| |
|
|
|
|
|
|
|||
|
NEOPLASIA
From the Department of Morphology and Molecular
Pathology, Katholieke Universiteit Leuven, Belgium.
Two recurrent translocations have been associated with
mucosa-associated lymphoid tissue (MALT)-type lymphoma,
t(11;18)(q21;q21) and t(1;14)(p22;q32). The first, t(11;18)(q21;q21),
results in the fusion protein API2-MLT (API2-MALT1). Through
t(1;14)(p22;q32), the BCL10 gene is entirely transferred to
the IgH gene, resulting in its overexpression. Wild-type
BCL10 is implicated in apoptosis, and it has been suggested that
mutated forms gain oncogenic activity. The occurrence of genomic
BCL10 mutations in 35 gastric MALT-type lymphomas with or
without t(11;18)(q21;q21) (10 and 25 cases, respectively) was
investigated. DNA extracted from either whole tissue sections or
microdissected clusters of tumor cells was used. Five polymerase chain
reactions amplifying the coding exons were performed and were
followed by direct sequencing of the products. Twenty differences with
the published BCL10 sequence, all single nucleotide
substitutions, were detected in 16 cases. Of these, 12 represented
known polymorphisms, either at codon 8, 213, or 5. Of the remaining 8 substitutions, 2 were silent and 6 resulted in amino acid
substitutions. Mutation analysis results were correlated with the BCL10
expression pattern. Aberrant nuclear BCL10 expression was detected in
14 cases. No association could be demonstrated between the latter and
the presence of BCL10 mutations. In contrast, all 10 cases
carrying t(11;18)(q21;q21) showed nuclear expression, whereas this
staining pattern was absent in 21 of 25 cases without t(11;18)(q21;q21). These results demonstrate that BCL10
mutations are rare in gastric MALT-type lymphoma and are not related to the aberrant nuclear expression of BCL10. In contrast, they indicate that the presence of the API2-MLT fusion protein is associated with
aberrant nuclear BCL10 expression.
(Blood. 2002;99:1398-1404) The BCL10 gene has recently been cloned
from the t(1;14)(p22;q32), which was found in a B-cell lymphoma of
mucosa-associated lymphoid tissue (MALT).1 As a
consequence of this translocation, the entire BCL10 gene was
juxtaposed to the IgH enhancer region, resulting in its
overexpression. The wild-type BCL10 gene encodes a protein
containing an amino-terminal caspase recruitment domain and was found
to weakly promote apoptosis, to activate NF- In a series of other studies, the occurrence of BCL10
mutation could not be confirmed for lymphoma and other hematologic
malignancies or for a wide range of solid tumors4-13; thus,
the role of BCL10 mutation resulting in the loss of tumor suppressor
function remains controversial. Moreover, the occurrence of the
t(1;14)(p22;q32) in MALT-type lymphoma is not always associated with
the presence of BCL10 mutations.3 This
observation contradicts the possible pathogenic role of loss of
proapoptotic BCL10 function in view of the overexpression of wild-type
BCL10 in these cases. However, the BCL10 expression pattern in tumor
cells from MALT-type lymphoma with the t(1;14)(p22;q32) differ from
that seen in normal marginal zone cells. Although in normal marginal
zone cells BCL10 is expressed only in the cytoplasm, it is expressed in
nucleus and cytoplasm in tumor cells from t(1;14)(p22;q32)-positive
MALT-type lymphoma cases.14 It was suggested that the
altered cellular localization of BCL10 protein may represent another
mechanism for BCL10-induced lymphomagenesis3,14 and
that this mechanism might be involved in cases without the
t(1;14)(p22;q32) because these cases also showed, in part, nuclear
BCL10 expression.14 The explanation for the nuclear
translocation of BCL10 protein in t(1;14)(p22;q32)-positive and
t(1;14)(p22;q32)-negative MALT lymphoma cases has not been elucidated.
In the current study, we investigated the occurrence of genomic
BCL10 mutations in a series of 35 well-characterized cases of gastric MALT lymphoma and 10 gastric diffuse large B-cell lymphoma (DLBCL). Mutation analysis results were correlated with the expression pattern of BCL10 protein to test a possible association between both.
