| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From the Department of Pathology, Stanford University
School of Medicine, Stanford, CA.
Efficient antigen presentation and T-cell priming are essential
components of effective antitumor immunity. Dendritic cells are
critical to both of these functions but to date no method has been
devised that both targets antigen to these cells and activates them, in
situ, in a manner that induces systemic immunity. In this study we
combined a dendritic cell growth factor, Flt3 ligand, with a dendritic
cell activator, immunostimulatory DNA, and a tumor antigen to activate
and load dendritic cells in vivo. Initial studies showed that
immunostimulatory DNA not only activates dendritic cells but also
prolongs their survival in vivo and in vitro. Following treatment of
mice with Flt3 ligand, coadministration of immunostimulatory DNA and
antigen induced potent antitumor immunity, resulting in both tumor
prevention and regression of existing tumors. CD8 cytotoxic T
lymphocytes but not CD4 T cells were required for tumor protection.
Natural killer cells also contributed to tumor protection. These
results show that dendritic cells can be loaded with antigen and
activated, in situ, and provide the basis for dendritic cell- targeted
clinical strategies.
(Blood. 2002;99:1676-1682) Dendritic cells (DCs) represent the most potent
antigen-presenting cells (APCs) capable of inducing immunity to newly
introduced antigen (Ag).1,2 DCs reside as immature cells
in peripheral tissues where they continuously take up and process Ag.
When activated, Ag-loaded DCs migrate to the draining lymph nodes where
they can prime Ag-specific CD4 and CD8 T cells. Multiple factors
contribute to the failure of DCs to prime effective antitumor response
in tumor-bearing hosts: the low number of DCs available in the tumor site, poor access of DCs to tumor Ag, the limited capacity of tumor
cells to activate intratumoral DCs,3-5 and secretion by the tumor cells of factors that inhibit DC maturation.6-8
Interestingly, in these studies T cells isolated from tumor-bearing
hosts were able to respond normally to various Ags in vitro if
stimulated with mature, functional DCs.7,9 Moreover,
professional APCs such as DCs or tumor cells10 engineered
to stimulate immunity can generate an effective antitumor immune
response in vivo,11,12 suggesting again that efficient Ag
presentation is critical in tumor immunotherapy.
Dendritic cells can be used as therapeutic cancer
vaccines.13 A variety of preparations of DCs can stimulate
antitumor immunity, including DCs loaded with proteins, DCs fused with
tumor cells, and DCs transduced with tumor-derived RNA or viral
vectors. At present, all of these approaches rely on ex vivo
manipulation of isolated DCs to produce the vaccine. Recently,
administration of a bone marrow growth factor, Flt3 ligand (FL), has
been shown to expand in vivo the numbers of DCs in lymph nodes, spleen,
and other tissues.14 However, a significant proportion of
the FL-mobilized DCs are immature and not efficient in inducing
Ag-specific T-cell responses. We therefore focused on developing an
approach to activate these mobilized DCs in situ, with the goal of
determining whether such an approach can induce effective Ag-specific immunity.
Although various DC maturation factors have been described (eg, tumor
necrosis factor- Animals
Cytokines and media
Ag and adjuvants Ovalbumin protein (OVA) was purchased from Sigma (St Louis, MO). Endotoxin contamination of OVA was removed by a phase separation technique using the detergent Triton X-114 (kindly provided by Dr J. Timmerman, Stanford University, Stanford, CA) such that endotoxin levels were undetectable by limulus amebocyte lysate assay. Complete Freund adjuvant (CFA) was purchased from DIFCO (Detroit, MI). Phosphorothioate-stabilized oligonucleotides were synthesized by Oligos Etc. (Wilsonville, OR). The oligonucleotide sequence bearing ISS was TCCATGACGTTCCTGACGTT; the sequence of the non-ISS control oligonucleotide (C-ODN) was TCCAGGACTTTCCTCAGGTT. All oligonucleotides were reconstituted in sterile pyrogen-free water.Antibodies and flow cytometry Cell preparations were preincubated with anti-CD32/16 to minimize nonspecific binding. Three-color analyses were performed on a FACSCalibur (Becton Dickinson, Mountain View, CA). Mouse monoclonal antibodies (MoAbs) to IA-b (Af6-120.1; IgG2a), B-220 (RA3-6B2; IgG2a), CD3 (145-2C11; IgG1), CD4 (GK1.5; IgG2b), CD8 (Ly-2; IgG2a), CD11c
(HL3; IgG1), CD16/CD32 (2.4G2; IgG2b), CD28 (37.51; IgG2), CD54 (3E2,
IgG1), CD80 (16-10A1, IgG2), CD86 (GL1; IgG2a), IL-2 (JES6-5H4, IgG),
interferon- (IFN- ; XMG1.2, IgG), leukocyte function-associated
antigen 1 (LFA-1) (2D7, IgG2a), natural killer 1.1 (NK1.1) (PK136,
IgG2a), T-cell receptor (TCR ) chain (H57-597; IgG2), isotype
controls, and the second-step antibodies (APC-conjugated streptavidin,
phycoerythrin [PE]-conjugated goat anti-rabbit IgG) were purchased
from Pharmingen (San Diego, CA).
