SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lin, M. Articles by Schuh, A. C. Search for Related Content PubMed PubMed Citation Articles by Lin, M. Articles by Schuh, A. C. Related Collections Immunobiology Transfusion Medicine Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 1 March 2002, Vol. 99, No. 5, pp. 1683-1691 IMMUNOBIOLOGY Cell surface antigen CD109 is a novel member of the 2 macroglobulin/C3, C4, C5 family of thioester-containing proteins Martin Lin, D. Robert Sutherland, Wendy Horsfall, Nicholas Totty, Erik Yeo, Rakash Nayar, Xiang-Fu Wu, and Andre C. Schuh From the Departments of Medical Biophysics, and Medicine, and the Institute of Medical Science, University of Toronto; the Division of Hematology/ Medical Oncology, The Princess Margaret Hospital, Toronto, ON, Canada; and the Imperial Cancer Research Fund, London, United Kingdom.     Abstract Top Abstract Introduction Materials and methods Results Discussion References Cell surface antigen CD109 is a glycosylphosphatidylinositol (GPI)-linked glycoprotein of approximately 170 kd found on a subset of hematopoietic stem and progenitor cells and on activated platelets and T cells. Although it has been suggested that T-cell CD109 may play a role in antibody-inducing T-helper function and it is known that platelet CD109 carries the Gov alloantigen system, the role of CD109 in hematopoietic cells remains largely unknown. As a first step toward elucidating the function of CD109, we have isolated and characterized a human CD109 cDNA from KG1a and endothelial cells. The isolated cDNA comprises a 4335 bp open-reading frame encoding a 1445 amino acid (aa) protein of approximately 162 kd that contains a 21 aa N-terminal leader peptide, 17 potential N-linked glycosylation sites, and a C-terminal GPI anchor cleavage-addition site. We report that CD109 is a novel member of the 2 macroglobulin (2M)/C3, C4, C5 family of thioester-containing proteins, and we demonstrate that native CD109 does indeed contain an intact thioester. Analysis of the CD109 aa sequence suggests that CD109 is likely activated by proteolytic cleavage and thereby becomes capable of thioester-mediated covalent binding to adjacent molecules or cells. In addition, the predicted chemical reactivity of the activated CD109 thioester is complementlike rather than resembling that of 2M proteins. Thus, not only is CD109 potentially capable of covalent binding to carbohydrate and protein targets, but the t1/2 of its activated thioester is likely extremely short, indicating that CD109 action is highly restricted spatially to the site of its activation. (Blood. 2002;99:1683-1691) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Materials and methods Results Discussion References To identify new surface antigens expressed by primitive hematopoietic stem and progenitor cells, we raised a series of monoclonal antibodies (mAbs) against the primitive CD34+ acute myeloid leukemia cell line, KG1a.1-3 Four of these mAbs8A3, 7D1, 8A1, and 7C5recognized a novel glycoprotein of approximately 170 kd that was expressed in a restricted pattern in the hematopoietic compartment and by endothelial cells.4 Subsequently found to be identified by a number of additional mAbs, this antigen was designated CDw109 in 19935 and CD109 in 1996.6 Antibodies to CD109 recognize monomeric polypeptides of about 170 kd and 150 kd in lysates of KG1a cells, T-cell lines, and activated T lymphoblasts, endothelial cells, and activated platelets.3,7-11 Peptide mapping and amino acid (aa) analysis indicate that the 150-kd form is likely derived proteolytically from the 170-kd form.3,10 An additional band of about 120 kd that is occasionally observed arises through calcium-dependent proteolysis of the larger forms.3,10 CD109 contains several N-linked endoglycosidase H-sensitive hybrid-type glycans but no O-linked glycans.3,10 Consistent with this finding, ABH blood group antigens have recently been shown to be carried by platelet CD109.12 KG1a CD109 is susceptible to cleavage with phosphatidylinositol-specific phospholipase C (PI-PLC), indicating that CD109 is bound to the cell membrane by a GPI anchor.5,6,9-11 On some cell types, a proportion of surface CD109 is resistant to PI-PLC but is sensitive to GPI-phospholipase D, indicating that some of the CD109 GPI anchors are acylated on inositol.10,13 Although the biologic relevance of such anchor heterogeneity is unknown, it suggests that discrete populations of CD109 may have distinct lipid solubility characteristics and, therefore, may partition differentially into distinct membrane-lipid microdomains. Indeed, T-cell CD109 is considerably more soluble in nonionic detergents than are several other GPI-anchored proteins,11 and it does not appear to colocalize with membrane-associated src-family kinases after T-cell activation.11 The expression of CD109 has been studied in greatest detail in hematopoietic cells.3,14,15 As defined by mAb binding, CD109 appears initially on a subset (3%-35%) of fetal and adult CD34+ bone marrow (BM) mononuclear cells.14,15 Notably, almost all myelo-erythroid and MK progenitors in fetal and adult BM are found in this CD34+CD109+ subset and not in the CD34+/CD109 fraction.14 Moreover, CD109 expression is strongest on cells expressing the highest levels of CD34, suggesting that the most primitive candidate hematopoietic stem cells (HSCs) may also be contained within the CD109+ subset. Consistent with this notion, we have shown that the CD34+CD109+ fraction contains cells that are CD38lo, Thy-1 (CD90)+, and AC133+ and that are able to efflux the mitochondrial dye rhodamine 123 (Rho123), characteristics associated with the most primitive HSCs.14 Indeed, the CD34+CD109+ bone marrow fraction contains all assayable cobblestone area-forming cell activity (known to correlate with long-term in vivo repopulating ability), with the CD109+Rho123lo subset of CD34+ cells containing cobblestone area-forming cells at frequencies of approximately 1 in 10 cells plated.14 Thus, it is likely that CD109 marks primitive HSCs. As hematopoietic differentiation proceeds, however, CD109 expression (as determined by mAb binding) becomes progressively restrictedinitially to myeloid precursors, and then to megakaryoblastic progenitorsand finally becomes undetectable on resting, mature blood cells. Curiously, CD109 reappears as an activation antigen on platelets and T cells.3,7-9 After activation with a variety of agonists, platelets become CD109+, expressing approximately 2000 ± 400 mAb 8A3 binding sites per cell.3 The Gov platelet alloantigens, which have been implicated in posttransfusion purpura, neonatal alloimmune thrombocytopenia, and refractoriness to platelet transfusion, have recently been shown to correspond to noncarbohydrate platelet CD109 epitopes.3,12,13 Previously undefined,10,16,17 the immunogenicity of the Gov antigens is now known to be similar to that of the HPA-5 antigens and is exceeded only by that of the HPA-1 antigens.18 CD109 is also expressed by activated T cells. After T-cell activation in vitro, CD109 becomes detectable on CD4+ and CD8+ T cells by day 1, peaks by day 6, and thereafter decreases in the absence of additional interleukin-2.3,7-9 The precise function of CD109 on hematopoietic precursors and on activated platelets and T cells is unknown. However, the observation that T-cell-dependent antibody production is abrogated in vitro by the CD109 mAb LDA1 suggests that CD109 may play a role in B-cell-T-cell interactions.7 As a first step toward elucidating the function of CD109, we have isolated and characterized a human CD109 cDNA. We report that CD109 is a novel member of the 2 macroglobulin (2M)/C3, C4, C5 family of thioester-containing proteins and demonstrate that native CD109 contains an intact thioester.     