generated from
the parental EML cells. These cultured cells proliferate indefinitely
in GM-CSF and undergo rapid apoptosis within 12 to 24 hours following
growth factor withdrawal.
The 32D cells10 were cultured in Dulbecco modified Eagle
medium supplemented with 10% fetal calf serum and IL-3 (1-2 ng/mL). Where indicated they were washed and resuspended in the same media supplemented with GM-CSF (2-4 ng/mL) rather than IL-3.
Primary cultures of highly enriched hematopoietic precursors were
initiated by isolating lin Assay of EML CFU-GM generation
Transient transfections and reporter gene assays All cell lines were transiently transfected by electroporation as previously detailed.14 Electroporation conditions for the EML, the EML plus IL-3 cells, and the primary Sca-1+, c-kit+ hematopoietic precursors cultured in either SCF or IL-3 were 270 V and 950 microfarads. Electroporation conditions for the EML/GM-CSF cells, the primary Sca-1+, c-kit+ hematopoietic precursors cultured in GM-CSF, and the 32D cells were 450 V and 700 microfarads. The electroporated cells were cultured for 5 hours prior to harvesting for luciferase as previously described.14 The luciferase reporter is the RARE
tk-LUC that harbors sequences corresponding to the RARE present in the
 55 to 33 sequence of the RAR2 promoter
(AGGGTTCACCGAAAGTTCACTCG).15 As an internal control for
transfection efficiency we used the PON838 plasmid, which is a
-galactosidase reporter regulated by the -actin promoter. A total
of 25 µg of the RARE tk-LUC reporter and 40 µg of the PON838
control plasmid were generally used for each transfection. The
LRXR SN expression vector was constructed as previously
detailed.16 Relative luciferase activity was calculated as
the ratio of absolute luciferase value divided by a baseline value that
was arbitrarily set at 1. This baseline value varied for each set of
experiments and was chosen as the lowest absolute luciferase value
within a particular experimental set. As a control for variable
transfection efficiency, the calculated relative luciferase
activity was adjusted using the -galactosidase activity as an
internal control.
RNA isolation and Northern blot analysis Total cell RNA was extracted with guanidine hydrochloride and electrophoresed through formaldehyde denaturing gels as previously detailed.17 The gel was blotted to nylon membranes (Nytran plus, Schleicher and Schuell, Keene, NH), and these membranes were hybridized to DNA probes radiolabeled by nick translation. The nuclear receptor corepressor (N-CoR), silencing mediator of retinoic acid and thyroid hormone receptor (SMRT), and Rac-3 (ACTR) probes were obtained from Ron Evans. The GRIP-1 probe was obtained from Michael Stallcup and the SRC-1 probe from Shaun Cowley.Protein extraction and Western blot analysis Whole cell protein extracts were obtained by boiling cell pellets for 5 minutes in Laemmli sample buffer (3 × 104 cells/µL). Cell extracts (20 µL/lane) were separated on a SDS-PAGE gradient (7%-10%), electrophoresed under reducing conditions, and electroblotted using the Mini-Trans Blot Cell (Bio-Rad, Hercules, CA) onto Polyscreen PVDF transfer membrane (NEN Life Sciences, Boston, MA). Immunoblotting was performed using antibodies obtained from Santa Cruz Biotechnology unless otherwise indicated. Peroxidase-conjugated goat anti-rabbit antibody or peroxidase-conjugated rabbit anti-mouse was used as secondary antibody (Santa Cruz Biotechnology) followed by detection with enhanced chemiluminescence (ECL kit, Amersham/Pharmacia).Surface antigen phenotyping The cultured cells were stained with antibodies directly conjugated with fluorescein isothiocyanate or phycoerythrin and analyzed on a FACScan (Becton Dickinson) as previously detailed.11 The antibodies used included anti-Gr-1, anti-CD11b, anti-c-kit, and anti-Sca-1 (Pharmingen).