Tumor cell lines B16-OVA is an OVA-transfected clone derived from the murine melanoma cell line B16.17 The tumor cell line was cultured in vitro in CM in the presence of geniticin (2 mg/mL) and hygromicin B (60 µg/mL). The lymphoma tumor cell line EL4 was purchased from the American Type Tissue Collection (ATCC, Rockville, MD). EG7 is an OVA-transfected subclone of EL-4,18 kindly provided by Dr M. Bevan (University of Washington, Seattle, WA), and was cultured in CM in the presence of geniticin (2 mg/mL).Immunization protocols FL (10 µg in 200 µL PBS) was administered intraperitoneally (IP) daily for 9 days. Control mice were injected in the same manner with PBS. In addition to the last FL injection, mice received where indicated, a single subcutaneous (SC) injection of OVA (300 µg), ISS (30 µg), ISS or C-ODN mixed with OVA (300 µg), or CFA mixed with OVA (300 µg).Isolation of secondary lymphoid organs Spleen and draining popliteal and inguinal lymph nodes were harvested and injected with collagenase D (1 mg/mL; Boehringer-Mannheim, Mannheim, Germany) in RPMI and 10% FCS for 20 minutes at 37°C. Digested lymph nodes or spleen were filtered through a stainless-steel sieve, and the cell suspension washed twice in PBS and 5% FCS. Where indicated DCs were isolated from the total lymph nodes or spleen cells using anti-CD11c-microbeads (Miltenyi Biotech, Auburn, CA). The purity of the DC population after sorting was more than 98% based on their coexpression of class II and CD11c antigens. Where indicated CD11c+ cells were cultured overnight in CM in addition to GM-CSF (10 ng/mL) in the presence or absence of ISS (10 µg/mL) or C-ODN (10 µg/mL).Cytokine profile of ISS-activated DCs in vitro Dendritic cells were isolated from the spleen of FL-treated mice using anti-CD11c magnetic beads as described above and cultured overnight in CM in addition to GM-CSF (10 ng/mL) in the presence or absence of ISS (10 µg/mL) or C-ODN (10 µg/mL). At the end of the culture, cytokine (IL-12, IFN- , and TNF- ) secretion in the supernatant was analyzed by enzyme-linked immunosorbent assay (ELISA).
Allogeneic T-cell stimulation Graded numbers of DCs isolated from the lymph nodes of immunized or nonimmunized C57BL/6 mice were irradiated (3000 rads), and added to allogeneic (Balb/c) spleen cells (2 × 105 /well) in a final volume of 0.2 mL in 96-well flat-bottom plates (Costar, Corning, NY). IFN- in the supernatant was measured by ELISA after 4 days of
coculture. Cell proliferation was measured by adding 1 µCi (0.037 MBq) [3H]-thymidine after 3 days. The cells were
harvested 16 to 18 hours later and counted in a Microbeta counter
(Wallac, Gaithersburg, MD). Results are presented as the mean of
triplicate cultures ± SEM.
Natural killer cell activation NK cells were isolated from the spleen using magnetic beads. Briefly, spleen cells were stained with biotin-conjugated MoAb to NK1.1 and labeled cells were then selected with streptavidin microbeads. Two rounds of positive selection were applied to ensure more than 98% NK cell purity. Purified FL mobilized DCs were isolated from spleen and cultured overnight in the presence or absence of ISS (10 µg/mL) or C-ODN (10 µg/mL). The DCs were then cultured in the presence of NK1.1+ cells at a ratio of 1:1 for 24 hours. In parallel, NK1.1+ cells were cultured in the presence of ISS (10 µg/mL), C-ODN (10 µg/mL), or medium alone for 24 hours. The cultured NK cells were incubated at different ratios with 51Cr-labeled YAC-1 cells for 4 hours before measuring their cytolytic activity based on a 51Cr release assay.DC viability assay A modification of the protocol of Inaba et al19 was used to generate bone marrow-derived DCs (BM-DCs). Briefly, BM cells were incubated at 1 × 105 cells/mL in CM in the presence of GM-CSF (5 ng/mL), and IL-4 (5 ng/mL). The supernatant was removed at day 2 and replaced with fresh medium and cytokines. At day 4 the cells were centrifuged and resuspended in fresh medium and cytokines for 2 to 3 more days. At the end of the culture CD11c+ DCs were isolated using anti-CD11c-microbeads, washed, and cultured in CM without any additional cytokines in the presence or absence of 10 µg/mL ISS or C-ODN. One, 4, and 7 days later, cell proliferation was measured by adding 1 µCi (0.037 MBq) [3H]-thymidine as described above. CD11c+ DCs and BM cells cultured for 4 days in GM-CSF and IL-4 were used as controls for cell proliferation assays. Cell numbers were counted daily using trypan blue exclusionLymph node cell activation after Ag restimulation in vitro C57BL/6 