Materials and methods Top Abstract Introduction Materials and methods Results Discussion References Cell culture KG1a12 and Chinese hamster ovary (CHO) cells were grown in RPMI 1640 and F12(Ham) (Life Technologies, Burlington, ON, Canada), respectively, each supplemented with 10% heat-inactivated fetal calf serum (Hyclone, Logan, UT), 2 mM L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin (Life Technologies). Cells were obtained from the ATCC and were maintained at 37°C in 5% CO2. Antibodies CD109 mAbs 8A3 and 7D1 were raised against KG1a cells as described previously,3 1B38 and LDA17 were gifts of Irwin Bernstein (Fred Hutchinson Cancer Research Center, Seattle, WA) and Nicole Suciu-Foca (Columbia University, New York, NY), respectively, and TEA 2/16 was from PharMingen (San Diego, CA). CD71 mAb D5119 (gift of Hans-Joachim Gross, University of Würzburg, Germany) was used as an immunoprecipitation control. Immuno-affinity purification and partial amino acid sequencing of CD109 KG1a cells (1 × 1010) were washed in ice-cold phosphate-buffered saline (PBS) (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4), pH 7.4, supplemented with 0.2 mM EDTA, were resuspended in 300 mL ice-cold lysis buffer (0.01 M Tris-HCl, pH 8.1, 0.15 M NaCl, and 0.5% Nonidet P-40 [NP40]) supplemented with 2 mM phenylmethylsulfonyl fluoride, 1 mg/mL bovine serum albumin, and 2 mM EDTA, and were lysed on ice for 20 minutes with stirring.20,21 After centrifugation at 100 000g for 30 minutes, the lysate was brought to 0.5 M NaCl, and CD109 antigen was purified by cross-linked immuno-affinity chromatography. Briefly, 10 mg of CD109 mAb 8A3 was coupled to 1 mL Protein A-Sepharose beads (Amersham Pharmacia Biotech, Baie d'Urfe, QC, Canada) using dimethyl pimelimidate (Pierce, Rockford, IL). After loading the lysate, the column was washed sequentially with lysis buffer containing 0.5 M NaCl and 0.1% sodium dodecyl sulfate (SDS), respectively. Bound CD109 was eluted with 0.05 M diethylamine (pH 11.5) containing 0.5% deoxycholate (DOC) adjusted to pH 8.1 with 0.1 N HCl,21,22 and its purity was assessed by SDS-polyacrylamide gel electrophoresis (PAGE) and silver staining.23 Purified CD109 was fractionated further by preparative 7.5% SDS-PAGE, and the 170-kd Coomassie-stained band was excised and digested overnight with endoproteinase Lys-C or Asp-N (Roche, Laval, QC, Canada). Resultant peptides were extracted and separated by tandem ion exchange and reverse-phase chromatography and were sequenced with an Applied Biosystems Procise sequencer.24 Labeling of cells and immunoprecipitation of CD109 KG1a cells were labeled with 125I-sodium iodide20 or were biotinylated with Sulfo-NHS-LC-LC-Biotin (Pierce). Lysates of labeled cells were then clarified by centrifugation at 14 000g for 5 minutes, brought to 0.5 M NaCl, and used for immunoprecipitation.20,21 Immune complexes were collected on Protein A-Sepharose beads or on rabbit anti-mouse immunoglobulin-coated Protein A-Sepharose beads and were washed sequentially with lysis buffer containing 0.5 M NaCl and 0.5% DOC-0.1% SDS, respectively. Methylamine treatment of immunoprecipitates Immunoprecipitates were washed further with 0.2 M HEPES, pH 8, 0.1% NP40, were resuspended in 1 mL fresh 0.4 mM methylamine (Sigma, Oakville, ON, Canada) in HEPES-NP40 for 30 minutes at 37°C, and were washed once with HEPES-NP40 and once in lysis buffer containing 0.1% SDS-0.5% DOC. Immunoprecipitates were then dissociated in SDS-gel sample buffer and were analyzed by SDS-PAGE. Analysis of immune complexes and Western blotting Radiolabeled immune complexes were analyzed by SDS-PAGE-autoradiography, and biotinylated complexes were analyzed by SDS-PAGE-Western blotting, using streptavidin-conjugated horseradish peroxidase-coupled chemiluminescence (Pierce). In some experiments, CD109 was detected with mAb 1B3, which detects a denaturation-resistant epitope of CD109 (D.R.S., A.C.S., unpublished observation, January 2000), followed by either iodinated Protein A22 or horseradish peroxidase-conjugated goat anti-mouse immunoglobulin-coupled chemiluminescence (Pierce). cDNA library screening A 4 kb EcoRI-XhoI fragment of rat EST R4712325 was radiolabeled with -32P-dCTP using the random primer synthesis method26 and was used to screen a  phage Uni-ZAP human umbilical vein endothelial cell (HUVEC) cDNA library (Stratagene, La Jolla, CA).27 Plaque-purified clones were rescued into pBS SK+ by in vivo excision and were amplified, and inserts were evaluated by restriction endonuclease digestion and DNA sequence analysis. A KG1a cDNA library28 constructed in  ZAP Express (gift of Robert Hawley) was screened as above using a clone H6 (Figure 1A) probe. Positive plaques were purified, rescued into pBK-CMV by in vivo excision, and analyzed as above. View larger version (11K): [in this window] [in a new window]   Figure 1. HUVEC and KG1a cDNA library-derived CD109 cDNAs and predicted protein. (A) Aligned restriction maps of the largest HUVEC (H6, H7)- and KG1a (K1)-derived CD109-specific cDNA fragments and the positions of the corresponding coding and untranslated regions are shown. K1 and deduced K1-H7 cDNAs contain identical ORFs but divergent 3'UTRs. White box, UTR; gray box, coding sequence; An, poly(A) tail; Sm, Sma I; E, EcoRI; Sa, SacI; B, BamHI; H, HindIII; Xb, XbaI; P, PstI. (B) CD109 is a novel GPI-linked member of the 2M family of thioester-containing proteins. The translated K1 sequence (Figure 1) predicts a 1445-aa protein of about 162 kd bearing a cleavable 21-aa N-terminal leader peptide and a C-terminal consensus GPI anchor cleavage-addition signal, with cleavage predicted to occur after aa 1420. CD109 shares the overall domain structure of the 2M family, containing a thioester signature sequence (aa 918-924) approximately two thirds of the way along the molecule, a thioester reactivity-defining hexapeptide (aa 1030-1035) ending in VIH about 100 aa further downstream and a putative bait region (approximately aa 651-683) lying roughly in the middle of the protein. Northern blot hybridization analysis KG1a cell total RNA was extracted using TRIzol (Life Technologies).29 Twenty micrograms total RNA was then analyzed by Northern blot analysis30 using a 635-bp K1/K1-H7 common probe generated by polymerase chain reaction (PCR) using the oligonucleotide primers K1(3225) 5'-3225GGAGTCTGAATTCAGTAGAGG3245-3' and K1(5n) 5'-3859CAGCAACATCTAAATCAAAGGC3838-3' with the K1 cDNA as template and a 732-bp K1-H7 specific probe generated by PCR using the primers K7(4670) 5'-4670CCTAGATTCTTAAGCATTATTAC4692-3' and K7(U1n) 5'- 5401CAGCAAGCATCAGATGTC5384-3' with the H7 cDNA fragment (Figure 1A) as template (numbering as in Figure 2). RNA loading and integrity were assessed using a 736-bp human hypoxanthine phosphoribosyltransferase probe generated by PCR using the primers F98 5'-GCCCTGGCGTCGTGATTAGTGATG-3' and R384 5'-AAGCAGATAGCCACAGAACTAGAAC-3'. To determine the tissue expression of CD109, a human multiple-tissue RNA membrane (Human RNA Master Blot; Clontech, Palo Alto, CA) containing poly(A) RNAs from 50 tissues was probed with a radiolabeled 725 bp (nt 3085-3809) BamHI-XbaI K1 cDNA fragment (Figure 1A; numbering as in Figure 2). View larger version (95K): [in this window] [in a new window]   Figure 2. CD109 