|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Departments of Medical Biophysics, and
Medicine, and the Institute of Medical Science, University of Toronto;
the Division of Hematology/ Medical Oncology, The Princess Margaret
Hospital, Toronto, ON, Canada; and the Imperial Cancer Research Fund,
London, United Kingdom.
Cell surface antigen CD109 is a glycosylphosphatidylinositol
(GPI)-linked glycoprotein of approximately 170 kd found on a subset of hematopoietic stem and progenitor cells and on activated platelets and T cells. Although it has been suggested that T-cell CD109
may play a role in antibody-inducing T-helper function and it is known
that platelet CD109 carries the Gov alloantigen system, the role of
CD109 in hematopoietic cells remains largely unknown. As a first step
toward elucidating the function of CD109, we have isolated and
characterized a human CD109 cDNA from KG1a and endothelial cells. The
isolated cDNA comprises a 4335 bp open-reading frame encoding a 1445 amino acid (aa) protein of approximately 162 kd that contains a 21 aa
N-terminal leader peptide, 17 potential N-linked glycosylation sites,
and a C-terminal GPI anchor cleavage-addition site. We report that
CD109 is a novel member of the To identify new surface antigens expressed by
primitive hematopoietic stem and progenitor cells, we raised a series
of monoclonal antibodies (mAbs) against the primitive CD34+
acute myeloid leukemia cell line, KG1a.1-3 Four of these
mAbs Antibodies to CD109 recognize monomeric polypeptides of about 170 kd
and 150 kd in lysates of KG1a cells, T-cell lines, and activated T
lymphoblasts, endothelial cells, and activated
platelets.3,7-11 Peptide mapping and amino acid (aa)
analysis indicate that the 150-kd form is likely derived
proteolytically from the 170-kd form.3,10 An additional
band of about 120 kd that is occasionally observed arises through
calcium-dependent proteolysis of the larger forms.3,10
CD109 contains several N-linked endoglycosidase H-sensitive hybrid-type
glycans but no O-linked glycans.3,10 Consistent with this
finding, ABH blood group antigens have recently been shown to be
carried by platelet CD109.12 KG1a CD109 is susceptible to
cleavage with phosphatidylinositol-specific phospholipase C (PI-PLC),
indicating that CD109 is bound to the cell membrane by a GPI
anchor.5,6,9-11 On some cell types, a proportion of
surface CD109 is resistant to PI-PLC but is sensitive to
GPI-phospholipase D, indicating that some of the CD109 GPI
anchors are acylated on inositol.10,13 Although the
biologic relevance of such anchor heterogeneity is unknown, it suggests
that discrete populations of CD109 may have distinct lipid solubility
characteristics and, therefore, may partition differentially into
distinct membrane-lipid microdomains. Indeed, T-cell CD109 is
considerably more soluble in nonionic detergents than are several other
GPI-anchored proteins,11 and it does not appear to
colocalize with membrane-associated src-family kinases after T-cell
activation.11
The expression of CD109 has been studied in greatest detail in
hematopoietic cells.3,14,15 As defined by mAb binding, CD109 appears initially on a subset (3%-35%) of fetal and adult CD34+ bone marrow (BM) mononuclear cells.14,15
Notably, almost all myelo-erythroid and MK progenitors in fetal and
adult BM are found in this CD34+CD109+ subset
and not in the CD34+/CD109 Curiously, CD109 reappears as an activation antigen on platelets and T
cells.3,7-9 After activation with a variety of agonists, platelets become CD109+, expressing approximately
2000 ± 400 mAb 8A3 binding sites per cell.3 The Gov
platelet alloantigens, which have been implicated in posttransfusion
purpura, neonatal alloimmune thrombocytopenia, and refractoriness to
platelet transfusion, have recently been shown to correspond to
noncarbohydrate platelet CD109 epitopes.3,12,13 Previously
undefined,10,16,17 the immunogenicity of the Gov antigens
is now known to be similar to that of the HPA-5 antigens and is
exceeded only by that of the HPA-1 antigens.18
CD109 is also expressed by activated T cells. After T-cell activation
in vitro, CD109 becomes detectable on CD4+ and
CD8+ T cells by day 1, peaks by day 6, and thereafter
decreases in the absence of additional
interleukin-2.3,7-9 The precise function of CD109 on