We also investigated the possible relationship between the expression
of BCL10 protein and BCL10 gene alteration in the presence or absence of the API2-MLT (also called
API2-MALT1) fusion transcript. The latter results from the
t(11;18)(q21;q21) for which all cases were previously
analyzed15 and which represents a more common genetic
alteration in MALT lymphoma than the BCL10 gene rearrangement.
Cases
DNA samples
DOP-PCR was performed on a thermocycler (Perkin Elmer 480; Applied Biosystems, Lennik, Belgium) in 2 separate phases. Four initial cycles (preamplification step) were carried out in a 10-µL reaction mixture (using ThermoSequenase [Amersham Pharmacia, Roosendaal, The Netherlands] and a high-salt buffer) at low-stringency conditions, which was followed by 30 cycles in a 40-µL reaction volume (using AmpliTaq polymerase LD [Applied Biosystems] and a low-salt buffer) at high-stringency conditions. Both PCR reactions contained the UN1-primer (5'-CCGACTCGAGNNNNNNATGTGG-3', with N = A, C, G, or T) allowing universal amplification of genomic DNA.16 Reagents, volumes, and reaction were previously described by Kuukasjärvi et al.17 The product was purified (Qiagen Westburg, Leusden, The Netherlands) before further use. Polymerase chain reaction analysis PCR for the full coding sequence of the BCL10 gene consisted of 5 different reactions amplifying coding exon 1 by a single reaction and coding exons 2 and 3 by 2 separate overlapping reactions. Primer sequences in the 5' to 3' direction were the following: Bex1F, GGACCCGGAAGAAGCGCCATCTCC; Bex1R, GATCCTCCTTGTCCTCGGAC TC; Bex2.1F, AAGACTGCCAACTAATAGTCACGT; Bex2.1R, CCGAATTTTCCAGCC CTTTTTCT; Bex2.2F, CCGAAGAAATTTCTTGTCGAACA; Bex2.2R, AGCATTATTA CATTTAAATTAGCTC; Bex3.1F, CACAAGATGGACAGTGACTCC; Bex3.1R, TTGA AGAGAAGATGGTATTTTCAGT; Bex3.2F, GAAGGAGAATCCAGCACGA; Bex3.2R, TGTCATCATTAAAAATTAAAAGGCA. PCR was performed in a GeneAmp PCR system 9600 (Applied Biosystems) in final volumes of 50 µL, containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 200 µM each dNTP, 0.2 µM each primer, 500 ng DNA (either extracted from tissue sections or purified DOP-PCR material), and 2.5 U Taq polymerase (AmpliTaq Gold; Applied Biosystems). Thermal cycle conditions were 10 minutes at 94°C followed by 40 cycles of denaturation (94°C, 1 minute), annealing (20 cycles at 63°C, 1 minute and 20 cycles at 60°C, 1 minute), and extension (72°C, 1 minute).Sequencing of polymerase chain reaction products and mutation analysis All PCR products were directly sequenced in both directions using the Big Dye Terminator Ready Reaction kit and an ABI PRISM 310 Genetic Analyzer, according to the manufacturer's recommendations (Applied Biosystems). Mutation analysis was performed by comparing obtained sequences to the germline BCL10 sequence as recorded in GenBank (accession no. AF097732), using SeqMan 4.00 software (DNAStar, Madison, WI).Immunohistochemistry Paraffin-embedded sections were used for the analysis of BCL10 expression by immunohistochemistry using a BCL10 monoclonal antibody kindly provided by M. Dyer (Sutton, United Kingdom). Reactive spleen and lymph node tissue sections were also stained as controls.After deparaffinization, the formalin- or B5-fixed tissue sections were incubated for 30 minutes in methanol plus peroxide at room temperature, followed by a brief wash in phosphate-buffered saline (PBS). Slides were heated 3 times in a sodium-citrate buffer (pH 6) using a microwave oven at 750 W, slowly cooled in the same solution, and briefly washed in PBS. Incubation with the BCL10 antibody (1:10) was carried out overnight at 4°C, followed by a brief wash with PBS. Staining was performed using the EnVision system (DAKO, Glostrup, Denmark) according to the manufacturer's recommendations and with amino ethyl carbazole. Sections were counterstained with hematoxylin.