cDNA and predicted protein sequences. The K1 and K1-H7 CD109 cDNAs and the corresponding 1445 aa protein sequence are shown (GenBank accession number AF410459). Nucleotides are numbered relative to the translation initiation codon, with the corresponding aa numbering shown in parentheses. K1 and K1-H7 3'UTRs, and the positions of the corresponding poly(A) tails [(a)n)] are shown. Peptides identified by immuno-affinity purification-microsequencing of CD109 are singly underlined. Potential sites of N-linked glycosylation, the thioester signature sequence (aa residues 918-924), and the corresponding downstream thioester reactivity-defining hexapeptide motif (aa residues 1030-1035) are marked by open boxes. Additionally, the amino-terminal leader peptide (double underline), the bait region (dotted underline), the translation stop (*), and the GPI anchor cleavage-addition site (open triangle) are shown. Reverse transcription-polymerase chain reaction RNA isolated as above was treated with RQ1 RNAse-free DNAse (Promega, Madison, WI), sequential phenol-chloroform and chloroform extraction, and ethanol precipitation, and cDNA was prepared with SuperScript I reverse transcriptase (Life Technologies).29 CD109 K1-H7-specific transcripts were detected using the oligonucleotide primer pair H6(7-1) 5'-4201CTGTCCTCCTGTGACCTT4218-3' and H7(U2) 5'-4841ATCTACTGAGACCACTGG4824-3' (numbering as in Figure 2) using 50 µL hot-start PCR reactions.29 In vitro transcription/translation The KG1a-derived CD109 K1 clone in pBK-CMV was digested with NotI-SalI to liberate a cDNA fragment containing the entire open-reading frame (ORF), including the translation initiation codon but without the 3' untranslated region (UTR), which was then inserted into NotI/SalI-digested pBS II KS() such that the CD109 cDNA was placed downstream of the T7 promoter. The pBS KS II T7/K1 construct (1.2 µg) was transcribed and translated in vitro using the T7/T3 TNT Coupled Reticulocyte Lysate System (Promega) and 35S-methionine (Amersham Pharmacia Biotech) according to the manufacturer's protocol. Five microliters reaction mix was then added to 195 µL lysis buffer supplemented with 50 µg/mL aminoethylbenzenesulfonylfluoride, 1 µg/mL antipain, 1 µg/mL leupeptin, 1 µg/mL pepstatin, and 1 µg/mL aprotinin (ICN, Montreal, QC, Canada). Then, 1.5 µg of one of the CD109 mAbs 1B3, 8A3, or LDA1 or of the control CD71 mAb D51 was added, and the resultant mix was incubated on ice for 1 hour. Protein A-Sepharose beads (5 µL packed beads per immunoprecipitate) were preincubated for 20 minutes on ice with unlabeled KG1a lysate (4 × 107 cells/mL). Beads were washed twice in cold lysis buffer, mixed with the TNT immune complexes for 45 minutes at 4°C, and were washed again in cold lysis buffer. Immune complexes were analyzed by SDS-PAGE. Expression of CD109 cDNA in Chinese hamster ovary cells The CD109 K1 cDNA ORF was excised from pBK-CMV as above and was inserted downstream of the CMV promoter (but upstream of the IRES sequence) into EcoRV-Notl cut plRES-EYFP (Clontech) to yield pK1/YFP. Restriction enzyme analysis and DNA sequencing were used to verify the orientation of the insert. CHO cells were seeded at a density of 1.3 × 106 cells per 10-cm dish. After 24 hours, cells were washed in PBS and were transfected in OPTI-MEM I medium (Life Technologies) with 10 µg pK1/YFP or control pIRES-EYFP and 40 µL Lipofectamine (Life Technologies) per dish, according to the manufacturer's protocol. After 4 hours, cells were washed in PBS and were placed in 5% CO2 at 37°C in F12(Ham) medium supplemented as above. Forty-eight hours thereafter, cells were detached from the plates with citric saline (135 mM KCl, 15 mM sodium citrate), washed twice in PBS-EDTA, incubated with phycoerythrin-conjugated CD109 mAb 8A3, 7D1, or TEA 2/16 for 30 minutes on ice, rinsed twice in PBS-EDTA, and resuspended in 0.5 mL PBS containing 1 µg/mL 7-amino actinomycin D (7-AAD; Sigma). After 10 minutes at room temperature, CD109 expression was determined by flow cytometry through the assessment of mAb binding to gated viable, single, YFP-positive cells.     Results Top Abstract Introduction Materials and methods Results Discussion References Immuno-affinity purification and partial amino acid sequencing of CD109 When analyzed by SDS-PAGE and silver staining (not shown), the eluate from the mAb 8A3/Protein A-Sepharose column yielded 2 bands at approximately 170 and 150 kd, characteristic of CD109.3,8-10 Affinity-purified CD109 was then fractionated further by preparative SDS-PAGE, and the larger band was excised and digested with endoproteinase Lys-C or Asp-N. Purification and sequence analysis of the resultant peptide fragments yielded 20 peptide sequences ranging in size from 7 to 20 aa. After overlapping sequences were combined, 17 independent CD109-derived peptide sequences were obtained. cDNA cloning and analysis BLAST analysis31,32 using these 17 CD109 peptide sequences identified a rat EST R4712325 that encoded the CD109-specific peptide DPKSNLIQQXLSQQ. EST R47123 was subsequently used to probe a  phage Uni-ZAP HUVEC cDNA library, yielding 8 independent clones that comprised 2 overlapping groups (Figure 1A). The first consisted of 7 clones that were progressive 5' truncations of the longest example, clone H6, a 3-kb clone containing a 2.7-kb ORF, followed by a 300-bp 3' UTR ending with a poly(A) tract. The second, consisting of clone H7 (approximately 2 kb), was contiguous with the H6 series cDNAs but contained a longer 3' UTR that extended an additional 1132 bp before the appearance of a poly(A) tract. Because clone H6 was not full length, we endeavored unsuccessfully to obtain more 5' CD109 cDNA sequence by rescreening the HUVEC library with H6 itself. A  ZAP Express KG1a cDNA library was screened using a clone H6 probe, yielding 9 independent clones. As illustrated in Figure 1A, restriction enzyme analysis and DNA sequencing demonstrated that these clones comprised a series of progressive 5' deletions of the longest example, clone K1 (approximately 4.7 kb), that encompassed clone H6 in its entirety and that contained about 1.3 kb additional 5' cDNA sequence. Nucleotide sequences of the 3 overlapping clonesH6, H7, and K1were determined in their entirety for both strands (Figures 1, 2). Clone K1 contained a 4335-bp ORF flanked by 112 bp 5' and 300 bp 3' UTRs, respectively. The putative translation start, though not comprising an optimal Kozak consensus sequence,33 was preceded by stop codons in all 3 frames. In addition (see below), the first 20 codons downstream of this start were predicted to encode a cleavable signal peptide. The K1 3' UTR contained a canonical polyadenylation signal, AATAAA, 15 bp upstream of the poly(A) tail. The clone H7 3' UTR was contiguous with that of clones K1 and H6 but extended an additional 1132 bp in the 5' direction. Two polyadenylation signals were found 34 and 19 bp, respectively, upstream of the H7 poly(A) tail. Clone K1 encodes CD109 To determine whether cDNA clone K1 did indeed encode CD109, we initially examined the predicted K1 protein sequence. Notably, the clone K1 ORF was found to contain 15 of the 17 CD109derived peptide sequences described above (Figure 2). A 16th peptide appeared to correspond to an actual, but scrambled, CD109 sequence (not shown). Next, we confirmed that the protein encoded by K1 could be detected by CD109-specific mAbs. When transcribed and translated in vitro (Figure 3A), K1 yielded a protein of about 160 kd that was recognized by CD109 mAbs 1B3, 8A3, and