hematopoietic precursors and on activated platelets and T cells is
unknown. However, the observation that T-cell-dependent antibody
production is abrogated in vitro by the CD109 mAb LDA1 suggests that CD109 may play a role in B-cell-T-cell
interactions.7
As a first step toward elucidating the function of CD109, we have
isolated and characterized a human CD109 cDNA. We report that CD109 is
a novel member of the Cell culture
Antibodies
Immuno-affinity purification and partial amino acid sequencing of CD109 KG1a cells (1 × 1010) were washed in ice-cold phosphate-buffered saline (PBS) (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4), pH 7.4, supplemented with 0.2 mM EDTA, were resuspended in 300 mL ice-cold lysis buffer (0.01 M Tris-HCl, pH 8.1, 0.15 M NaCl, and 0.5% Nonidet P-40 [NP40]) supplemented with 2 mM phenylmethylsulfonyl fluoride, 1 mg/mL bovine serum albumin, and 2 mM EDTA, and were lysed on ice for 20 minutes with stirring.20,21 After centrifugation at 100 000g for 30 minutes, the lysate was brought to 0.5 M NaCl, and CD109 antigen was purified by cross-linked immuno-affinity chromatography. Briefly, 10 mg of CD109 mAb 8A3 was coupled to 1 mL Protein A-Sepharose beads (Amersham Pharmacia Biotech, Baie d'Urfe, QC, Canada) using dimethyl pimelimidate (Pierce, Rockford, IL). After loading the lysate, the column was washed sequentially with lysis buffer containing 0.5 M NaCl and 0.1% sodium dodecyl sulfate (SDS), respectively. Bound CD109 was eluted with 0.05 M diethylamine (pH 11.5) containing 0.5% deoxycholate (DOC) adjusted to pH 8.1 with 0.1 N HCl,21,22 and its purity was assessed by SDS-polyacrylamide gel electrophoresis (PAGE) and silver staining.23Purified CD109 was fractionated further by preparative 7.5% SDS-PAGE, and the 170-kd Coomassie-stained band was excised and digested overnight with endoproteinase Lys-C or Asp-N (Roche, Laval, QC, Canada). Resultant peptides were extracted and separated by tandem ion exchange and reverse-phase chromatography and were sequenced with an Applied Biosystems Procise sequencer.24 Labeling of cells and immunoprecipitation of CD109 KG1a cells were labeled with 125I-sodium iodide20 or were biotinylated with Sulfo-NHS-LC-LC-Biotin (Pierce). Lysates of labeled cells were then clarified by centrifugation at 14 000g for 5 minutes, brought to 0.5 M NaCl, and used for immunoprecipitation.20,21 Immune complexes were collected on Protein A-Sepharose beads or on rabbit anti-mouse immunoglobulin-coated Protein A-Sepharose beads and were washed sequentially with lysis buffer containing 0.5 M NaCl and 0.5% DOC-0.1% SDS, respectively.Methylamine treatment of immunoprecipitates Immunoprecipitates were washed further with 0.2 M HEPES, pH 8, 0.1% NP40, were resuspended in 1 mL fresh 0.4 mM methylamine (Sigma, Oakville, ON, Canada) in HEPES-NP40 for 30 minutes at 37°C, and were washed once with HEPES-NP40 and once in lysis buffer containing 0.1% SDS-0.5% DOC. Immunoprecipitates were then dissociated in SDS-gel sample buffer and were analyzed by SDS-PAGE.Analysis of immune complexes and Western blotting Radiolabeled immune complexes were analyzed by SDS-PAGE-autoradiography, and biotinylated complexes were analyzed by SDS-PAGE-Western blotting, using streptavidin-conjugated horseradish peroxidase-coupled chemiluminescence (Pierce). In some experiments, CD109 was detected with mAb 1B3, which detects a denaturation-resistant epitope of CD109 (D.R.S., A.C.S., unpublished observation, January 2000), followed by either iodinated Protein A22 or horseradish peroxidase-conjugated goat anti-mouse immunoglobulin-coupled chemiluminescence (Pierce).cDNA library screening A 4 kb EcoRI-XhoI fragment of rat EST R4712325 was radiolabeled with -32P-dCTP
using the random primer synthesis method26 and was used to
screen a  phage Uni-ZAP human umbilical vein endothelial cell (HUVEC) cDNA library (Stratagene, La Jolla, CA).27
Plaque-purified clones were rescued into pBS SK+ by in vivo
excision and were amplified, and inserts were evaluated by restriction
endonuclease digestion and DNA sequence analysis. A KG1a cDNA
library28 constructed in ZAP Express (gift of Robert
Hawley) was screened as above using a clone H6 (Figure 1A) probe. Positive plaques were
purified, rescued into pBK-CMV by in vivo excision, and analyzed
as above.