All results are summarized in
Table 1.
BCL10 gene mutation In the 5 DNA samples derived from the lymphadenitis cases, 2 distinct differences with the published BCL10 sequence (GenBank accession no. AF097732), both single nucleotide substitutions, were observed in coding exons 1 and 3. These included C/G in codon 8 (CTC > CTG) (exon 1) and G/A in codon 213 (GGA > GAA) (exon 3). The presence of these substitutions in normal DNA suggests they represent polymorphisms. The polymorphism at codon 213 caused an amino acid substitution (GLY > GLU), whereas the polymorphism in codon 8 was silent. Both polymorphisms were reported previously.3-5,12As analyzed on the DNA extracted from whole tissue sections, the 35 MALT-type lymphoma cases showed a total of 16 differences with the published sequence in 14 cases. Twelve cases showed 1 difference, and 2 cases exhibited 2 differences. All were single nucleotide substitutions, and 11 of 16 were identified as one of the polymorphisms described above for the lymphadenitis cases: the polymorphisms at codon 8 and codon 213 were detected 7 and 4 times, respectively. One case exhibited 2 polymorphisms at codons 8 and 213 (case 28). The remaining 5 single nucleotide substitutions were present in codons 5, 11, 68, 94, and 227, and all caused amino acid substitutions except for the substitution in codon 227, which was silent (Table 1). The substitution in codon 5 was G to T (GCA > TCA) (exon 1), causing an amino acid substitution (ALA > SER) and was previously described by others as a polymorphism.4,5,12 Analysis on DNA derived from microdissected tumor cell clusters
revealed 2 additional differences with the published BCL10 sequence,
both single nucleotide substitutions. One of these was found in a tumor
cell cluster of case 13. It comprised no large cell component, and it
was silent (codon 175). The other was a nucleotide substitution (codon
207) in the large tumor cell cluster microdissected from case 25, causing an amino acid substitution (Table 1, Figure
1). In contrast, the substitutions in
codons 68, 94 (Figure 1), and 227
Of the 10 gastric DLBCL cases, 4 exhibited a single difference with the published BCL10 sequence. Cases 41 and 43 showed the codon 8 polymorphism, and case 40 demonstrated the codon 213 polymorphism. The remaining difference found in case 37 was a single nucleotide substitution, which occurred in codon 195 and was silent (Table 1). None of the potentially pathogenic mutations occurred more than once, and no apparent clustering of these mutations within a specific region of the BCL10 gene was observed. BCL10 expression by immunohistochemistry Analysis of normal spleen and lymph node tissue sections demonstrated expression of BCL10 protein. It was abundantly expressed in the cytoplasm of follicle center cells and in the cytoplasm of marginal zone cells compared with the expression of BCL10 in the lymphocytic corona, where it was absent or weak and never abundant. In none of the normal tissue sections was nuclear staining observed (Figure 2).
All MALT-type lymphoma cases showed cytoplasmic staining in the tumor cells, ranging from weak to abundant. In addition, 14 cases also displayed nuclear staining (Figure 2). All gastric DLBCL cases showed cytoplasmic expression, but no nuclear BCL10 expression, in the tumor cells. Correlation of results: BCL10 mutation, BCL10 nuclear expression, API2-MLT fusion. No obvious relation between BCL10 mutation and BCL10 nuclear expression could be deduced from the results summarized in Table 1. Of 14 cases displaying nuclear BCL10 expression, only 3 revealed a potentially pathogenic mutation (excluding known polymorphisms and silent mutations). In contrast, all 10 cases known to contain API2-MLT fusion transcripts showed BCL10 nuclear staining (Table 1). Four other cases without API2-MLT fusion transcripts also expressed BCL10 in the nucleus.