LDA1. In addition, expression of clone K1 was able to confer high-level mAb 7D1 binding to transfected CHO cells (Figure 3B). Similar staining was observed with the other CD109 mAbs 8A3, and TEA 2/16, and with Govb antiserum. Notably, this binding was abrogated by the treatment of K1 transfected cells with PI-PLC (not shown). In contrast, staining was not detectable on CHO cells transfected with control vectors expressing K1 antisense or an irrelevant cDNA (not shown). View larger version (49K): [in this window] [in a new window]   Figure 3. Clone K1 encodes a protein that is recognized by CD109 mAbs. (A) By in vitro transcription-translation in the presence of 35S-methionine, followed by immunoprecipitation, CD109 clone K1 is shown to encode an approximately 160-kd protein (arrow, lane 1) that is recognized by mAb 1B3, but not by control antibodies, including CD71 mAb D51 (lane 2). Positions of radiolabeled molecular weight markers are shown on the left. Similar results were obtained using CD109 mAbs 8A3 and LDA1 (not shown). (B) Expression of clone K1 confers CD109 mAb binding to CHO cells. Control mock-transfected CHO cells (top row), CHO cells transfected with empty pIRES-EYFP vector (middle row), and CHO cells transfected with CD109 expression vector pK1/YFP (bottom row) were stained with CD109 mAb 7D1-PE and 7-AAD. Viable (7-AAD) cells were then gated (region R1), and single cells within this gate were identified by light scatter (R2, not shown). YFP-expressing cells within this population (R3, left column) were then analyzed for CD109 expression (R4, right column). Expression of the K1 cDNA confers high-level 7D1 binding to CHO cells. Similar specific staining was observed using phycoerythrin conjugates of CD109 mAbs 8A3 and TEA 2/16 (not shown), and with Govb antiserum.53 In contrast, staining was not detectable on control CHO cells or on CHO cells transfected with pIRES-EYFP-based vectors expressing K1 antisense or an irrelevant cDNA and was abrogated by treatment of K1-transfected cells with PI-PLC (not shown). CD109 is a GPI-linked thioester-containing protein Consistent with the known size of CD109, the translated K1 sequence (Figures 1B, 2) predicts a 1445-aa protein of approximately 162 kd bearing a cleavable 21-aa N-terminal leader peptide34 and containing 17 potential N-linked glycosylation sites. As expected, the presence of a C-terminal hydrophobic tail preceded by a short hydrophilic stretch and a cluster of nonbulky amino acids defines a GPI anchor cleavage-addition site, with cleavage predicted to occur after aa 1420.35-37 Notably, the translated K1 sequence (Figures 1B, 2) contains the 918PYGCGEQ924 thioester motif, defining CD109 as a member of the 2M/C3, C4, C5 superfamily of thioester-containing protease inhibitor and complement proteins.38,39 Indeed, by blast31,32 analysis, CD109 bears 45% to 50% overall sequence similarity to other vertebrate and invertebrate 2M proteins (and was more distantly related to C3 and C4 complement proteins), with particularly high similarity in the region of the thioester motif (Figure 4A) and in 11 additional 2M family-specific conserved sequence blocks.40,41 The overall structural organization and size of CD109 is typical of 2M inhibitors as well (Figure 2B). The thioester lies approximately two thirds of the way along the 162-kd chain, and a hexapeptide motif (residues 1030-1035) that defines the chemical reactivity of the thioester42,43 is found as expected, 100 aa further downstream (Figures 1, 2B, 4B). In addition to these highly conserved regions, each 2M protein also contains a unique bait region in the middle of the molecule that defines substrate specificity.44 Containing cleavage sites for proteases of all 4 mechanistic classes44,45 and with diverse specificities, the bait region confers promiscuous protease inhibitory activity to 2M proteins. Consistent with this, CD109 also contains a putative bait region (approximate residues 651-683; Figures 1B, 2) that, as expected, is unrelated to the corresponding regions of other family members. View larger version (71K): [in this window] [in a new window]   Figure 4. CD109 contains an 2M-like thioester, but its chemical reactivity likely resembles that of complement. (A) The CD109 thioester most closely resembles that of other 2M proteins. Although CD109 bears 45% to 50% overall sequence similarity with other vertebrate and invertebrate 2M proteins, it shares particularly high similarity in the region of the thioester. An alignment of a 50 aa stretch flanking the CD109 thioester and the corresponding regions of the 18 most closely related proteins is shown. Notably, this group does not contain complement proteins. Numbers refer to the corresponding aa coordinates. MUG, murinoglobulin; 1I3, 1-inhibitor III; 1M, 1-macroglobulin; PZP, pregnancy zone protein; OvoM, ovomacroglobulin. Black shading, aa identity; gray shading, aa similarity; no shading, unrelated. (Carp 2M-1, GenBank accession no. [GB no.] AB026128; Carp 2M-2, GB no. AB026129; Carp 2M-3, GB no. AB026130; C elegans ZK337, GB no. Z82090; Limulus 2M, GB no. D83196; Chicken OvoM, GB no. X78801; Guinea Pig 2M, GB no. D84338; Guinea Pig MUG, GB no. D84339; Human PZP, GB no. X54380; Human 2M, GB no. M11313; Lamprey 2M, GB no. D13567; Mouse MUG2, GB no. M65238; Mouse MUG1, GB no.M65736; Mouse 2M, GB no. NM_007376; Rat 1I3, GB no. J03552; Rat 2M, GB no. J02635; Rat 1M, GB no. M84000; Xenopus Endodermin, GB no. L63543.) (B) The CD109 thioester reactivity-defining hexapeptide most resembles that of complement proteins. A 20 aa stretch encompassing the CD109 regulatory hexapeptide is aligned with the corresponding regions of human complement C3 and C4b and those of the 2 other 2M-family proteins2M and PZP. Although the 2M hexapeptide ends in an LLN triplet, that of CD109, C3, and C4b ends in VIH. Numbers refer to the corresponding aa coordinates. (Human PZP, GB no. X54380; Human 2M, GB no. M11313; Human C3, GB no. K02765; Human C4B, GB no. K02404.) The defining structural feature of the 2M/C3, C4, C5 superfamily is an intrachain thioester bond formed between a cysteinyl side chain sulfhydryl and a glutamine side chain carbonyl in the sequence CGEQ that can be disrupted with small nucleophiles such as methylamine.44,46 In addition, under experimental conditions of heat or chemical denaturation (preparing a sample for SDS-PAGE, for example), both complement and 2M inhibitors may undergo internal nucleophilic attack on the thioester, resulting in autolytic cleavage of the protein.47-49 Although not of physiological significance, this autolytic reaction is useful diagnostically to indicate the presence of an intact thioester bond. Therefore, we determined whether native CD109 could undergo high-temperature autolytic cleavage that could be prevented by pretreatment with methylamine. As illustrated in Figure 5, when KG1a-derived mAb 8A3-CD109 immune complexes were treated with 400 mM methylamine before analysis, only a single CD109 band of about 170 kd was subsequently observed. In the absence of methylamine treatment, however, boiling of immune complexes resulted in the appearance of the typical 150-kd form and of an associated 20-kd fragment. In contrast, and consistent with the known inability of standard cell-free systems to support intramolecular thioester formation,50 only a single band was observed when CD109 synthesized in vitro was heat-treated in the absence of methylamine (Figure 3A). Taken together, these observations demonstrate that native CD109 contains an