Northern blot hybridization analysis KG1a cell total RNA was extracted using TRIzol (Life Technologies).29 Twenty micrograms total RNA was then analyzed by Northern blot analysis30 using a 635-bp K1/K1-H7 common probe generated by polymerase chain reaction (PCR) using the oligonucleotide primers K1(3225) 5'-3225GGAGTCTGAATTCAGTAGAGG3245-3' and K1(5n) 5'-3859CAGCAACATCTAAATCAAAGGC3838-3' with the K1 cDNA as template and a 732-bp K1-H7 specific probe generated by PCR using the primers K7(4670) 5'-4670CCTAGATTCTTAAGCATTATTAC4692-3' and K7(U1n) 5'- 5401CAGCAAGCATCAGATGTC5384-3' with the H7 cDNA fragment (Figure 1A) as template (numbering as in Figure 2). RNA loading and integrity were assessed using a 736-bp human hypoxanthine phosphoribosyltransferase probe generated by PCR using the primers F98 5'-GCCCTGGCGTCGTGATTAGTGATG-3' and R384 5'-AAGCAGATAGCCACAGAACTAGAAC-3'. To determine the tissue expression of CD109, a human multiple-tissue RNA membrane (Human RNA Master Blot; Clontech, Palo Alto, CA) containing poly(A) RNAs from 50 tissues was probed with a radiolabeled 725 bp (nt 3085-3809) BamHI-XbaI K1 cDNA fragment (Figure 1A; numbering as in Figure 2).
Reverse transcription-polymerase chain reaction RNA isolated as above was treated with RQ1 RNAse-free DNAse (Promega, Madison, WI), sequential phenol-chloroform and chloroform extraction, and ethanol precipitation, and cDNA was prepared with SuperScript I reverse transcriptase (Life Technologies).29 CD109 K1-H7-specific transcripts were detected using the oligonucleotide primer pair H6(7-1) 5'-4201CTGTCCTCCTGTGACCTT4218-3' and H7(U2) 5'-4841ATCTACTGAGACCACTGG4824-3' (numbering as in Figure 2) using 50 µL hot-start PCR reactions.29In vitro transcription/translation The KG1a-derived CD109 K1 clone in pBK-CMV was digested with NotI-SalI to liberate a cDNA fragment containing the entire open-reading frame (ORF), including the translation initiation codon but without the 3' untranslated region (UTR), which was then inserted into NotI/SalI-digested pBS II KS( ) such that the CD109 cDNA was placed downstream of the T7
promoter. The pBS KS II T7/K1 construct (1.2 µg) was transcribed and
translated in vitro using the T7/T3 TNT Coupled Reticulocyte Lysate
System (Promega) and 35S-methionine (Amersham Pharmacia
Biotech) according to the manufacturer's protocol. Five microliters
reaction mix was then added to 195 µL lysis buffer supplemented with
50 µg/mL aminoethylbenzenesulfonylfluoride, 1 µg/mL antipain, 1 µg/mL leupeptin, 1 µg/mL pepstatin, and 1 µg/mL aprotinin (ICN,
Montreal, QC, Canada). Then, 1.5 µg of one of the CD109 mAbs 1B3,
8A3, or LDA1 or of the control CD71 mAb D51 was added, and
the resultant mix was incubated on ice for 1 hour.