mice were immunized with FL (9 daily injections) in addition to OVA (300 µg) alone or in association with ISS or C-ODN (30 µg). Control groups were immunized with OVA (300 µg) alone. At 7, 12, and 18 days after immunization, cells isolated from the draining lymph nodes were restimulated in the presence or absence of ovalbumin257-264 (10 µg/mL) and anti-CD28 (1 µg/mL) for 8 hours in addition to brefeldin (10 µg/mL; Sigma) and analyzed for intracellular cytokine secretion by flow cytometry. Simultaneously, lymph node cells were cultured in the presence of different concentrations of OVA and cell proliferation was measured by adding at day 3, 1 µCi (0.037 MBq) [3H]-thymidine. At 16 to 18 hours later, cells were harvested and the incorporated thymidine counted in a Microbeta counter.Cytokine measurements Cytokines present in the supernatant were quantified by ELISA as described elsewhere.20 For intracellular cytokine detection, cells were stained for surface membrane Ag as described above, washed extensively, and then permeabilized using Cytofix/Cytoperm (Pharmingen) for 20 minutes on ice. Permeabilized cells were resuspended in Perm Wash buffer (Pharmingen) and stained with anti-IFN- or anti-IL-2 antibodies.
Tumor experiments Tumor cells (1 × 104) in 0.1 mL PBS were injected SC into mice. In the tumor protection experiments, mice received a tumor challenge 1 week after the completion of the therapy. To explore whether the treatment had induced a memory response against melanoma cells, mice that were still alive 6 weeks following the tumor challenge were rechallenged SC with the same dose of tumor cells without any further treatment. In the tumor therapy experiments, mice were first challenged with tumor cells and received the first FL injection 3 days later followed by immunization with ISS or C-ODN (30 µg) and OVA (300 µg). Mice were examined twice a week for the presence of tumors. Tumor size represents the product of 2 perpendicular diameters. As per protocol, mice were killed when tumors reached 20 mm in their largest dimension or when ulceration or bleeding or both developed.Tumor experiments in lymphocyte-depleted mice Following the same treatment schedule described in the tumor protection experiment, groups of 8 mice were injected IP with 0.5 mg anti-CD4 (GK1.5), anti-CD8 (2.43), or anti-NK cell (PK136) antibody 3 times at 2-day intervals and then weekly for the duration of the experiment. Where indicated anti-CD4 antibody injection was started 6 days before the first FL injection, or 24 hours after immunization with ISS plus Ag. Anti-CD8 antibody and NK antibody treatments started 24 hours after immunization. Lymphocyte depletion was confirmed in each depletion experiment by FACS analysis of peripheral blood 10 and 30 days following antibody treatment and showed less than 0.2% CD4+ cells, less than 0.02% CD8+ cells, and less than 0.3% NK+ cells, respectively. In mice treated with anti-CD8 there was no change in the number of IA-b+, CD11c+, DEC205hi, and CD11blow cells in the spleen and lymph nodes, suggesting that CD8+ DCs were not affected by the anti-CD8 antibody.Statistical analyses The Kaplan-Meier plot for tumor survival was assessed for significance with the Mantel-Cox test (StatView, SAS Institute, Cary, NC).
ISS can activate FL-mobilized DCs in situ Although FL administration can expand DCs in vivo, most of these DCs are not fully mature. We evaluated the capacity of ISS to activate FL-mobilized DCs (FL-DCs) in vitro. After 9 days of FL administration to mice, CD11c+ DCs were harvested from spleen and cultured for 18 hours with or without ISS. ISS-treated CD11c+ DCs had an increase in their surface expression of major histocompatibility complex (MHC) class II molecules, as well as the costimulatory molecules CD80 and CD86 and the adhesion molecule CD54 (Figure 1A), and secreted higher levels of IL-12 and IFN- compared to C-ODN-treated DCs and unstimulated DCs (Figure
1B). ISS administration also increased the immunostimulatory capacity
of DCs as shown by their ability to induce allogeneic T-cell
proliferation and IFN- secretion compared to DCs obtained from
untreated animals or animals treated with FL either alone or in
association with C-ODN (Figure 1C-D). Because ISS was initially
described as a strong NK cell activator, we explored the effect of ISS
as well as ISS-treated FL-DCs on a highly purified population of NK
cells. As shown in Figure 1E, ISS did not activate NK cells directly but dramatically enhanced the capacity of FL-DCs to activate these cells.