intact thioester. In addition, these data indicate that the 150-kd CD109 band is indeed derived from the 170-kd form as had previously been suggested,3,10 but by autolytic rather than by proteolytic cleavage. The known ability of reducing agents to inhibit the autolytic cleavage of thioester containing proteins such as C348,51,52 thus provides an explanation for the earlier observation that reduction before denaturation decreases the formation of the 150-kd CD109 band.10 View larger version (63K): [in this window] [in a new window]   Figure 5. Native CD109 contains an intact thioester. Boiling of radiolabeled KG1a-derived mAb 8A3-CD109 immune complexes results in the appearance of the typical 150- and 170-kd CD109 bands (arrows, lane 1) and of an additional 20-kd band (not shown). If, however, the immune complexes are treated with 400 mM methylamine before boiling, formation of the 150-kd band is greatly inhibited (lane 2). Thus, the 150-kd CD109 band arises by the thioester-mediated autolytic cleavage of the 170-kd form, which is abrogated if the thioester is first disrupted with the small nucleophile methylamine. Positions of molecular weight markers are shown on the right. Expression pattern of CD109 As noted above, 2 distinct CD109 3' UTRs were isolated by library screening. By RT-PCR analysis, both variants were readily detectable in KG1a and HUVEC RNA (not shown). Consistent with these data, several KG1a CD109 transcripts were also detectable by Northern blot analysis of total RNA (Figure 6A). Notably, a probe expected to recognize both K1 and K1-H7 detected transcripts measuring 5.5 and 7.4 kb, whereas a K1-H7-specific probe detected only the latter. It is likely, therefore, that the 5.5 and 7.4 kb bands correspond to K1 and K1-H7 transcripts, respectively. The relationship of these transcripts to the additional large band detected by both probes is unclear. Northern blot analysis of Jurkat, HeLa, MEG01, and CMK-11-5 cell total RNAs using both K1 and K1-H7 probes yielded similar results (not shown). A cDNA probe expected to recognize both K1 and K1-H7 transcripts was also used to evaluate the tissue range of expression of CD109 with a commercial multiple tissue blot bearing a series of human adult and fetal RNAs. As shown in Figure 6B, CD109 transcripts were detected in a wide range of tissues, with highest levels found in adult uterus, aorta, heart, lung, trachea, and placenta, and in fetal heart, kidney, liver, spleen, and lung. Whether these data indicate true widespread expression or merely reflect endothelial cell expression (or both) is unknown. View larger version (36K): [in this window] [in a new window]   Figure 6. Northern blot analysis of CD109-specific transcripts. (A) KG1a cells contain multiple CD109-specific transcripts. Northern blots of KG1a total RNA probed with K1/K1-H7 common and K1-H7 specific probes are shown. The former probe is expected to detect both K1 and K1-H7 transcripts. Although 3 CD109-specific bands (11.4, 7.4, and 5.5 kb) are revealed by the common probe, the K1-H7-specific probe detects only the 2 larger transcripts. Positions of the 28S and 18S rRNA species are noted on the right. Control hypoxanthine phosphoribosyltransferase hybridizations ensure equal RNA loading. (B) CD109 is expressed widely in adult and fetal tissues. A commercial multiple tissue mRNA blot probed with a CD109 probe expected to detect both K1 and K1-H7 transcripts is shown (top panel). Corresponding RNAs are identified in the bottom panel. CD109 transcripts are detected in a wide range of tissues, with the highest levels found in adult uterus, aorta, heart, lung, trachea, and placenta, and in fetal heart, kidney, liver, spleen, and lung. In all cases, negative control RNAs and DNAs did not yield CD109-specific signals.     Discussion Top Abstract Introduction Materials and methods Results Discussion References The restricted pattern of expression of CD109 within hematopoietic cells (CD109 is expressed by a subset of early progenitor and candidate HSCs and by activated platelets and T cells) suggests that it may play a role not only in hematopoiesis but also in cell-mediated immunity and in hemostasis. As a first step toward elucidating the function of CD109, we used an immuno-purification-microsequencing strategy to isolate a cDNA encoding human CD109. Several lines of evidence indicate that the isolated cDNA has been correctly identified. Not only does the clone encode 16 of 17 CD109-derived peptides, but its expression results in the synthesis of a GPI-linked protein that can be detected by multiple CD109-specific mAbs, both in vitro and in vivo. In addition, and confirming its identity, we have recently determined that the Gova and Govb alloantigens are defined by a single nucleotide polymorphism of the cDNA reported here (see accompanying article by Schuh et al,53 page 1692). Nevertheless, the presence of multiple CD109 transcripts by Northern blot analysis and the presence of an additional CD109-related peptide that could not be accounted for by our cDNA raise the possibility that additional CD109 cDNA variants may exist. The presence of a thioester signature sequence38,39918PYGCGEQ924defines CD109 as a member of the 2M/C3, C4, C5 superfamily of thioester-containing proteins. This family comprises 2 general divisionsthe 2M-like protease inhibitors and the complement proteinsthat are thought to have arisen from a common, ancestral 2M-like molecule.44 By sequence similarity, CD109 is closely related to the 2M inhibitors and more distantly to C3 and C4 proteins. CD109 differs from typical 2M inhibitors in several respects, however. First, though most 2M protease inhibitors exist as oligomers of a 180-kd subunit44 (for example, human 2 macroglobulin occurs in plasma as a 720-kd tetramer), CD109 apparently exists as a monomer.3,5,6 To date, monomeric 2M protease inhibitors have been characterized primarily in rodents,44 although they are believed to exist in other vertebrates as well.54 Second, CD109 is membrane bound through a GPI anchor. Membrane-anchored 2M/C3, C4, and C5 proteins have not been described previously. Third, although various activated human and rodent 2M inhibitors have been shown to interact with 2 cellular receptorsthe low-density lipoprotein receptor-related protein-2M receptor (LRP-2MR) that mediates the clearance of inhibitor-protease complexes from the circulation55,56 and the 2-macroglobulin signaling receptor (2MSR) that mediates 2M activation-dependent signals57-61the carboxyl end of CD109 does not contain the KPTVK motif59,62-67 required for receptor binding. And fourth, although CD109 bears much greater overall sequence similarity to 2M proteins than it does to complement, its thioester reactivity-defining hexapeptide (Figure 4B) does not end in LLN as in other 2M proteins; rather, it ends in the 1033VIH1035 triplet characteristic of complement proteins (see below). Overall, therefore, CD109 defines a new member of the 2M family, but one with unusual features. The defining structural feature of the 2M/C3, C4, C5 superfamilythe intrachain thioester bondis typically unreactive in the native molecule, except with small nucleophiles such as methylamine. On proteolytic cleavage of the molecule, howeverby specific activating enzymes (in the case of the complement proteins) or by a wide range of proteases (in the case of the protease inhibitors)a conformational change occurs, and the thioester becomes highly reactive toward nucleophiles such that the proteins become covalently bound to nearby