Initial studies on the involvement of BCL10 mutation in
the pathogenesis of lymphomas and other malignancies1-3
have reported splice variants and deletions and insertions within
homopolymeric runs, resulting in truncated BCL10 protein. These
truncated forms demonstrated loss of proapoptotic function but retained
the capacity to activate NF- We analyzed a series of gastric MALT-type lymphomas for the occurrence of BCL10 mutations. We detected 3 commonly reported polymorphisms3-5,12 that occurred 12 times in 11 cases (1, 7, and 4 times, respectively, in codons 5, 8, and 213). The polymorphic nature of codon 8 and 213 alterations was further confirmed by the analysis of reactive tissues and matched normal cells of the lymphoma cases. Apart from these polymorphisms, we further detected 8 differences in 6 cases with the published BCL10 sequence (GenBank accession no. AF097732) not previously reported, all of which represented single nucleotide substitutions. In 5 cases, we observed a discrepancy between results obtained on DNA extracted from whole tissue sections and those obtained on DOP-PCR-amplified DNA derived from 4 microdissected tumor clusters from the corresponding case. In 2 of these 5 cases, 2 different alterations, not present in the whole tumor DNA, were found in a different cluster. In contrast, the 3 other cases showed a mutation in the whole tumor DNA not present in the analyzed cell clusters. Based on a hematoxylin and eosin-stained serial section, it was ascertained for all cases that most cells present in the analyzed tissue section represented tumor cells. Nevertheless, it is likely to assume that the amount of normal DNA is higher in the whole tissue sections than in a microdissected tumor cell cluster, precluding the detection of a mutation occurring in the tumor cells. Amplification-related errors may cause these discrepancies. In particular, DOP-PCR may have induced technical artifacts whereby the DOP-PCR-amplified DNA may not perfectly represent the genotype of the microdissected tumor cells. Finally, the mutations may not be present in all tumor cells, precluding their detection in some samples by the abundance of tumor cells lacking the mutation. The latter implicates the presence of subclones with and without a particular mutation. This hypothesis is attractive because the same phenomenon has been described for other genes in lymphoid malignancies, such as the c-Myc and the BCL6 genes, in which it has been indicated as ongoing mutations.18,19 Discrepant results between different DNA samples from the same tumor specimen also indicate that these substitutions are not genetic polymorphisms, as additionally confirmed for cases 14, 21, and 31 by the analysis on DNA derived from corresponding normal cells (codons 94, 227, and 68). The significance of these mutations in the pathogenesis of MALT-type
lymphoma is unclear. Two of 8 BCL10 mutations detected in
the MALT-type lymphoma cases were silent, whereas the remaining 6 resulted in amino acid substitutions that might have altered the
structure of the protein. The functional importance of the latter
should be investigated, but it is probably low because the potentially
pathogenic mutations were detected at only a low frequency, were
nonrecurrent, and did not show a clustering within a specific domain of
the BCL10 gene. In addition, none of these mutations has
been reported. Finally, as discussed above, it is possible that not all
tumor cells from the same case exhibited the particular mutation,
indicating that it might be secondarily acquired, precluding its role
in the development of the lymphoma. In contrast, the codon 207 mutation
in the large cell component of one case might have caused the
acquisition of the high-grade morphology. However, ongoing mutation was
not restricted to cases with a high-grade component. Moreover, no
significant difference was found between the frequency of mutations in
MALT-type lymphoma with and without large cell proliferation. Finally,
