|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Laboratory of Immunology, National Cancer
Research Institute, Genoa, Italy; the Laboratory of Clinical
Immunology, Dipartimento di Medicina Interna, Università di
Genova, Genoa, Italy; and the Laboratory of Tumor Immunology,
Scientific Institute San Raffaele, Milan, Italy.
Herein, we show that CD8dull,
CD8intermediate, and CD8bright natural killer
(NK) cell clones can be identified. Triggering of CD8 with its natural ligand(s), represented by soluble HLA class I (sHLA-I), isolated either
from serum of healthy donors or from HLA-I CD8 antigen is expressed on a subpopulation
of T-cell receptor (TCR) Herein, we show that the interaction of sHLA-I with CD8 Monoclonal antibodies and reagents
Indirect immunofluorescence
Isolation and culture of polyclonal and clonal NK cell populations Peripheral blood mononuclear cells from healthy volunteers were isolated by Ficoll-Hypaque gradient. CD3 CD4
cells were isolated after negative immunodepletion as
described.25 The resulting cell population was 50% to
70% CD16+ (range of 8 different experiments) but 99%
CD3CD4. Highly purified
CD3CD4 cells were stimulated with 10 µg/mL phytohemagglutinin (PHA) and cultured in 96-well U-bottomed
microplates (Becton Dickinson) with complete medium in the presence of
100 U/mL rIL-2 in a final volume of 200 µL/well in the presence of
105/well irradiated allogeneic peripheral blood mononuclear
cells and 104/well 721.221 lymphoblastoid cell
line.25 Under these culture conditions, by 15 days all
cells expressed CD16 and CD56 antigens. CD3CD16+ clones were obtained by culturing
highly purified CD3CD4 NK cells under
limiting dilution conditions as previously reported.25 Cloning efficiency was of 5% to 10% calculated as
described.28
sHLA-I antigen preparations sHLA-I molecules were obtained from serum of healthy subjects by precipitation with ammonium sulfate, low-medium pressure chromatography, strong anionic and strong cationic ion exchange, and gel filtration as described19 and were purified by affinity chromatography on anti-HLA-I mAb W6/32 (10 µg/mL) coupled to cyanogen-bromide-activated Sepharose 4B (Pharmacia). The purity of sHLA-I molecule preparations was analyzed by one-dimensional polyacrylamide gel electrophoresis under nonreducing/nondenaturing or reducing/denaturing conditions followed by silver staining or immunoblotting with anti-HLA-I mAb TP25.99.19 Soluble HLA-A2, -Bw46, -Cw4, and -G1 were prepared from culture supernatants (SNs) of 721.221 cells transfected with the corresponding HLA-I alleles.10,20Determination of soluble FasL in culture SNs Soluble FasL (sFasL) present in culture SNs derived from NK cell clones after different incubation times (6, 12, 24, 36, and 48 hours), with medium alone, or under the various culture conditions indicated in the "Results" section and figure legends was evaluated by enzyme-linked immunosorbent assay.19 Standard curve was obtained by using progressive dilution of recombinant FasL from Alexis (Leufelfingen, Switzerland). Results were expressed as mean ± SD of triplicate wells.Induction and detection of apoptosis Bulk NK cell populations or NK cell clones (105/mL) were cultured in 24-well flat-bottomed plates with culture medium either alone or with different amounts of sHLA-I molecules (from 0.5 to 8 µg/mL) for different time periods (6, 12, 24, 36, 48, 60, and 72 hours) at 37°C in a 5% CO2 atmosphere. In some experiments cells were incubated with anti-CD8 mAb (OKT8, or astra102 orLeu2a) alone or in combination with anti-CD94 (HP-3B1) or anti-CD158b (GL183) or with anti-CD54 mAb (14D12D2) for 30 minutes at 4°C, washed, and then incubated for different times with 4-per-cell GAM-coated magnetic beads.19,29 Cells were then washed, and early apoptotic events were evaluated by annexin-V labeling method to show the exposure of phosphatidyl-serine at the external side of the plasma membrane. Viable apoptotic cells were differentiated from necrotic cells by flow cytometry after PI staining of nonpermeabilized cells. Apoptotic cells were identified as annexin V+ PI cells.19,29 Some experiments were
performed in the presence of 0.1, 1, or 10 µM verapamil diluted in
dimethyl sulfoxide or with the dimethyl sulfoxide solvent as control,
or with 2 mM EGTA (calcium chelator). Analysis of 104
cells/sample was done, and results were plotted as the percentage of
annexin V+ cells and PI cells. Apoptosis was
also detected by PI staining after permeabilization (DNA content
< 2n) and by DNA extraction and agarose gel
electrophoresis.19,29
Isolation of RNA, reverse transcription, and polymerase chain reaction amplification Total RNA was isolated from cell pellets by using the RNAzol B (Biotech Lab, Houston, TX) method.19 Complementary DNA (corresponding to 2 µg RNA) was synthesized from oligo(dT)-primed RNA as described.19 The polymerase chain reaction (PCR) mixture was amplified by using the following primer sequences: -actin 5'-GTGGGGCGCCCCAGGCACCA, -actin
3'-CTCCTTAATGTCACGCACGATTTC (548-base pair [bp] fragment); Fas-L
5'-CAAGTCCAACTCAAGGTCCATGCC, Fas-L 3'CAGAGAGAGCTCAGATACGTTGAC (350-bp
fragment).19 PCR products were size-fractionated by agarose electrophoresis and normalized according to the amount of
-actin detected in the same messenger RNA (mRNA) sample.