To test the ability of ISS to activate FL-DCs in vivo, mice were
injected with FL for 9 consecutive days and, on the final day, were
also given a single SC injection of either ISS, a similar oligonucleotide (C-ODN) that lacks the CpG motif, or PBS. Forty-eight hours later, DCs within the draining lymph nodes were assessed phenotypically. The percentage of mature DCs expressing high levels of
MHC class II molecules and costimulatory molecules such as CD86 was
higher in mice treated with both FL and ISS than mice treated with FL
alone (Figure 2A). The effect of ISS on
FL-DC maturation was localized to the draining lymph nodes because the phenotype of DCs in the contralateral lymph node was unaffected (data
not shown).
To determine the duration of the ISS effect, DCs within the draining lymph nodes were enumerated and analyzed by flow cytometry at 1, 7, 12, and 18 days after treatment. At day 1, the number of DCs was similar in all FL-treated groups (Figure 2B). In contrast, at days 7, 12, and 18, the number of DCs was 39, 14, and 7 times greater in mice treated with FL and ISS, respectively, compared to PBS-treated mice. In animals treated with FL alone the number of DCs was only 6 times above baseline at day 7 and returned to baseline by day 12. Furthermore, the number of DCs that expressed high levels of MHC class II, CD86, CD54, and LFA-1 was significantly greater at day 7 in mice treated with FL and ISS compared to mice treated with FL alone (Figure 2C). This effect persisted for more than 18 days after treatment (data not shown). Additional studies suggested that the persistence of DCs in ISS-treated animals may be due to a direct effect of ISS on DC viability (Figure 2D). Thus, when purified DCs were cultured in the absence of ISS, the vast majority died by day 5. In contrast, more than 50% of ISS-activated DCs were still alive on day 11. This effect was not due to an increase of cellular proliferation induced by ISS, because proliferation analyzed at days 1, 4, and 7 was similar in ISS, C-ODN, and untreated cells (data not shown). ISS increases CD4 and CD8 T-cell responses to Ag in vivo in FL-treated mice Because ISS activates DCs in vitro and in vivo, we sought to determine whether ISS could increase the capacity of FL-DCs to prime T-cell immunity by injecting a mixture of Ag (OVA) and ISS into FL-treated mice (Figure 3A). The combined treatment was well tolerated and no sign of clinical toxicity or autoimmunity was observed. As shown in Figure 3, panels B and C, the combination of DC mobilization with DC activation at the site of Ag administration dramatically enhanced the induction of both CD4 and CD8 T-cell immunity, based on measurement of lymph node cell proliferation in response to soluble OVA and IFN- secretion by CD8 T cells. OVA-specific CD8 T cells could be detected in draining lymph nodes more
than 3 weeks after the immunization.
Ag loading and ISS activation of FL-mobilized DCs induce tumor-specific immunity Next, we explored whether the enhanced immunity induced with this combined treatment could protect mice against a lethal tumor challenge (Figure 4A). As shown in Figure 4B, 100% of the mice treated with FL plus ISS plus OVA survived without developing any tumors compared to only 20% of mice treated with FL plus OVA alone or FL plus OVA plus C-ODN (Figure 4B). None of the mice treated with OVA plus ISS without FL, with OVA plus CFA, or with OVA alone survived the tumor challenge (Figure 4B and data not shown). Also, 80% of the mice that were initially treated with FL, ISS, and OVA survived a second tumor challenge without any additional immunization indicating that a memory antitumor immune response had been induced by the first treatment (Figure 4B).
To determine if the combination of FL, ISS, and Ag can induce regression of existing tumors, we established melanoma tumors in mice for 3 days before starting the daily FL injections (Figure 4C). Twelve days following injection of tumor, mice were immunized with OVA with or without ISS. Sixty percent of the mice treated with both FL mobilization and OVA plus ISS survived without developing detectable tumors (Figure 4D-E). In contrast, less than 20% of the mice treated with OVA plus ISS without FL, or FL plus OVA without ISS, and none of the mice treated with OVA plus CFA or OVA alone, were free of tumor (Figure 4D-E and data not shown). Administration of OVA in association with ISS and FL was always required to induce tumor regression (Figure 4D-E). CD8 T cells and NK cells mediate the antitumor effect of FL, Ag, and ISS To identify the effector cells responsible for the observed antitumor effect, mice were depleted of T-cell subsets or NK cells before or after immunization (Figure 5A). CD8 T cells were required for tumor protection as depletion of these cells before immunization abrogated this effect (Figure 5B). By contrast, ISS-activated DCs did not require CD4 T cells either as effectors or helpers to induce Ag-specific CD8 T cells because mice depleted of CD4 lymphocytes before treatment and immunization could still reject the tumor challenge. NK cells also appear to play an important role in the tumor protection induced by ISS and Ag following FL mobilization, because 50% of mice depleted of NK cells succumbed to tumor challenge (Figure 5B).