Protein A-Sepharose beads (5 µL packed beads per immunoprecipitate) were preincubated for 20 minutes on ice with unlabeled KG1a lysate (4 × 107 cells/mL). Beads were washed twice in cold lysis buffer, mixed with the TNT immune complexes for 45 minutes at 4°C, and were washed again in cold lysis buffer. Immune complexes were analyzed by SDS-PAGE. Expression of CD109 cDNA in Chinese hamster ovary cells The CD109 K1 cDNA ORF was excised from pBK-CMV as above and was inserted downstream of the CMV promoter (but upstream of the IRES sequence) into EcoRV-Notl cut plRES-EYFP (Clontech) to yield pK1/YFP. Restriction enzyme analysis and DNA sequencing were used to verify the orientation of the insert.CHO cells were seeded at a density of 1.3 × 106 cells per 10-cm dish. After 24 hours, cells were washed in PBS and were transfected in OPTI-MEM I medium (Life Technologies) with 10 µg pK1/YFP or control pIRES-EYFP and 40 µL Lipofectamine (Life Technologies) per dish, according to the manufacturer's protocol. After 4 hours, cells were washed in PBS and were placed in 5% CO2 at 37°C in F12(Ham) medium supplemented as above. Forty-eight hours thereafter, cells were detached from the plates with citric saline (135 mM KCl, 15 mM sodium citrate), washed twice in PBS-EDTA, incubated with phycoerythrin-conjugated CD109 mAb 8A3, 7D1, or TEA 2/16 for 30 minutes on ice, rinsed twice in PBS-EDTA, and resuspended in 0.5 mL PBS containing 1 µg/mL 7-amino actinomycin D (7-AAD; Sigma). After 10 minutes at room temperature, CD109 expression was determined by flow cytometry through the assessment of mAb binding to gated viable, single, YFP-positive cells.
Immuno-affinity purification and partial amino acid sequencing of CD109 When analyzed by SDS-PAGE and silver staining (not shown), the eluate from the mAb 8A3/Protein A-Sepharose column yielded 2 bands at approximately 170 and 150 kd, characteristic of CD109.3,8-10 Affinity-purified CD109 was then fractionated further by preparative SDS-PAGE, and the larger band was excised and digested with endoproteinase Lys-C or Asp-N. Purification and sequence analysis of the resultant peptide fragments yielded 20 peptide sequences ranging in size from 7 to 20 aa. After overlapping sequences were combined, 17 independent CD109-derived peptide sequences were obtained.cDNA cloning and analysis BLAST analysis31,32 using these 17 CD109 peptide sequences identified a rat EST R4712325 that encoded the CD109-specific peptide DPKSNLIQQXLSQQ. EST R47123 was subsequently used to probe a phage Uni-ZAP HUVEC cDNA library, yielding 8 independent clones that comprised 2 overlapping groups (Figure 1A). The first consisted of 7 clones that were progressive 5' truncations of the
longest example, clone H6, a 3-kb clone containing a 2.7-kb ORF,
followed by a 300-bp 3' UTR ending with a poly(A) tract. The second,
consisting of clone H7 (approximately 2 kb), was contiguous with the H6
series cDNAs but contained a longer 3' UTR that extended an additional
1132 bp before the appearance of a poly(A) tract. Because clone H6 was
not full length, we endeavored unsuccessfully to obtain more 5' CD109
cDNA sequence by rescreening the HUVEC library with H6 itself. A ZAP Express KG1a cDNA library was screened using a clone H6 probe,
yielding 9 independent clones. As illustrated in Figure 1A, restriction
enzyme analysis and DNA sequencing demonstrated that these clones
comprised a series of progressive 5' deletions of the longest example,
clone K1 (approximately 4.7 kb), that encompassed clone H6 in its
entirety and that contained about 1.3 kb additional 5' cDNA sequence.