macromolecules through ester or amide bonds.44 In the case of complement, this leads to the covalent deposition of C3 and C4 on the target cell and on immune aggregates. In the case of protease inhibitors, covalent binding of the activating protease may similarly occur. By analogy, it is likely that CD109 becomes activated in a similar fashion by proteolytic cleavage and thereby becomes capable of covalent substrate binding. Curiously, though 2M proteins preferentially bind to substrate molecules by forming ester bonds with hydroxyl groups on carbohydrates or proteins, C3 and C4 generally form amide bonds with proteins.44,68 This differential specificity is determined by the presence or absence of His or Asn in the terminal position of a conserved hexapeptide lying about 100 aa C-terminal to the thioester bond,42,43 (by protein folding, this domain interacts with, and modulates the reactivity of the thioester69). As has recently been elucidated,44,70,71 proteolytically activated Asn-containing molecules undergo direct nucleophilic attack of the thioester carbonyl in an uncatalyzed reaction. In contrast, proteolytic activation of His-containing molecules results in a catalyzed transacylation reaction that involves the initial intramolecular transacylation of the thioester carbonyl to the imidazole ring of His, forming a covalent intramolecular acyl imidazole intermediate. The liberated thioester cysteinyl sulfhydryl then acts as a general base to deprotonate hydroxyl nucleophiles for attack on the acyl imidazole intermediate. The catalyzed (His) reaction thus facilitates transacylation to hydroxyl-containing carbohydrate or protein targets, whereas in the uncatalyzed (Asn) reaction, only primary amine groups of protein targets are sufficiently nucleophilic to attack the thioester bond directly. In addition, the t1/2 of the reactive thioester is known to be much shorter if His is substituted for Asn, as the intermediate in the catalyzed reaction will react quickly with the most common hydroxyl-containing nucleophile, water.44,70-72 Thus, 2M proteins bearing a carboxyl-terminal His residue can potentially react with both carbohydrate and protein targets, but, by virtue of the short half-life of the reactive thioester, such binding is thought to be tightly restricted spatially to the initial site of activation. Because the CD109 regulatory motif ends in the VIH triplet usually associated with complement, it is likely not only that proteolytically activated CD109 forms ester bonds with hydroxyl groups on carbohydrates or proteins, rather than amide bonds, but also that this reactivity is short-lived and is highly restricted spatially to the site of activation, defining activated CD109 as a locally acting molecule. To date, though CD109 has been defined primarily as a marker of specific hematopoietic stem and progenitor cell subsets or as potential target antigen in alloimmune platelet destruction, its biologic function has remained obscure. The identification of CD109 as a novel, monomeric, 2M-type inhibitor with complementlike thioester reactivity allows several functional predictions to be made: First, it is likely that CD109 becomes activated by proteolytic cleavage. Although the expression pattern of CD109 immediately suggests a large number of candidate activating proteases that are elaborated during hematopoiesis and during platelet and T-cell activation, the physiologically relevant protease(s) are as yet undefined. Second, it is likely that proteolytic cleavage of CD109 results in a conformational change that leads to the covalent cross-linking of CD109 to adjacent molecules. Such covalent cross-linking activity is essential for the action of C3 and C4 and for the protease inhibitory action of monomeric 2M protease inhibitors. Although it is not yet known whether CD109 can function as a protease inhibitor, by analogy with other monomeric 2M inhibitors, such activity would likely require covalent binding to the activating protease, resulting in the formation of a CD109-protease complex. Third, it is possible that the covalent binding of activated CD109 is not restricted to proteases. Proteolytically activated 2M is able to bind a variety of other proteins and peptides by noncovalent trapping and covalent thioester-mediated binding mechanisms, thereby regulating their plasma stability, transport, and clearance.73-75 Although proteolytically activated monomeric 2M family proteins such as CD109 would not be expected to be able to trap other molecules noncovalently, as are their multimeric counterparts, they likely are capable of covalent binding to other nonprotease substrates. Indeed, in view of the putative complementlike spatially restricted thioester reactivity of activated CD109 and its location as a GPI-linked cell surface molecule, we suggest that CD109 may function as a membrane-bound cross-linking reagent, thereby mediating cell-substrate, cell-matrix, or cell-cell interactions that play roles in hematopoiesis, primary hemostasis, or innate immune responses. Consistent with this notion, the CD109 mAb LDA1 has been reported to abrogate antibody-inducing T-cell helper function during a primary mixed-lymphocyte reaction,7 suggesting that CD109 may play a role in T-cell-antigen-presenting cell or T-cell-B-cell interactions. The isolation of a cDNA encoding CD109 and the identification of this molecule as a novel membrane-bound member of the 2M/ C3, C4, C5 superfamily of thioester proteins has raised a number of intriguing possibilities regarding its functional role(s) and mechanism of action. We anticipate that biochemical studies using recombinant CD109 and the generation of murine pedigrees carrying specific CD109 mutations will allow these questions to be answered.     Acknowledgments We thank Norman Lassam, Ed Conway, David Isenman, and Alex Law for helpful discussions during this work and Willem Ouwehand and David Spaner for reviewing the manuscript.     Footnotes Submitted March 20, 2001; accepted October 12, 2001. Supported by grants from the Medical Research Council of Canada and the National Cancer Institute of Canada (A.C.S. and D.R.S.). The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Andre C. Schuh, Rm 7366, Medical Sciences Bldg, University of Toronto, 1 King's College Circle, Toronto, ON, Canada, M5S 1A8; e-mail: andre.schuh{at}utoronto.ca.     References Top Abstract Introduction Materials and methods Results Discussion References 1. Furley AJ, Reeves BR, Mizutani S, et al. Divergent molecular phenotypes of KG1 and KG1a myeloid cell lines. Blood. 1986;68:1101-1107[Abstract/Free Full Text]. 2. Koeffler HP, Billing R, Lusis AJ, Sparkes R, Golde DW. An undifferentiated variant derived from the human acute myelogenous leukemia cell line (KG-1). Blood. 1980;56:265-273[Abstract/Free Full Text]. 3. Sutherland DR, Yeo E, Ryan A, Mills GB, Bailey D, Baker MA. Identification of a cell-surface antigen associated with activated T lymphoblasts and activated platelets. Blood. 1991;77:84-93[Abstract/Free Full Text]. 4. Yeo EL, Sutherland DR. Further characterization of platelet 8A3, and activation-specific and T-cell antigen and its identification in endothelial cells [abstract]. Blood. 1992;80:56. 5. Sutherland DR, Yeo EL. Cluster report: CDw109. In: Schlossman S, et al., eds. Leukocyte Typing V. Oxford, England: Oxford University Press; 1995:1767-1769. 6. Sutherland DR, Yeo EL. Cluster report: CD109. In: Kishimoto T, et al., eds. Leukocyte Typing VI. London, England: Garland Publishing; 1998:714-716. 