of the 10 gastric DLBCL cases Based on all these arguments we conclude that BCL10 genomic mutations do not play an important role in the pathogenesis or the progression of gastric MALT-type lymphoma. This conclusion is in line with the interpretation of some recent reports,4,5,10,11 but it contradicts that of the initial studies on BCL10 mutation.1-3 The discordance between the findings of the latter studies and ours might be attributable to the occurrence of posttranscriptional modification because those studies were conducted on single cDNA clones in which the mutation frequency was higher than in genomic DNA.20 We cannot preclude that our cases exhibited additional mutations at the RNA level because we used genomic DNA. The possibility of posttranscriptional RNA modification is, however, contradicted by others who did not find truncating mutations in cDNA or in matched genomic DNA from malignant mesothelioma and colorectal carcinoma, which were also reported to exhibit similar truncating mutations.21 Alternatively, the discrepancy between results might have been caused by cloning or PCR artefacts,22 though similar truncating mutations were found by direct sequencing of PCR products, and their occurrence was confirmed in different studies at varying frequencies ranging from 10%3 to 45%1 of non-Hodgkin lymphoma cases. A third explanation for discrepant results may be the ongoing nature of the mutations, which might lead to an underestimation of mutation frequency by the direct sequencing of PCR products and not of individual clones.20 Of 18 cases analyzed on both types of DNA, only 5 showed discordant results between matched DNA samples, and none of the mutations in these cases resulted in BCL10 truncation. Thus, we have no arguments in favor of this explanation; the reason for the discrepancy between different studies remains unclear. Other important findings resulting from the current study concern the
expression of BCL10 and its cellular localization, as identified by
immunohistochemistry. Although control tissues only revealed
cytoplasmic BCL10 expression, we found that 14 of 35 gastric MALT-type
lymphoma cases displayed, apart from the cytoplasmic expression,
nuclear BCL10 expression, confirming the findings of Ye et
al.14 Our results clearly demonstrate that genomic BCL10 mutation cannot be responsible for the nuclear
localization of BCL10 protein in MALT-type lymphoma cells. Neither can
the latter be entirely explained by the occurrence of the t(1;14) as Ye
et al14 found aberrant nuclear expression not only in 4 MALT-type lymphomas with the t(1;14) but in 20 of 36 cases without the
translocation. Of interest, we found nuclear expression of BCL10 to be
highly associated with the occurrence of the API2-MLT fusion, comparable to what was recently reported by Liu et
al.23 All 10 t(11;18)-positive cases included in the
current study showed nuclear expression. Based on these findings, it is
tempting to speculate on a possible interaction between the API2-MLT
fusion protein and BCL10, resulting in the altered subcellular
localization of the latter. In view of our results, the finding that
BCL10 specifically interacts with MLT is intriguing.24,25
BCL10 and MLT form a tight complex that serves to oligomerize the
caspaselike domain of MLT. The latter appears to subsequently activate
the downstream I It is unclear whether BCL10 might directly interact with API2-MLT,
explaining the aberrant nuclear expression of BCL10. Binding of BCL10
to MLT requires the presence of the immunoglobulinlike domains of
MLT,25 present in the API2-MLT fusion protein in only some
cases. Moreover, the expression of API2-MLT has not been observed in
the nucleus,28 making it unlikely that direct binding of
BCL10 to API2-MLT results in nuclear colocalization of both.
Alternatively, if API2-MLT represents a gain-of-function mutant in
inducing NF- In summary, our results show that BCL10 mutation does not
play an important role in the development or the progression of gastric
MALT-type lymphoma and that BCL10 nuclear expression is not related to
the occurrence of BCL10 mutations. In contrast, t(1;14) and
t(11;18), both resulting in NF-
We thank Miet Vanherck for excellent technical assistance.
Submitted May 23, 2001; accepted October 11, 2001.
Supported by a grant from the Belgian Cancer Association.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Brigitte Maes, Department of Pathology, University Hospitals Leuven, Minderbroedersstraat 12, B-3000 Leuven, Belgium; e-mail: brigitte.maes{at}uz.kuleuven.ac.be.
1. Willis TG, Jadayel DM, Du MQ, et al. Bcl10 is involved in t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in multiple tumor types. Cell. 1999;96:35-45[CrossRef][Medline] [Order article via Infotrieve]. 2. Zhang Q, Siebert R, Yan M, et al. Inactivating mutations and overexpression of BCL10, a caspase recruitment domain-containing gene, in MALT lymphoma with t(1;14)(p22;q32). Nat Genet. 1999;22:63-68[CrossRef][Medline] [Order article via Infotrieve].
3.
Du MQ, Peng H, Liu H, et al.
BCL10 gene mutation in lymphoma.
Blood.