Nucleotide sequences of the 3 overlapping clones Clone K1 encodes CD109 To determine whether cDNA clone K1 did indeed encode CD109, we initially examined the predicted K1 protein sequence. Notably, the clone K1 ORF was found to contain 15 of the 17 CD109derived peptide sequences described above (Figure 2). A 16th peptide appeared to correspond to an actual, but scrambled, CD109 sequence (not shown). Next, we confirmed that the protein encoded by K1 could be detected by CD109-specific mAbs. When transcribed and translated in vitro (Figure 3A), K1 yielded a protein of about 160 kd that was recognized by CD109 mAbs 1B3, 8A3, and LDA1. In addition, expression of clone K1 was able to confer high-level mAb 7D1 binding to transfected CHO cells (Figure 3B). Similar staining was observed with the other CD109 mAbs 8A3, and TEA 2/16, and with Govb antiserum. Notably, this binding was abrogated by the treatment of K1 transfected cells with PI-PLC (not shown). In contrast, staining was not detectable on CHO cells transfected with control vectors expressing K1 antisense or an irrelevant cDNA (not shown).
CD109 is a GPI-linked thioester-containing protein Consistent with the known size of CD109, the translated K1 sequence (Figures 1B, 2) predicts a 1445-aa protein of approximately 162 kd bearing a cleavable 21-aa N-terminal leader peptide34 and containing 17 potential N-linked glycosylation sites. As expected, the presence of a C-terminal hydrophobic tail preceded by a short hydrophilic stretch and a cluster of nonbulky amino acids defines a GPI anchor cleavage-addition site, with cleavage predicted to occur after aa 1420.35-37 Notably, the translated K1 sequence (Figures 1B, 2) contains the 918PYGCGEQ924 thioester motif, defining CD109 as a member of the2M/C3, C4, C5 superfamily of thioester-containing
protease inhibitor and complement proteins.38,39 Indeed,
by blast31,32 analysis, CD109 bears 45% to 50% overall
sequence similarity to other vertebrate and invertebrate 2M proteins
(and was more distantly related to C3 and C4 complement proteins), with
particularly high similarity in the region of the thioester motif
(Figure 4A) and in 11 additional 2M
family-specific conserved sequence blocks.40,41 The
overall structural organization and size of CD109 is typical of 2M
inhibitors as well (Figure 2B). The thioester lies approximately two
thirds of the way along the 162-kd chain, and a hexapeptide motif
(residues 1030-1035) that defines the chemical reactivity of the
thioester42,43 is found as expected, 100 aa further
downstream (Figures 1, 2B, 4B). In addition to these highly conserved
regions, each 2M protein also contains a unique bait region in the
middle of the molecule that defines substrate
specificity.44 Containing cleavage sites for proteases of
all 4 mechanistic classes44,45 and with diverse specificities, the bait region confers promiscuous protease inhibitory activity to 2M proteins. Consistent with this, CD109 also contains a
putative bait region (approximate residues 651-683; Figures 1B, 2)
that, as expected, is unrelated to the corresponding regions of other
family members.
The defining structural feature of the
Expression pattern of CD109 As noted above, 2 distinct CD109 3' UTRs were isolated by library screening. By RT-PCR analysis, both variants were readily detectable in KG1a and HUVEC RNA (not shown). Consistent with these data, several KG1a CD109 transcripts were also detectable by Northern blot analysis of total RNA (Figure 6A). Notably, a probe expected to recognize both K1 and K1-H7 detected transcripts measuring 5.5 and 7.4 kb, whereas a K1-H7-specific probe detected only the latter. It is likely, therefore, that the 5.5 and 7.4 kb bands correspond to K1 and K1-H7 transcripts, respectively. The relationship of these transcripts to the additional large band detected by both probes is unclear. Northern blot analysis of Jurkat, HeLa, MEG01, and CMK-11-5 cell total RNAs using both K1 and K1-H7 probes yielded similar results (not shown). A cDNA probe expected to recognize both K1 and K1-H7 transcripts was also used to evaluate the tissue range of expression of CD109 with a commercial multiple tissue blot bearing a series of human adult and fetal RNAs. As shown in Figure 6B, CD109 transcripts were detected in a wide range of tissues, with highest levels found in adult uterus, aorta, heart, lung, trachea, and placenta, and in fetal heart, kidney, liver, spleen, and lung. Whether these data indicate true widespread expression or merely reflect endothelial cell expression (or both) is unknown.