The capacity of DCs to prime Ag-specific immunity relies on both their access to relevant Ag and their state of activation.1,21,22 In this study we demonstrated that DCs can be manipulated in vivo such that both parameters are enhanced. However, to induce effective antitumor immunity, increasing DC availability through in vivo expansion and activation of these DCs at sites where Ag is present are both required. In these studies FL provided a critical growth stimulus for DCs, directing sufficient numbers of these cells to peripheral tissues to enable local delivery of Ag and ISS. The failure of FL alone to induce an antitumor response contrasts with a prior report.23 However, the latter study used slow-growing tumors rather than aggressive and poorly immunogenic tumors such as the B-16 melanoma used here. Our results are also in contrast to the results reported by Pulendran and coworkers demonstrating that FL can be used as a vaccine adjuvant.24 This study, however, was performed with TCR transgenic mice in which the predominant population of T-cell precursors is specific for the target Ag. Our study was performed in nontransgenic animals with diverse T-cell repertoires. In this setting, FL-expanded DCs may not efficiently prime the low frequency (< 0.01%) of relevant T-cell precursors, a setting typical of clinical situations. ISS strongly activated FL-DCs in vitro and in vivo. Interestingly, we found that ISS dramatically increases the persistence of mature DCs in FL-treated animals. One potential explanation for this persistence is that DCs simply survive longer after their exposure to ISS, which was confirmed in the in vitro experiments. Although DCs deprived of cytokines and cultured without ISS died in 4 days, a significant proportion of DCs cultured with ISS survived beyond 11 days. The possibility exists that continuous migration of DCs from the periphery to draining lymph nodes25 contributed to the high numbers of DCs in the lymph nodes of mice treated with FL and ISS. Nevertheless, these DCs continue to stimulate Ag-specific T cells within the lymph nodes even 3 weeks after treatment with ISS and Ag. The combination of DC mobilization with DC activation at the site of Ag
administration dramatically enhanced the induction of systemic T-cell
immunity. Thus, the number of Ag-specific CD4 and CD8 T cells as
evidenced by T-cell proliferation and IFN- To determine whether the potent, persistent Th1 response induced by FL followed by ISS and Ag could induce effective antitumor immunity, we used an aggressive B16 melanoma tumor line that had been engineered to express OVA as the target tumor Ag. The combination of FL mobilization followed by ISS activation of DC in the presence of OVA induced a protective antitumor response and also led to regression of established tumors. CD8 T cells were required for tumor protection because depletion of these cells before immunization abrogated this effect. By contrast, ISS-activated DCs did not require CD4 T cells either as effectors or helpers to induce Ag-specific CD8 T cells because mice depleted of CD4 lymphocytes before treatment and immunization could still reject tumor challenge. These results are consistent with recent findings showing that vaccination with ISS and Ag was able to induce a similar level of Ag-specific CD8 cytotoxic T lymphocyte-mediated response29 and to confer a similar level of tumor protection in CD4 wild-type and knock-out mice.30 These results suggest that similar to viruses, double-stranded RNA, and CD40L, ISS is able to "license" DCs to directly prime CD8 T cells.30-32 Although CD4 T cells were not required for CD8 priming, CD4 help clearly enhanced priming because 40% of the CD4-depleted mice still succumbed to tumor challenge. The NK cells also played an important role in the tumor protection
provided by FL, ISS, and Ag, because 50% of mice depleted of NK cells
succumbed to tumor challenge. FL treatment can induce modest NK cell
proliferation, but does not induce NK activation.33 In
addition, FL-deficient mice have a striking defect in NK cell function,34 suggesting a major role for FL in NK cell
development and maturation. ISS failed to activate NK directly.
However, ISS increased the capacity of FL-DCs to activate NK cells.
This effect does not rely on cell-cell contact because similar results
were obtained when the cells were cocultured on opposite sides of a porous membrane (data not shown). As shown in Figure 1B, ISS-stimulated DCs secreted large amounts of IL-12 and IFN- Although ISS can strongly activate B cells,36 FL neither activates B cells nor induces mobilization of mature B cells into the periphery.14 Because, in our studies, FL was absolutely required for any antitumor efficacy, it seems unlikely that B cells played a significant role in this effect. It is important to note that in the absence of exogenously administered tumor Ag, FL and ISS did not lead to tumor rejection indicating that the mechanism responsible for the antitumor effect is Ag specific. This also indicates that FL-mobilized DCs either do not reach a critical number in the tumor sites or are not activated in such sites. Specifically recruiting DCs to tumor sites and then activating them with ISS would be a potential approach to overcome the need for Ag immunization. In summary, we described an effective method of inducing DCs to prime an Ag- specific response in vivo without the requirement of DC manipulation ex vivo. Our study demonstrates the immunotherapeutic potential of combining FL with ISS and Ag treatment for induction of a strong cell-mediated immune response against tumor Ag. These findings provide the basis for human trials to test the efficacy of combining DC mobilization with DC activation and Ag delivery in situ for clinical immunotherapy.