IL-3 induction of the multipotent EML cells to granulocyte/monocyte progenitors is associated with enhanced RA receptor activity The SCF-dependent EML cell line is multipotent, exhibiting the potential to differentiate along the erythroid, lymphoid, myeloid, or mast cell lineages.9 The addition of IL-3 to these SCF-dependent EML cells induces their rapid commitment to GM-CSF-responsive granulocyte/monocyte progenitors (colony-forming units [CFU]-GM)9,14 (Figure 1). Curiously, we observe that the synthetic retinoid, AGN193109, a potent competitive inhibitor of RAR activity,13 does not inhibit CFU-GM production in the SCF-dependent EML cells but significantly inhibits this IL-3-mediated enhancement of CFU-GM production in these cultures (Figure 1, compare columns 3 and 4), suggesting that this activity of IL-3 might be mediated through RARs. To test this hypothesis we used transient transfection of a luciferase reporter driven by a RARE to compare RAR transcriptional activity in the parental EML cells versus the same EML cells treated overnight with IL-3. We noted that this relatively brief (15- to 20-hour) exposure of the EML cells to IL-3 enhanced both basal and ATRA-induced reporter activity at least 3- to 5-fold (Figure 2A). This enhanced reporter activity is not secondary to differences in transfection efficiency of the IL-3-treated cells because all luciferase values were corrected using a cotransfected-galactosidase reporter as an internal control.
Moreover, this increase in RAR activity is not a generalized
phenomenon, because other transfected reporter constructs, including an
RSV-luciferase reporter, do not display enhanced activity in the
IL-3-treated EML cells (Figure 2C). This IL-3-mediated enhancement of
RAR functional activity was not associated with any obvious increase in
RXR or RAR protein levels in the IL-3-treated cells. Indeed, these
IL-3-treated cells exhibited somewhat decreased RXR expression
(Figure 2B).
IL-3 enhances the activity of transfected chimeric RARs in EML cells The EML cells were initially generated by transducing a truncated dominant negative RAR construct (RAR 403) into normal mouse bone
marrow.9 This dominant negative RAR403, which lacks the RAR COOH terminal activation domain, likely competes with normal
RARs for binding to the RXR heterodimeric partner,18 and
the cultured EML cells express relatively high levels of this truncated, dominant negative RAR.14 The presence of this
dominant negative RAR403 in the EML cells complicates the
interpretation of the above studies because it is unclear whether IL-3
might be enhancing the activity of the endogenous RXR/RAR versus the truncated RXR/RAR403 heterodimer. Moreover, the presence of the
dominant negative RAR403 might potentially mask or dilute the
stimulation of any endogenous RAR activity in the IL-3-treated EML
cells. We therefore performed transient transfection studies in the
cultured EML cells using chimeric RAR expression vectors that harbor an
intact RA ligand binding domain but which recognize and stimulate
reporters driven by glucocorticoid response elements rather than RAREs
19,20 (Figure 3A). These
chimeric receptors are activated by RA, but their activity on the
glucocorticoid response element-driven reporter should not be
inhibited by the dominant negative RAR403, because the latter
recognizes RAREs rather than glucocorticoid response elements.
Using this approach we observed that overnight treatment of the EML
cells with IL-3 markedly enhanced the activity of the transiently
transfected chimeric receptor on the corresponding R5G reporter (Figure
3B). This enhanced receptor activity was observed at all concentrations
of ATRA, including the lower "physiologic" concentrations of
10 Derivation and characterization of GM-CSF-dependent cells from the SCF-dependent EML cells Because the increased RAR activity that we observed in the IL-3-treated EML cells (Figures 2A, 3B) was associated with the enhanced production of GM-CSF-dependent granulocyte/monocyte progenitors (Figure 1), we wished to determine whether such committed progenitors derived from the EML cells also displayed enhanced RAR functional activity. To approach this question, as detailed in "Materials and methods," we used the parental SCF-dependent EML cells to derive GM-CSF-dependent cell lines (designated EML/GM-CSF) that were enriched in these granulocyte/monocyte precursors.The characterization of the EML/GM-CSF cells and their comparison with
the parental SCF-dependent EML cells is summarized in Figures 4 and 5.
Morphologically the parental EML cells as well as the EML cells treated
overnight with IL-3 appear relatively undifferentiated (Figure
4A,B) and display an immature surface antigen phenotype that is predominantly Sca 1+,
kit+ with few Gr1+, Cd11b mature myeloid cells
present (Figure 5A,B). In contrast, the
EML/GM-CSF cells display a more differentiated phenotype, morphologically resembling myeloblasts and promyelocytes (Figure 4C)
with loss of Sca-1 and kit expression and a predominance in the culture
of mature Gr1+, Cd11b+ myeloid cells (Figure
5C). Of note is the marked difference in the response of these cells to
ATRA. The addition of ATRA (10
Differential activity of the RARs in EML/GM-CSF versus the parental EML cells Similar to the experiments described in Figure 2, we compared the functional activity of RARs in the EML/GM-CSF cultures with the parental, SCF-dependent EML cells. We observed a relatively large (8- to 10-fold) increase in the activity of the endogenous RARs in the EML/GM-CSF cells compared with the parental EML cells (Figure 6). This GM-CSF-mediated enhancement was observed for both basal as well as ATRA-induced receptor activity (Figure 6). As with the IL-3-treated EML cells, we observed no increase in expression of either RXR or RAR in the EML/GM-CSF cells compared with the parental EML cells, and indeed RXR expression appeared somewhat diminished in the EML/GM-CSF cells (Figure 2B).