7. Suciu-Foca N, Reed E, Rubinstein P, MacKenzie W, Ng AK, King DW. A late-differentiation antigen associated with the helper inducer function of human T cells. Nature. 1985;318:465-467[CrossRef][Medline] [Order article via Infotrieve]. 8. Brashem-Stein C, Nugent D, Bernstein ID. Characterization of an antigen expressed on activated human T cells and platelets. J Immunol. 1988;140:2330-2333[Abstract]. 9. Haregewoin A, Solomon K, Hom RC, et al. Cellular expression of a GPI-linked T cell activation protein. Cell Immunol. 1994;156:357-370[CrossRef][Medline] [Order article via Infotrieve]. 10. Smith JW, Hayward CP, Horsewood P, Warkentin TE, Denomme GA, Kelton JG. Characterization and localization of the Gova/b alloantigens to the glycosylphosphatidylinositol-anchored protein CDw109 on human platelets. Blood. 1995;86:2807-2814[Abstract/Free Full Text]. 11. Solomon KR, Mallory MA, Finberg RW. Determination of the non-ionic detergent insolubility and phosphoprotein associations of glycosylphosphatidylinositol-anchored proteins expressed on T cells. Biochem J. 1998;334:325-333. 12. Kelton JG, Smith JW, Horsewood P, et al. ABH antigens on human platelets: expression on the glycosyl phosphatidylinositol-anchored protein CD109. J Lab Clin Med. 1998;132:142-148[CrossRef][Medline] [Order article via Infotrieve]. 13. Smith JW, Kelton JG. Phospholipase digestion and solubility define two distinct populations of platelet CD109 [abstract]. Blood. 1998;92:74. 14. Murray LJ, Bruno E, Uchida N, et al. CD109 is expressed on a subpopulation of CD34+ cells enriched in hematopoietic stem and progenitor cells. Exp Hematol. 1999;27:1282-1294[CrossRef][Medline] [Order article via Infotrieve]. 15. Rappold I, Ziegler BL, Kohler I, et al. Functional and phenotypic characterization of cord blood and bone marrow subsets expressing FLT3 (CD135) receptor tyrosine kinase. Blood. 1997;90:111-125[Abstract/Free Full Text]. 16. Kelton JG, Smith JW, Horsewood P, Humbert JR, Hayward CP, Warkentin TE. Gova/b alloantigen system on human platelets. Blood. 1990;75:2172-2176[Abstract/Free Full Text]. 17. Bordin JO, Kelton JG, Warner MN, et al. Maternal immunization to Gov system alloantigens on human platelets. Transfusion. 1997;37:823-828[CrossRef][Medline] [Order article via Infotrieve]. 18. Berry JE, Murphy CM, Smith GA, et al. Detection of Gov system antibodies by MAIPA reveals an immunogenicity similar to the HPA-5 alloantigens. Br J Haematol. 2000;60:75-81[CrossRef]. 19. Gross HJ. A monoclonal antibody D51 recognizes the transferrin-receptor structure. Blut. 1985;51:117-122[CrossRef][Medline] [Order article via Infotrieve]. 20. Schneider C, Sutherland R, Newman R, Greaves M. Structural features of the cell surface receptor for transferrin that is recognized by the monoclonal antibody OKT9. J Biol Chem. 1982;257:8516-8522[Abstract/Free Full Text]. 21. Sutherland DR, Rudd CE, Greaves MF. Isolation and characterization of a human T lymphocyte-associated glycoprotein (gp40). J Immunol. 1984;133:327-333[Abstract]. 22. Sutherland DR, Watt SM, Dowden G, et al. Structural and partial amino acid sequence analysis of the human hemopoietic progenitor cell antigen CD34. Leukemia. 1988;2:793-803[Medline] [Order article via Infotrieve]. 23. Wray W, Boulikas T, Wray VP, Hancock R. Silver staining of proteins in polyacrylamide gels. Anal Biochem. 1981;118:197-203[CrossRef][Medline] [Order article via Infotrieve]. 24. Totty NF, Waterfield MD, Hsuan JJ. Accelerated high-sensitivity microsequencing of proteins and peptides using a miniature reaction cartridge. Protein Sci. 1992;1:1215-1224[Medline] [Order article via Infotrieve]. 25. Matsuki Y, Nakashima M, Amizuka N, et al. A compilation of partial sequences of randomly selected cDNA clones from the rat incisor. J Dent Res. 1995;74:307-312[Abstract/Free Full Text]. 26. Feinberg AP, Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 1983;132:6-13[CrossRef][Medline] [Order article via Infotrieve]. 27. Conway EM, Pollefeyt S, Cornelissen J, et al. Three differentially expressed survivin cDNA variants encode proteins with distinct antiapoptotic functions. Blood. 2000;95:1415-1442. 28. Claudio JO, Liew CC, Dempsey AA, et al. Identification of sequence-tagged transcripts differentially expressed within the human hematopoietic hierarchy. Genomics. 1998;50:44-52[CrossRef][Medline] [Order article via Infotrieve]. 29. Ong K, Horsfall W, Conway EM, Schuh AC. Early embryonic expression of murine coagulation system components. Thromb Haemost. 2000;84:1023-1030[Medline] [Order article via Infotrieve]. 30. Lassam N, Bickford S. Loss of c-kit expression in cultured melanoma cells. Oncogene. 1992;7:51-56[Medline] [Order article via Infotrieve]. 31. Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389-3402[Abstract/Free Full Text]. 32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410[CrossRef][Medline] [Order article via Infotrieve]. 33. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 1987;15:8125-8148[Abstract/Free Full Text]. 34. Nielsen H, Engelbrecht J, Brunak S, von Heijne G. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 1997;10:1-6[Abstract/Free Full Text]. 35. Eisenhaber B, Bork P, Eisenhaber F. Sequence properties of GPI-anchored proteins near the omega-site: constraints for the polypeptide binding site of the putative transamidase. Protein Eng. 1998;11:1155-1161[Abstract/Free Full Text]. 36. Eisenhaber B, Bork P, Yuan Y, Loffler G, Eisenhaber F. Automated annotation of GPI anchor sites: case study C. elegans. Trends Biochem Sci. 2000;25:340-341[CrossRef][Medline] [Order article via Infotrieve]. 37. Eisenhaber B, Bork P, Eisenhaber F. Prediction of potential GPI-modification sites in proprotein sequences. J Mol Biol. 1999;292:741-758[CrossRef][Medline] [Order article via Infotrieve]. 38. Hofmann K, Bucher P, Falquet L, Bairoch A. The PROSITE database, its status in 1999. Nucleic Acids Res. 1999;27:215-219[Abstract/Free Full Text]. 39. Bucher P, Bairoch A. A generalized profile syntax for biomolecular sequence motifs and its function in automatic sequence interpretation. Ismb. 1994;2:53-61. 40. Henikoff S, Henikoff JG. Protein family classification based on searching a database of blocks. Genomics. 1994;19:97-107[CrossRef][Medline] [Order article via Infotrieve]. 41. Blocks Database. Version 13.0. Available at: http://blocks.fhcrc.org. Block IPB001599: A2M. Accessed August 2001. 42. Dodds AW, Law SK. Structural basis of the binding specificity of the thioester-containing proteins, C4, C3 and alpha-2-macroglobulin. Complement. 1988;5:89-97[Medline] [Order article via Infotrieve]. 43. Ren XD, Dodds AW, Enghild JJ, Chu CT, Law SK. The effect of residue 1106 on the thioester-mediated covalent binding reaction of human complement protein C4 and the monomeric rat alpha-macroglobulin alpha 1 I3. FEBS Lett. 1995;368:87-91[CrossRef][Medline] [Order article via Infotrieve]. 44. Dodds AW, Law SK. The phylogeny and evolution of the thioester bond-containing proteins C3, C4 and alpha 2-macroglobulin. Immunol Rev. 1998;166:15-26[CrossRef][Medline] [Order article via Infotrieve]. 45. Armstrong PB, Quigley JP. Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 1999;23:375-390[CrossRef][Medline] [Order article via Infotrieve]. 46. Salvesen G, Enghild JJ. -Macroglobulins: detection and characterization. Methods Enzymol. 1993;223:121-141[Medline] [Order article via Infotrieve]. 47. Harpel PC, Hayes MB, Hugli TE. Heat-induced fragmentation of human alpha 2-macroglobulin. J Biol Chem. 1979;254:8669-8678[Abstract/Free Full Text]. 