We thank Claudia Benike for critical review of the manuscript and Donna Jones for formatting the manuscript.
Submitted June 8, 2001; accepted October 11, 2001.
Supported, in part, by grants from the National Institutes of Health (CA71725, HL57443, and CA72103), and from the Tobacco Related Disease Research Program of the University of California (9RT-0229) L.F. was supported by a physician-scientist award from the National Cancer Institute (K23 CA82584-01).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Edgar G. Engelman, Stanford Blood Center, 800 Welch Rd, Palo Alto, CA 94304; e-mail: edengleman{at}stanford.edu.
1. Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol. 2000;18:767-811[CrossRef][Medline] [Order article via Infotrieve]. 2. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245-252[CrossRef][Medline] [Order article via Infotrieve]. 3. Nestle FO, Burg G, Fah J, Wrone-Smith T, Nickoloff BJ. Human sunlight-induced basal-cell-carcinoma-associated dendritic cells are deficient in T cell co-stimulatory molecules and are impaired as antigen-presenting cells. Am J Pathol. 1997;150:641-651[Abstract]. 4. Enk AH, Jonuleit H, Saloga J, Knop J. Dendritic cells as mediators of tumor-induced tolerance in metastatic melanoma. Int J Cancer. 1997;73:309-316[CrossRef][Medline] [Order article via Infotrieve]. 5. Thurnher M, Radmayr C, Ramoner R, et al. Human renal-cell carcinoma tissue contains dendritic cells. Int J Cancer. 1996;68:1-7[CrossRef][Medline] [Order article via Infotrieve].
6.
Menetrier-Caux C, Montmain G, Dieu MC, et al.
Inhibition of the differentiation of dendritic cells from CD34(+) progenitors by tumor cells: role of interleukin-6 and macrophage colony-stimulating factor.
Blood.
1998;92:4778-4791 7. Gabrilovich DI, Corak J, Ciernik IF, Kavanaugh D, Carbone DP. Decreased antigen presentation by dendritic cells in patients with breast cancer. Clin Cancer Res. 1997;3:483-490[Abstract]. 8. Gabrilovich DI, Chen HL, Girgis KR, et al. Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. Nat Med. 1996;2:1096-1103[CrossRef][Medline] [Order article via Infotrieve]. 9. Hanson HL, Donermeyer DL, Ikeda H, et al. Eradication of established tumors by CD8+ T cell adoptive immunotherapy. Immunity. 2000;13:265-276[CrossRef][Medline] [Order article via Infotrieve]. 10. Pardoll DM. Paracrine cytokine adjuvants in cancer immunotherapy. Annu Rev Immunol. 1995;13:399-415[CrossRef][Medline] [Order article via Infotrieve].
11.
Zitvogel L, Mayordomo JI, Tjandrawan T, et al.
Therapy of murine tumors with tumor peptide-pulsed dendritic cells: dependence on T cells, B7 costimulation, and T helper cell 1-associated cytokines.
J Exp Med.
1996;183:87-97
12.
Celluzzi CM, Mayordomo JI, Storkus WJ, Lotze MT, Falo LD Jr.
Peptide-pulsed dendritic cells induce antigen-specific CTL-mediated protective tumor immunity.
J Exp Med.
1996;183:283-287 13. Fong L, Engleman EG. Dendritic cells in cancer immunotherapy. Annu Rev Immunol. 2000;18:245-273[CrossRef][Medline] [Order article via Infotrieve].
14.
Maraskovsky E, Brasel K, Teepe M, et al.
Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified.
J Exp Med.
1996;184:1953-1962 15. Hemmi H, Takeuchi O, Kawai T, et al. A Toll-like receptor recognizes bacterial DNA. Nature. 2000;408:740-745[CrossRef][Medline] [Order article via Infotrieve]. 16. Hogquist KA, Jameson SC, Heath WR, Howard JL, Bevan MJ, Carbone FR. T cell receptor antagonist peptides induce positive selection. Cell. 1994;76:17-27[CrossRef][Medline] [Order article via Infotrieve]. 17. Mayordomo JI, Zorina T, Storkus WJ, et al. Bone marrow-derived dendritic cells pulsed with synthetic tumour peptides elicit protective and therapeutic antitumour immunity. Nat Med. 1995;1:1297-1302[CrossRef][Medline] [Order article via Infotrieve]. 18. Moore MW, Carbone FR, Bevan MJ. Introduction of soluble protein into the class I pathway of antigen processing and presentation. Cell. 1988;54:777-785[CrossRef][Medline] [Order article via Infotrieve].
19.
Inaba K, Inaba M, Romani N, et al.
Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor.
J Exp Med.