IL-3- and GM-CSF-mediated activation of RAR activity in other cultured hematopoietic cells To determine whether the IL-3- and GM-CSF-mediated activation of RAR transcriptional activity that we observed in the EML cells extended to other in vitro models of myeloid differentiation, we assessed RAR transcriptional activity in normal mouse hematopoietic precursors (lin c-kit+ Sca-1+) cultured, as
detailed in "Materials and methods," in liquid suspension in a
mixture of hematopoietic growth factors together with the immobilized
notch ligand, Delta-1.12 Similar to the EML cells,
virtually all of these cultured normal hematopoietic precursors exhibit
a relatively immature Sca-1+, c-kit+ surface
antigen phenotype (not shown). We washed and then cultured these
Sca-1+, c-kit+ cells in either SCF alone, SCF
plus IL-3, or GM-CSF alone and then used transient transfection of the
RARE luciferase reporter to assess the activity of endogenous RARs in
these different cytokine-stimulated, immature hematopoietic precursors.
Similar to our observation in EML cells, the stimulation of these
SCF-dependent cells with IL-3 enhanced the transcriptional activity of
the endogenous RARs, and this was evident at both relatively high
(106 M) as well as physiologic (109 M)
concentrations of ATRA (Figure 7).
Moreover, as in EML cells, switching the cytokine from SCF alone to
GM-CSF alone also resulted in a marked enhancement of RAR functional
activity (Figure 7).
We also assessed the activity of RARs in the murine 32D myeloid cell
line exposed to different cytokines. The growth of these cells is
IL-3-dependent, but their differentiation to granulocytes/monocytes is
induced by switching the growth factor to GM-CSF.10 We
observe that the 32D cells cultured in GM-CSF alone exhibit an increase in myeloid surface antigen expression (Gr1 and CD11b) compared with the
IL-3-dependent 32D cells (Figure 8A,B).
This enhanced GM-CSF-mediated myeloid differentiation is associated
with enhanced ATRA-induced RAR activity in these cells (Figure 8C).
Thus, the cytokine-mediated enhancement of RAR activity is not a
phenomenon unique to EML cells but is also observed in other
cytokine-responsive in vitro models of myeloid differentiation.
Expression of nuclear hormone receptor corepressors and coactivators in the different cytokine-stimulated cells The current model of RAR activation suggests that in the absence of ligand the RXR-RAR heterodimer interacts with repressor complexes that harbor histone deacetylase (HDAC) activity and whose critical components include the corepressors N-CoR 21 and/or SMRT.22 The addition of ligand (RA) results in a distinct conformational change in the RAR, leading to the release of such corepressors and recruitment of transcriptional coactivators including SRC-1, ACTR, and GRIP-1.23 We have noted at least a 5- to 10-fold enhancement of the RAR basal activity (ie, activity in the absence of exogenous ligand) in the EML/GM-CSF cells compared with the parental EML cells (Figure 6), suggesting that the functional activity of the N-CoR/SMRT repressor complexes harboring HDAC activity may be diminished in the EML/GM-CSF cells. Interestingly, we observe that the HDAC inhibitor trichostatin A (TSA) readily activates the RA-responsive reporter in the parental EML cells and in the EML cells treated overnight with IL-3 but induces very little if any RAR activation in the EML/GM-CSF cells (Figure 9). This observation suggests that the functional activity of HDAC-containing repressor complexes may be greater in the parental EML cells compared with the more mature EML/GM-CSF cells. However, we observe no significant differences in messenger RNA or protein expression of the corepressors N-CoR or SMRT in the different cytokine-treated cells (Figure 10). Similarly, we observe no significant differences in expression of the nuclear hormone receptor coactivators SRC-1, ACTR, or GRIP-1 that might account for the differences in the functional activity of the RARs that we have observed in the different cytokine-treated EML cells (Figure 10).