48. Sim R, Sim E. Autolytic fragmentation of complement components C3 and C4 under denaturing conditions, a property shared with alpha 2-macroglobulin. Biochem J. 1981;193:129-141[Medline] [Order article via Infotrieve]. 49. Sim R, Sim E. Autolytic fragmentation of complement components C3 and C4 and its relationship to covalent binding activity. Ann N Y Acad Sci. 1983;421:259-276[Medline] [Order article via Infotrieve]. 50. Iijima M, Tobe T, Sakamoto T, Tomita M. Biosynthesis of the internal thioester bond of the third component of complement. J Biochem (Tokyo). 1984;96:1539-1546[Abstract/Free Full Text]. 51. Janatova J, Tack BF, Prahl JW. Third component of human complement: structural requirement for its function. Biochemistry. 1980;19:4479-4485[CrossRef][Medline] [Order article via Infotrieve]. 52. Janatova J, Tack BF. Fourth component of human complement: studies of an amine-sensitive site comprised of a thiol component. Biochemistry. 1981;20:2394-2402[CrossRef][Medline] [Order article via Infotrieve]. 53. Schuh AC, Watkins N, Nguyen Q, et al. A tyrosine703serine polymorphism of CD109 defines the gov platelet alloantigens. Blood. 2002;99:1692-1698[Abstract/Free Full Text]. 54. Rubenstein DS, Thogersen IB, Pizzo SV, Enghild JJ. Identification of monomeric alpha-macroglobulin proteinase inhibitors in birds, reptiles, amphibians and mammals, and purification and characterization of a monomeric alpha-macroglobulin proteinase inhibitor from the American bullfrog Rana catesbeiana. Biochem J. 1993;290:85-95. 55. Salvesen G, Pizzo S. Proteinase inhibitors: alpha-macroglobulins, serpins, and kunins. In: Colman R,Hirsch J,Marder V,Salzman J, eds. Hemostasis and Thrombosis: Basic Principles and Clinical Practice. 3rd ed. Philadelphia, PA: JB Lippincott; 1994:241-258. 56. Krieger M, Herz J. Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annu Rev Biochem. 1994;63:601-637[Medline] [Order article via Infotrieve]. 57. Misra UK, Chu CT, Gawdi G, Pizzo SV. The relationship between low density lipoprotein-related protein/alpha 2-macroglobulin (alpha 2M) receptors and the newly described alpha 2M signaling receptor. J Biol Chem. 1994;269:18303-18306[Abstract/Free Full Text]. 58. Misra UK, Chu CT, Gawdi G, Pizzo SV. Evidence for a second alpha 2-macroglobulin receptor. J Biol Chem. 1994;269:12541-12547[Abstract/Free Full Text]. 59. Misra UK, Gawdi G, Pizzo SV. Ligation of the alpha 2-macroglobulin signalling receptor on macrophages induces protein phosphorylation and an increase in cytosolic pH. Biochem J. 1995;309:151-158. 60. Misra UK, Gawdi G, Pizzo SV. Binding of rat  1-inhibitor-3-methylamine to the  2-macroglobulin signaling receptor induces second messengers. J Cell Biochem. 1996;61:61-71[CrossRef][Medline] [Order article via Infotrieve]. 61. Misra UK, Pizzo SV. Binding of receptor-recognized forms of 2-macroglobulin to the 2-macroglobulin signaling receptor activates phosphatidylinositol 3-kinase. J Biol Chem. 1998;273:13399-13402[Abstract/Free Full Text]. 62. Enghild JJ, Thogersen IB, Roche PA, Pizzo SV. A conserved region in alpha-macroglobulins participates in binding to the mammalian alpha-macroglobulin receptor. Biochemistry. 1989;28:1406-1412[CrossRef][Medline] [Order article via Infotrieve]. 63. Howard GC, DeCamp DL, Misra UK, Pizzo SV. Identification of residues in alpha-macroglobulins involved in activation of the alpha 2-macroglobulin signaling receptor. Biochim Biophys Acta. 1996;1297:111-114[CrossRef][Medline] [Order article via Infotrieve]. 64. Howard GC, Yamaguchi Y, Misra UK, et al. Selective mutations in cloned and expressed alpha-macroglobulin receptor binding fragment alter binding to either the 2-macroglobulin signaling receptor or the low density lipoprotein receptor-related protein/2-macroglobulin receptor. J Biol Chem. 1996;271:14105-14111[Abstract/Free Full Text]. 65. Huang W, Dolmer K, Liao X, Gettins PG. Localization of basic residues required for receptor binding to the single alpha-helix of the receptor binding domain of human 2-macroglobulin. Protein Sci. 1998;7:2602-2612[Medline] [Order article via Infotrieve]. 66. Marynen P, van Leuven F, Cassiman JJ, van den Berghe H. Proteolysis at a lysine residue abolishes the receptor-recognition site of alpha 2-macroglobulin complexes. FEBS Lett. 1982;137:241-244[CrossRef][Medline] [Order article via Infotrieve]. 67. Nielsen KL, Holtet TL, Etzerodt M, et al. Identification of residues in alpha-macroglobulins important for binding to the alpha2-macroglobulin receptor/low density lipoprotein receptor-related protein. J Biol Chem. 1996;271:12909-12912[Abstract/Free Full Text]. 68. Law SK, Dodds AW. The internal thioester and the covalent binding properties of the complement proteins C3 and C4. Protein Sci. 1997;6:263-274[Medline] [Order article via Infotrieve]. 69. Nagar B, Jones RG, Diefenbach RJ, Isenman DE, Rini JM. X-ray crystal structure of C3d: a C3 fragment and ligand for complement receptor 2. Science. 1998;280:1277-1281[Abstract/Free Full Text]. 70. Dodds AW, Ren XD, Willis AC, Law SK. The reaction mechanism of the internal thioester in the human complement component C4. Nature. 1996;379:177-179[CrossRef][Medline] [Order article via Infotrieve]. 71. Gadjeva M, Dodds AW, Taniguchi-Sidle A, Willis AC, Isenman DE, Law SK. The covalent binding reaction of complement component C3. J Immunol. 1998;161:985-990[Abstract/Free Full Text]. 72. Sepp A, Dodds AW, Anderson MJ, Campbell RD, Willis AC, Law SK. Covalent binding properties of the human complement protein C4 and hydrolysis rate of the internal thioester upon activation. Protein Sci. 1993;2:706-716[Medline] [Order article via Infotrieve]. 73. Chu CT, Rubenstein DS, Enghild JJ, Pizzo SV. Mechanism of insulin incorporation into alpha 2-macroglobulin: implications for the study of peptide and growth factor binding. Biochemistry. 1991;30:1551-1560[CrossRef][Medline] [Order article via Infotrieve]. 74. Chu CT, Pizzo SV. Interactions between cytokines and alpha 2-macroglobulin [abstract]. Immunol Today. 1991;12:249[Medline] [Order article via Infotrieve]. 75. Chu CT, Pizzo SV. Receptor-mediated antigen delivery into macrophages: complexing antigen to alpha 2-macroglobulin enhances presentation to T cells. J Immunol. 1993;150:48-58[Abstract]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: N. Doan and P. G. W. Gettins {alpha}-Macroglobulins Are Present in Some Gram-negative Bacteria: CHARACTERIZATION OF THE {alpha}2-MACROGLOBULIN FROM ESCHERICHIA COLI J. Biol. Chem., October 17, 2008; 283(42): 28747 - 28756. [Abstract] [Full Text] [PDF] K. W. Finnson, B. Y. Y. Tam, K. Liu, A. Marcoux, P. Lepage, S. Roy, A. A. Bizet, and A. Philip Identification of CD109 as part of the TGF-{beta} receptor system in human keratinocytes FASEB J, July 1, 2006; 20(9): 1525 - 1527. [Abstract] [Full Text] [PDF] C.-T. Thai and R. T. Ogata Expression and Characterization of the C345C/NTR Domains of Complement Components C3 and C5 J. Immunol., December 15, 2003; 171(12): 6565 - 6573. [Abstract] [Full Text] [PDF] A. C. Schuh, N. A. Watkins, Q. Nguyen, N. J. Harmer, M. Lin, J. Y. A. Prosper, K. Campbell, D. R. Sutherland, P. Metcalfe, W. Horsfall, et al. A tyrosine703serine polymorphism of CD109 defines the Gov platelet alloantigens Blood, March 1, 2002; 99(5): 1692 - 1698. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Lin, M. Articles by Schuh, A. C. Search for Related Content PubMed PubMed Citation Articles by Lin, M. Articles by Schuh, A. C. Related Collections Immunobiology Transfusion Medicine Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020