2000;95:3885-3890 4. Fakruddin JM, Chaganti RS, Murty VV. Lack of BCL10 mutations in germ cell tumors and B cell lymphomas. Cell. 1999;97:683-684[CrossRef][Medline] [Order article via Infotrieve]. 5. Apostolou S, De Rienzo A, Murthy SS, Jhanwar SC, Testa JR. Absence of BCL10 mutations in human malignant mesothelioma. Cell. 1999;97:684-686[CrossRef][Medline] [Order article via Infotrieve]. 6. Stone JG, Rowan AJ, Tomlinson IP, Houlston RS. Mutations in Bcl10 are very rare in colorectal cancer. Br J Cancer. 1999;80:1569-1570[Medline] [Order article via Infotrieve]. 7. van Schothorst EM, Mohkamsing S, van Gurp RJ, Oosterhuis JW, van der Saag PT, Looijenga LH. Lack of Bcl10 mutations in testicular germ cell tumours and derived cell lines. Br J Cancer. 1999;80:1571-1574[CrossRef][Medline] [Order article via Infotrieve]. 8. Lambers AR, Gumbs C, Ali S, et al. Bcl10 is not a target for frequent mutation in human carcinomas. Br J Cancer. 1999;80:1575-1576[CrossRef][Medline] [Order article via Infotrieve]. 9. Bose S, Goldman JM, Melo JV. Mutations of the BCL10 gene are not associated with the blast crisis of chronic myeloid leukaemia. Leukemia. 1999;13:1894-1896[Medline] [Order article via Infotrieve].
10.
Lee SH, Shin MS, Kim HS, et al.
Point mutations and deletions of the Bcl10 gene in solid tumors and malignant lymphomas.
Cancer Res.
1999;59:5674-5677 11. Luminari S, Intini D, Baldini L, et al. BCL10 gene mutations rarely occur in lymphoid malignancies. Leukemia. 2000;14:905-908[CrossRef][Medline] [Order article via Infotrieve]. 12. Grimwade D, Du MQ, Langabeer S, Rogers J, Solomon E. Screening for mutations of Bcl10 in leukaemia. Br J Haematol. 2000;109:611-615[Medline] [Order article via Infotrieve]. 13. Shih LY, Fu JF, Shurtleff SA, Morris SW, Downing JR. Lack of BCL10 mutations in multiple myeloma and plasma cell leukemia. Genes Chromosomes Cancer. 2001;30:402-406[CrossRef][Medline] [Order article via Infotrieve].
14.
Ye H, Dogan A, Karran L, et al.
BCL10 expression in normal and neoplastic lymphoid tissue: nuclear localization in MALT lymphoma.
Am J Pathol.
2000;157:1147-1154
15.
Baens M, Maes B, Steyls A, Geboes K, Marynen P, De Wolf-Peeters C.
The product of the t(11;18), an API2-MLT fusion, marks nearly half of the gastric MALT type lymphomas without large cell proliferation.
Am J Pathol.
2000;156:1433-1439 16. Telenius H, Nigel PC, Bebb CE, Nordenskjold M, Ponder BAJ, Tunnacliffe A. Degenerate oligonucleotide-primed PCR: general amplification of target DNA by a single degenerate primer. Genomics. 1992;13:718-725[CrossRef][Medline] [Order article via Infotrieve]. 17. Kuukasjarvi T, Tanner M, Pennanen S, Karhu R, Visakorpi T, Isola J. Optimizing DOP-PCR for universal amplification of small DNA samples in comparative genomic hybridization. Genes Chromosomes Cancer. 1997;18:94-101[CrossRef][Medline] [Order article via Infotrieve]. 18. Albert T, Urlbauer B, Kohlhuber F, Hammersen B, Eick D. Ongoing mutations in the N-terminal domain of c-Myc affect transactivation in Burkitt's lymphoma cell lines. Oncogene. 1994;9:759-763[Medline] [Order article via Infotrieve].
19.
Szereday Z, Csernus B, Nagy M, Laszlo T, Warnke RA, Matolcsy A.
Somatic mutation of the 5' noncoding region of the BCL-6 gene is associated with intraclonal diversity and clonal selection in histological transformation of follicular lymphoma.
Am J Pathol.