1992;176:1693-1702
20.
Merad M, Fong L, Bogenberger J, Engleman EG.
Differentiation of myeloid dendritic cells into CD8alpha-positive dendritic cells in vivo.
Blood.
2000;96:1865-1872
21.
Jonuleit H, Schmitt E, Schuler G, Knop J, Enk AH.
Induction of interleukin 10-producing, nonproliferating CD4(+) T cells with regulatory properties by repetitive stimulation with allogeneic immature human dendritic cells.
J Exp Med.
2000;192:1213-1222
22.
Dhodapkar MV, Steinman RM, Krasovsky J, Munz C, Bhardwaj N.
Antigen-specific inhibition of effector T cell function in humans after injection of immature dendritic cells.
J Exp Med.
2001;193:233-238 23. Lynch DH, Andreasen A, Maraskovsky E, Whitmore J, Miller RE, Schuh JC. Flt3 ligand induces tumor regression and antitumor immune responses in vivo. Nat Med. 1997;3:625-631[CrossRef][Medline] [Order article via Infotrieve].
24.
Pulendran B, Smith JL, Jenkins M, Schoenborn M, Maraskovsky E, Maliszewski CR.
Prevention of peripheral tolerance by a dendritic cell growth factor: flt3 ligand as an adjuvant.
J Exp Med.
1998;188:2075-2082
25.
Ban E, Dupre L, Hermann E, et al.
CpG motifs induce Langerhans cell migration in vivo.
Int Immunol.
2000;12:737-745 26. Wagner H. Bacterial CpG DNA activates immune cells to signal infectious danger. Adv Immunol. 1999;73:329-368[Medline] [Order article via Infotrieve]. 27. Kranzer K, Bauer M, Lipford GB, Heeg K, Wagner H, Lang R. CpG-oligodeoxynucleotides enhance T-cell receptor-triggered interferon-gamma production and up-regulation of CD69 via induction of antigen-presenting cell-derived interferon type I and interleukin-12. Immunology. 2000;99:170-178[CrossRef][Medline] [Order article via Infotrieve]. 28. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999;401:708-712[CrossRef][Medline] [Order article via Infotrieve]. 29. Sparwasser T, Vabulas RM, Villmow B, Lipford GB, Wagner H. Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent cytotoxic T cell responses to soluble proteins. Eur J Immunol. 2000;30:3591-3597[CrossRef][Medline] [Order article via Infotrieve]. 30. Cho HJ, Takabayashi K, Cheng PM, et al. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism. Nat Biotechnol. 2000;18:509-514[CrossRef][Medline] [Order article via Infotrieve]. 31. Ridge JP, Di Rosa F, Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature. 1998;393:474-478[CrossRef][Medline] [Order article via Infotrieve]. 32. Bennett SR, Carbone FR, Karamalis F, Flavell RA, Miller JF, Heath WR. Help for cytotoxic-T-cell responses is mediated by CD40 signaling. Nature. 1998;393:478-480[CrossRef][Medline] [Order article via Infotrieve].
33.
Shaw SG, Maung AA, Steptoe RJ, Thomson AW, Vujanovic NL.
Expansion of functional NK cells in multiple tissue compartments of mice treated with Flt3-ligand: implications for anti-cancer and anti- viral therapy.
J Immunol.
1998;161:2817-2824
34.
McKenna HJ, Stocking KL, Miller RE, et al.
Mice lacking flt3 ligand have deficient hematopoiesis affecting hematopoietic progenitor cells, dendritic cells, and natural killer cells.
Blood.