The restricted pattern of expression of CD109 within hematopoietic cells (CD109 is expressed by a subset of early progenitor and candidate HSCs and by activated platelets and T cells) suggests that it may play a role not only in hematopoiesis but also in cell-mediated immunity and in hemostasis. As a first step toward elucidating the function of CD109, we used an immuno-purification-microsequencing strategy to isolate a cDNA encoding human CD109. Several lines of evidence indicate that the isolated cDNA has been correctly identified. Not only does the clone encode 16 of 17 CD109-derived peptides, but its expression results in the synthesis of a GPI-linked protein that can be detected by multiple CD109-specific mAbs, both in vitro and in vivo. In addition, and confirming its identity, we have recently determined that the Gova and Govb alloantigens are defined by a single nucleotide polymorphism of the cDNA reported here (see accompanying article by Schuh et al,53 page 1692). Nevertheless, the presence of multiple CD109 transcripts by Northern blot analysis and the presence of an additional CD109-related peptide that could not be accounted for by our cDNA raise the possibility that additional CD109 cDNA variants may exist. The presence of a thioester signature
sequence38,39 The defining structural feature of the Curiously, though To date, though CD109 has been defined primarily as a marker of
specific hematopoietic stem and progenitor cell subsets or as potential
target antigen in alloimmune platelet destruction, its biologic
function has remained obscure. The identification of CD109 as a novel,
monomeric, The isolation of a cDNA encoding CD109 and the identification of this
molecule as a novel membrane-bound member of the
We thank Norman Lassam, Ed Conway, David Isenman, and Alex Law for helpful discussions during this work and Willem Ouwehand and David Spaner for reviewing the manuscript.
Submitted March 20, 2001; accepted October 12, 2001.
Supported by grants from the Medical Research Council of Canada and the National Cancer Institute of Canada (A.C.S. and D.R.S.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Andre C. Schuh, Rm 7366, Medical Sciences Bldg, University of Toronto, 1 King's College Circle, Toronto, ON, Canada, M5S 1A8; e-mail: andre.schuh{at}utoronto.ca.
1.
Furley AJ, Reeves BR, Mizutani S, et al.
Divergent molecular phenotypes of KG1 and KG1a myeloid cell lines.
Blood.
1986;68:1101-1107
2.
Koeffler HP, Billing R, Lusis AJ, Sparkes R, Golde DW.
An undifferentiated variant derived from the human acute myelogenous leukemia cell line (KG-1).
Blood.
1980;56:265-273
3.
Sutherland DR, Yeo E, Ryan A, Mills GB, Bailey D, Baker MA.
Identification of a cell-surface antigen associated with activated T lymphoblasts and activated platelets.
Blood.
1991;77:84-93 4. Yeo EL, Sutherland DR. Further characterization of platelet 8A3, and activation-specific and T-cell antigen and its identification in endothelial cells [abstract]. Blood. 1992;80:56. 5. Sutherland DR, Yeo EL. Cluster report: CDw109. In: Schlossman S, et al., eds. Leukocyte Typing V. Oxford, England: Oxford University Press; 1995:1767-1769. 6. Sutherland DR, Yeo EL. Cluster report: CD109. In: Kishimoto T, et al., eds. Leukocyte Typing VI. London, England: Garland Publishing; 1998:714-716. 7. Suciu-Foca N, Reed E, Rubinstein P, MacKenzie W, Ng AK, King DW. A late-differentiation antigen associated with the helper inducer function of human T cells. Nature. 1985;318:465-467[CrossRef] |
2 macroglobulin/C3, C4, C5 family of
thioester-containing proteins
Top
Abstract
Introduction
8A3, 7D1, 8A1, and 7C5
fraction.