2000;156:1017-1024 20. Dyer MSJ, Price HP, Jadayel DM, et al. In Response to Fakruddin et al and Apostolou et al [letter]. Cell. 1999;97:686-687[CrossRef]. 21. Apostolou S, Murthy SS, Kolachana P, Jhanwar SC, Testa JR. Absence of post-transcriptional RNA modifications of BCL10 in human malignant mesothelioma and colorectal cancer. Genes Chromosomes Cancer. 2001;30:96-98[Medline] [Order article via Infotrieve]. 22. Duke V, Kapoor A, Gricks C, Melo J, Foroni L. BCL10 deletions in haematological malignancies: a cloning artefact? Br J Haematol. 2000;111:1106-1108[Medline] [Order article via Infotrieve].
23.
Liu H, Ye H, Dogan A, et al.
T(11;18)(q21;q21) is associated with advanced mucosa-associated lymphoid tissue lymphoma that expresses nuclear BCL10.
Blood.
2001;98:1182-1187 24. Uren GA, O'Rourke K, Aravind L, et al. Identification of paracaspases and metacaspases: two ancient families of caspase-like proteins, one of which plays a key role in MALT lymphoma. Mol Cell. 2000;6:961-967[Medline] [Order article via Infotrieve].
25.
Lucas PC, Yonezumi M, Inohara N, et al.
Bcl10 and MALT1, independent targets of chromosomal translocation in MALT lymphoma, cooperate in a novel NF-
26.
Koseki T, Inohara N, Chen S, et al.
CIPER, a novel NF
27.
Yan M, Lee J, Schilbach S, Goddard A, Dixit V.
mE10, a novel caspase recruitment domain-containing proapoptotic molecule.
J Biol Chem.
1999;274:10287-10292 28. Yonezumi M, Takahashi H, Suzuki H, et al. Molecular characterization of API2-MALT1 chimeric product involved in mucosa-associated lymphoid tissue lymphoma [abstract]. Blood. 2000;96:87.
29.
Colussi PA, Harvey NL, Kumar S.
Prodomain-dependent nuclear localization of the caspase-2 (Nedd2) precursor: a novel function for a caspase prodomain.
J Biol Chem.
1998;273:24535-24542
© 2002 by The American Society of Hematology.
| ||||||||||
![]() |
H. Zeng, L. Di, G. Fu, Y. Chen, X. Gao, L. Xu, X. Lin, and R. Wen Phosphorylation of Bcl10 Negatively Regulates T-Cell Receptor-Mediated NF-{kappa}B Activation Mol. Cell. Biol., July 15, 2007; 27(14): 5235 - 5245. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M Bacon, M.-Q. Du, and A. Dogan Mucosa-associated lymphoid tissue (MALT) lymphoma: a practical guide for pathologists J. Clin. Pathol., April 1, 2007; 60(4): 361 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lobry, T. Lopez, A. Israel, and R. Weil Negative feedback loop in T cell activation through I{kappa}B kinase-induced phosphorylation and degradation of Bcl10 PNAS, January 16, 2007; 104(3): 908 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
M-Q Du and J C Atherton Molecular subtyping of gastric MALT lymphomas: implications for prognosis and management. Gut, June 1, 2006; 55(6): 886 - 893. [Full Text] [PDF] |
||||
![]() |
X. Sagaert, P. de Paepe, L. Libbrecht, V. Vanhentenrijk, G. Verhoef, J. Thomas, I. Wlodarska, and C. De Wolf-Peeters Forkhead Box Protein P1 Expression in Mucosa-Associated Lymphoid Tissue Lymphomas Predicts Poor Prognosis and Transformation to Diffuse Large B-Cell Lymphoma J. Clin. Oncol., June 1, 2006; 24(16): 2490 - 2497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Baens, S. Fevery, X. Sagaert, H. Noels, S. Hagens, V. Broeckx, A. D. Billiau, C. De Wolf-Peeters, and P. Marynen Selective Expansion of Marginal Zone B Cells in E{micro}-API2-MALT1 Mice Is Linked to Enhanced I{kappa}B Kinase {gamma} Polyubiquitination. Cancer Res., May 15, 2006; 66(10): 5270 - 5277. [Abstract] |