The role of specific hematopoietic cytokines such as IL-3 and
GM-CSF in regulating myeloid cell proliferation and differentiation is
well established. Similarly, RARs, particularly RAR The RARs were originally defined by their concentration-dependent
activation by RA,24 and investigators studying the role of
retinoids in hematopoiesis routinely use relatively high
"pharmacologic" concentrations of ATRA
(10 What is the molecular basis for this cytokine-mediated enhanced transcriptional activity of the RARs that we have observed in these different in vitro models of myeloid differentiation? In the EML cells enhanced expression of the components of the RXR/RAR heterodimer cannot be responsible for this augmented receptor activity because we observe no increase in the expression levels of either RXR or RAR in the IL-3- or GM-CSF-treated cells (Figure 2B). Our observation that the HDAC inhibitor trichostatin A markedly activates receptor activity in the immature, SCF-dependent EML cells but not in the more mature EML/GM-CSF cells (Figure 9) suggests that there might be differences in the repressor complexes harboring HDAC activity that interact with the RARs in these different cell types. However, with the different cytokine exposure, we can discern no significant changes in expression of the RAR corepressors (N-CoR or SMRT) that likely mediate the interaction of HDAC-containing complexes to the RARs23 (Figure 10). Similarly, the expression of the RAR coactivators (SRC-1, GRIP-1, ACTR) appears similar in the different cytokine-treated cells (Figure 10). These observations suggest that the cytokine-mediated enhancement of RAR activity may involve posttranslational modification of either the RARs themselves or of their associated coactivators/corepressors. Site-specific phosphorylation has been previously observed to alter the activity of certain nuclear hormone receptors25,26 as well as their associated corepressors27 and coactivators.28,29 It is possible that exposure to different cytokines might trigger certain posttranslational events that modulate RAR activity at different stages of myeloid development, but such molecular events remain to be defined. In these studies we have noted and emphasized the role of specific cytokines in modulating RAR activity in different in vitro models of myeloid differentiation. However, an alternative interpretation to consider is that the observed differences in RAR activity primarily reflect differences in the level of myeloid commitment/differentiation of these different cytokine-dependent cells. For example, the EML/GM-CSF cells are more differentiated than the parental, SCF-dependent EML cells both by morphology (Figure 4) and surface antigen expression (Figure 5), and these more differentiated EML/GM-CSF cells display considerably greater RAR transcriptional activity than the parental EML cultures (Figure 6). This differential activity of RARs at different stages of myeloid differentiation may be related to the clinically relevant differential sensitivity exhibited by human myelogenous leukemia cells to ATRA therapy. We hypothesize that this differential response of myeloid leukemia cells to ATRA reflects the underlying retinoid sensitivity of the normal hematopoietic cell lineages corresponding to these different leukemias. Thus, in myeloid leukemias corresponding to relatively immature myeloid precursors (such as the SCF-dependent EML cells), RAR activity in response to retinoids is relatively blunted. In contrast, in myeloid leukemias corresponding to a more mature myeloid progenitor (such as the more mature EML/GM-CSF cells), RAR activity in response to retinoids is enhanced. Determining the molecular basis for these differences in RAR activity that is observed at different stages of myeloid differentiation may have direct relevance to the question of why some leukemias (ie, APL) respond dramatically to retinoids while most others (the non-APL leukemias) do not.
We thank Jutta Fero for excellent technical assistance; Ron Evans
and Michael Stallcup for gifts of molecular probes; Elliot Klein
(Allergan Pharmaceuticals) for the gift of the RAR-PGR expression vector; Dave Flowers for aid in the surface antigen phenotyping of the
cultured cells; and Carrie Stein and Barbara Varnum-Finney for the
normal mouse hematopoietic precursor (lin
Submitted June 22, 2001; accepted September 27, 2001.
Supported by National Institutes of Health grant CA58292 (S.J.C.) and by National Institutes of Health grant HL54881.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Steven J. Collins, Human Biology Div, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave N, Seattle WA 98109; e-mail: scollins{at}fhcrc.org.
1. Kastner P, Mark M, Chambon P. Nonsteroid nuclear receptors: what are genetic studies telling us about their role in real life? Cell. 1995;83:859-869[CrossRef][Medline] [Order article via Infotrieve]. 2. Mangelsdorf D, Evans R. The RXR and orphan receptors. Cell. 1995;83:841-850[CrossRef][Medline] [Order article via Infotrieve].