2000;95:3489-3497 35. Ballas ZK, Rasmussen WL, Krieg AM. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol. 1996;157:1840-1845[Abstract]. 36. Krieg AM, Yi AK, Matson S, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995;374:546-549[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
P. Cerkovnik, B. Jezersek Novakovic, V. Stegel, and S. Novakovic Class C CpG oligodeoxynucleotides as a single agent and in combination with radiotherapy efficiently delayed growth of subcutaneous B16F1 tumors Innate Immunity, October 1, 2009; 15(5): 313 - 321. [Abstract] [PDF] |
||||
![]() |
M. L. Salem, C. M. Diaz-Montero, A. A. Al-Khami, S. A. El-Naggar, O. Naga, A. J. Montero, A. Khafagy, and D. J. Cole Recovery from Cyclophosphamide-Induced Lymphopenia Results in Expansion of Immature Dendritic Cells Which Can Mediate Enhanced Prime-Boost Vaccination Antitumor Responses In Vivo When Stimulated with the TLR3 Agonist Poly(I:C) J. Immunol., February 15, 2009; 182(4): 2030 - 2040. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Taylor, M. J. Ehrhardt, C. J. Lees, A. Panoskaltsis-Mortari, A. M. Krieg, A. H. Sharpe, W. J. Murphy, J. S. Serody, H. Hemmi, S. Akira, et al. TLR agonists regulate alloresponses and uncover a critical role for donor APCs in allogeneic bone marrow rejection Blood, October 15, 2008; 112(8): 3508 - 3516. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ginhoux, M. P. Collin, M. Bogunovic, M. Abel, M. Leboeuf, J. Helft, J. Ochando, A. Kissenpfennig, B. Malissen, M. Grisotto, et al. Blood-derived dermal langerin+ dendritic cells survey the skin in the steady state J. Exp. Med., December 24, 2007; 204(13): 3133 - 3146. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bogunovic, F. Ginhoux, A. Wagers, M. Loubeau, L. M. Isola, L. Lubrano, V. Najfeld, R. G. Phelps, C. Grosskreutz, E. Scigliano, et al. Identification of a radio-resistant and cycling dermal dendritic cell population in mice and men J. Exp. Med., November 27, 2006; 203(12): 2627 - 2638. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hollenbaugh and R. W. Dutton IFN-{gamma} Regulates Donor CD8 T Cell Expansion, Migration, and Leads to Apoptosis of Cells of a Solid Tumor. J. Immunol., September 1, 2006; 177(5): 3004 - 3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wakita, K. Chamoto, Y. Zhang, Y. Narita, D. Noguchi, H. Ohnishi, T. Iguchi, T. Sakai, H. Ikeda, and T. Nishimura An indispensable role of type-1 IFNs for inducing CTL-mediated complete eradication of established tumor tissue by CpG-liposome co-encapsulated with model tumor antigen Int. Immunol., March 1, 2006; 18(3): 425 - 434. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Okano, M. Merad, K. Furumoto, and E. G. Engleman In Vivo Manipulation of Dendritic Cells Overcomes Tolerance to Unmodified Tumor-Associated Self Antigens and Induces Potent Antitumor Immunity J. Immunol., March 1, 2005; 174(5): 2645 - 2652. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chagnon, S. Tanguay, O. L. Ozdal, M. Guan, Z. Z. Ozen, J.-S. Ripeau, M. Chevrette, M. M. Elhilali, and L. A. Thompson-Snipes Potentiation of a Dendritic Cell Vaccine for Murine Renal Cell Carcinoma by CpG Oligonucleotides Clin. Cancer Res., February 1, 2005; 11(3): 1302 - 1311. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. O'Neill, S. Adams, and N. Bhardwaj Manipulating dendritic cell biology for the active immunotherapy of cancer Blood, October 15, 2004; 104(8): 2235 - 2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Marshall, E. M. Hessel, J. Gregorio, C. Abbate, P. Yee, M. Chu, G. V. Nest, R. L. Coffman, and K. L. Fearon Novel chimeric immunomodulatory compounds containing short CpG oligodeoxyribonucleotides have differential activities in human cells Nucleic Acids Res., September 1, 2003; 31(17): 5122 - 5133. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Pabst, A. Luhrmann, I. Steinmetz, and T. Tschernig A Single Intratracheal Dose of the Growth Factor Fms-Like Tyrosine Kinase Receptor-3 Ligand Induces a Rapid Differential Increase of Dendritic Cells and Lymphocyte Subsets in Lung Tissue and Bronchoalveolar Lavage, Resulting in an Increased Local Antibody Production J. Immunol., July 1, 2003; 171(1): 325 - 330. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Miller, V. G. Pillarisetty, A. B. Shah, S. Lahrs, and R. P. DeMatteo Murine Flt3 Ligand Expands Distinct Dendritic Cells with Both Tolerogenic and Immunogenic Properties J. Immunol., April 1, 2003; 170(7): 3554 - 3564. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sailaja, S. Husain, B. P. Nayak, and A. M. Jabbar Long-Term Maintenance of gp120-Specific Immune Responses by Genetic Vaccination with the HIV-1 Envelope Genes Linked to the Gene Encoding Flt-3 Ligand J. Immunol., March 1, 2003; 170(5): 2496 - 2507. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Miller, V. G. Pillarisetty, A. B. Shah, S. Lahrs, Z. Xing, and R. P. DeMatteo Endogenous Granulocyte-Macrophage Colony-Stimulating Factor Overexpression In Vivo Results in the Long-Term Recruitment of a Distinct Dendritic Cell Population with Enhanced Immunostimulatory Function J. Immunol., September 15, 2002; 169(6): 2875 - 2885. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Vicari, C. Chiodoni, C. Vaure, S. Ait-Yahia, C. Dercamp, F. Matsos, O. Reynard, C. Taverne, P. Merle, M. P. Colombo, et al. Reversal of Tumor-induced Dendritic Cell Paralysis by CpG Immunostimulatory Oligonucleotide and Anti-Interleukin 10 Receptor Antibody J. Exp. Med., August 19, 2002; 196(4): 541 - 549. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||