3.
Labrecque J, Allan D, Chambon P, Iscove NN, Lohnes D, Hoang T.
Impaired granulocytic differentiation in vitro in hematopoietic cells lacking retinoic acid receptors 4. Douer D, Ramezani L, Parker J, Levine AM. All-trans-retinoic acid effects the growth, differentiation and apoptosis of normal human myeloid progenitors derived from purified CD34+ bone marrow cells. Leukemia. 2000;14:874-881[CrossRef][Medline] [Order article via Infotrieve]. 5. He L-Z, Guidez F, Tribioli C, et al. Distinct interactions of PML-RARa and PLZF- RARa with co-repressors determine differential responses to RA in APL. Nat Genet. 1998;18:126-135[CrossRef][Medline] [Order article via Infotrieve]. 6. Lin R, Nagy L, Inoue S, Shao W, Miller W, Evans R. Role of the histone deacetylase complex in acute promyelocytic leukemia. Nature. 1998;391:811-814[CrossRef][Medline] [Order article via Infotrieve].
7.
Pandolfi PP.
Oncogenes and tumor suppressors in the molecular pathogenesis of acute promyelocytic leukemia.
Hum Mol Genet.
2001;10:769-775
8.
Morosetti R, Grignani F, Liberatore C, et al.
Infrequent alterations of the RAR
9.
Tsai S, Bartelmez S, Sitnicka E, Collins S.
Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant negative retinoic acid receptor can recapitulate lymphoid, myeloid and erythroid development.
Genes Dev.
1994;8:2831-2842
10.
Kreider BL, Phillips PD, Prystowsky MB, et al.
Induction of the granulocyte-macrophage colony-stimulating factor (CSF) receptor by granulocyte CSF increases the differentiative options of a murine hematopoietic progenitor cell.
Mol Cell Biol.
1990;10:4846-4853
11.
Purton L, Bernstein I, Collins S.
All-trans retinoic acid delays the differentiation of primitive hematopoietic precursors while enhancing the terminal maturation of committed granulocyte/monocyte progenitors.
Blood.
1999;94:483-495 12. Varnum-Finney B, Wu L, Yu M, et al. Immobilization of Notch ligand, Delta-1, is required for induction of notch signaling. J Cell Sci. 2000;113 pt 23:4313-4318[Abstract]. 13. Johnson A, Klein E, Gillet S, et al. Synthesis and characterization of a highly potent and effective antagonist of retinoic acid receptors. J Med Chem. 1995;38:4764-4767[CrossRef][Medline] [Order article via Infotrieve].
14.
Johnson B, Chandraratna R, Heyman R, Allegretto E, Mueller L, Collins S.
RXR agonist-induced activation of dominant negative RXR-RAR*403 heterodimers is developmentally regulated during myeloid differentiation.
Mol Cell Biol.
1999;19:3372-3382 15. de The H, Vivanco-Ruiz MM, Tiollais P, Stunnenberg H, Dejean A. Identification of a retinoic acid responsive element in the retinoic acid receptor beta gene. Nature. 1990;343:177-180[CrossRef][Medline] [Order article via Infotrieve].
16.
Robertson KA, Emami B, Mueller L, Collins SJ.
Multiple members of the retinoic acid receptor family are capable of mediating the granulocytic differentiation of HL-60 cells.
Mol Cell Biol.
1992;12:3743-3749
17.
Collins S, Coleman H, Groudine M.
Expression of bcr and bcr-abl fusion transcripts in normal and leukemic cells.
Mol Cell Biol.
1987;7:2870-2876
18.
Tsai S, Bartelmez S, Heyman R, Damm K, Evans R, Collins S.
A mutated retinoic acid receptor
19.
Klein ES, Pino ME, Johnson AT, et al.
Identification and functional separation of retinoic acid receptor neutral antagonists and inverse agonists.
J Biol Chem.
1996;271:22692-22696 20. Kurokawa R, DiRenzo J, Boehm M, et al. Regulation of retinoid signalling by receptor polarity and allosteric control of ligand binding. Nature. 1994;371:528-531[CrossRef][Medline] [Order article via Infotrieve]. 21. Horlein A, Naar A, Heinzel T, et al. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature. 1995;377:397-404[CrossRef][Medline] [Order article via Infotrieve]. 22. Chen JD, Evans R. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature. 1995;377:454-457[CrossRef][Medline] [Order article via Infotrieve].
23.
Glass CK, Rosenfeld MG.
The coregulator exchange in transcriptional functions of nuclear receptors.
Genes Dev.
2000;14:121-141 24. Giguere V, Ong ES, Segui P, Evans RM. Identification of a receptor for the morphogen retinoic acid. Nature. 1987;330:624-629[CrossRef][Medline] [Order article via Infotrieve].
25.
Kato S, Endoh H, Masuhiro Y, et al.
Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase.
Science.
1995;270:1491-1494
26.
Rochette-Egly C, Adam S, Rossignol M, Egly JM, Chambon P.
Stimulation of RAR
27.
Hong SH, Privalsky ML.
The SMRT corepressor is regulated by a MEK-1 kinase pathway: inhibition of corepressor function is associated with SMRT phosphorylation and nuclear export.
Mol Cell Biol.
2000;20:6612-6625
28.
Font de Mora J, Brown M.
AIB1 is a conduit for kinase-mediated growth factor signaling to the estrogen receptor.
Mol Cell Biol.
2000;20:5041-5047
29.
Rowan BG, Weigel NL, O'Malley BW.
Phosphorylation of steroid receptor coactivator-1. Identification of the phosphorylation sites and phosphorylation through the mitogen- activated protein kinase pathway.
J Biol Chem.
2000;275:4475-4483
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  S. Taschner, C. Koesters, B. Platzer, A. Jorgl, W. Ellmeier, T. Benesch, and H. Strobl Down-regulation of RXR{alpha} expression is essential for neutrophil development from granulocyte/monocyte progenitors Blood, February 1, 2007; 109(3): 971 - 979. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Shimizu, L. Esaki, H. Mizuno, and K. Takeda Granulocyte macrophage colony-stimulating factor enhances retinoic acid-induced gene expression J. Leukoc. Biol., October 1, 2006; 80(4): 889 - 896. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Szanto and L. Nagy Retinoids Potentiate Peroxisome Proliferator-Activated Receptor {gamma} Action in Differentiation, Gene Expression, and Lipid Metabolic Processes in Developing Myeloid Cells Mol. Pharmacol., June 1, 2005; 67(6): 1935 - 1943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Glasow, N. Prodromou, K. Xu, M. von Lindern, and A. Zelent Retinoids and myelomonocytic growth factors cooperatively activate RARA and induce human myeloid leukemia cell differentiation via MAP kinase pathways Blood, January 1, 2005; 105(1): 341 - 349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. M. Hengesbach and K. A. Hoag Physiological Concentrations of Retinoic Acid Favor Myeloid Dendritic Cell Development over Granulocyte Development in Cultures of Bone Marrow Cells from Mice J. Nutr., October 1, 2004; 134(10): 2653 - 2659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Maun, P. Gaines, A. Khanna-Gupta, T. Zibello, L. Enriquez, L. Goldberg, and N. Berliner G-CSF signaling can differentiate promyelocytes expressing a defective retinoic acid receptor: evidence for divergent pathways regulating neutrophil differentiation Blood, March 1, 2004; 103(5): 1693 - 1701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Moqattash and J. D. Lutton Leukemia Cells and the Cytokine Network: Therapeutic Prospects Experimental Biology and Medicine, February 1, 2004; 229(2): 121 - 137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. T. Phan, D. B. Shultz, B.-T. H. Truong, T. J. Blake, A. L. Brown, T. J. Gonda, M. M. Le Beau, and S. C. Kogan Cooperation of Cytokine Signaling with Chimeric Transcription Factors in Leukemogenesis: PML-Retinoic Acid Receptor Alpha Blocks Growth Factor-Mediated Differentiation Mol. Cell. Biol., July 1, 2003; 23(13): 4573 - 4585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Si and S. J. Collins IL-3-induced enhancement of retinoic acid receptor activity is mediated through Stat5, which physically associates with retinoic acid receptors in an IL-3-dependent manner Blood, December 15, 2002; 100(13): 4401 - 4409. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-C. Guillemin, E. Raffoux, D. Vitoux, S. Kogan, H. Soilihi, V. Lallemand-Breitenbach, J. Zhu, A. Janin, M.-T. Daniel, B. Gourmel, et al. In Vivo Activation of cAMP Signaling Induces Growth Arrest and Differentiation in Acute Promyelocytic Leukemia J. Exp. Med., November 18, 2002; 196(10): 1373 - 1380. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
display an in vitro block to granulocyte differentiation,