Calcium mobilization assay NK cells were loaded with the acetoxymethyl-ester of Fura-2 (Fura-2-AM, 1 µM; Sigma), placed in a quartz 2-mL cuvette, and maintained at 37°C by a thermostatically controlled water bath.27,30 Fura-2-AM was excited at 334 nm and 380 nm, emitted light was filtered at 510 nm, and fluorescence was monitored with the LS-50B spectrofluorimeter (Perkin-Elmer, Beaconsfield, England). The intracellular free calcium concentration ([Ca++]i) was calculated as described.30 [Ca++]i increases were measured on addition of sHLA-I (the optimal concentration, 4 µg/mL, was determined after titration experiments by using concentrations from 0.5 to 8 µg/mL) or on cross-linking of the CD8 molecule obtained by the addition of 20 µg/mL GAM after the preincubation for 20 minutes at 4°C of NK cells with anti-CD8-specific mAb (astra 102 or OKT8). Some experiments were performed in the presence of EGTA (2 mM) followed by 4 mM CaCl2. Inhibition of [Ca++]i increases induced by CD8 was performed by incubating Fura-2-labeled NK cell clones with anti-CD8 mAb (OKT8 or astra 102) together with anti-CD94 mAb (HP-3B1) or with anti-CD158b mAb (GL183). In control experiments anti-CD8 mAb was added in combination with anti-CD54 mAb (14D12D2) or anti-CD56 mAb (TA181H12). Cells were then analyzed as above and co-engagement of the indicated surface molecules was achieved by the addition of 20 µg/mL GAM.27
sHLA-I induces NK cell apoptosis on engagement of CD8 We first analyzed the expression of CD8 on a panel of NK cell clones obtained from peripheral blood CD3CD4 cells stimulated with PHA and
cultured with 100 U/mL rIL-2 under limiting dilution condition at 25-, 12-, and 6-cells/well. Clonal efficiency was relatively low (<10%) in
different experiments (n = 8), and, on this basis, these
microcultures could be operationally considered as
clones.10,11,25,28 NK cell clones were selected for the
homogeneous expression of a panel of NK cell surface molecules, including CD56, CD16, CD158a, and/or CD158b CD94,10-12
further supporting that they can be considered as clones.
We observed that these selected NK cell clones (n = 90) could be
divided into 3 groups with different CD8 expressions (Figure 1). Indeed, in some NK clones (35 of 90)
most of the cells were surface CD8
Although not shown, all NK cell clones displayed a similar cytolytic
activity against a panel of tumor target cells independently of the
different expression of CD8 antigen and the percentage of
CD8+ cells present. Furthermore, the addition of anti-CD8
mAb to the cytolytic assay did not have any effect. Finally,
cytotoxicity of these clones was not triggered, in a redirected killing
assay, using a panel of anti-CD8 mAb, whereas mAbs specific for
activating surface molecules, such as CD16, and CD69 were effective
(not shown). This finding would indicate that NK cells that bear CD8 antigen do not use this molecule to trigger cytolysis but rather to
regulate some other functions of NK cells. In this context, it has been
reported that CD8 can deliver an apoptotic signal in T lymphocytes by
interacting with its soluble natural ligand represented by sHLA-I
molecule.13-16,19,20 Thus, we analyzed whether sHLA-I
could induce apoptosis of NK cell clones by interacting with CD8 and
whether this effect was correlated with the CD8 antigen expression of
each clone tested. As shown in Figure 2,
sHLA-I induced apoptosis in CD8bright (C,F) and in
CD8intermediate (B,E) but not in CD8dull (A,D)
NK cell clones. Indeed, the detectable percentage of cells among
CD8bright (13% to 46%; C,F) and
CD8intermediate clones (12% to 14%; B,E) was annexin
V+ within 48 hours from the addition of sHLA-I to culture
medium; that is, they expressed phosphatidylserine at the cell surface, an early marker of programmed cell death (PCD).17,19,31-33
Apoptosis was also confirmed by DNA staining with PI after incubation
with sHLA-I (Figure 2H) and by DNA laddering (Figure 2M, lane 2). This apoptosis was mediated by the specific interaction of sHLA-I with CD8
antigen as the preincubation of NK cells with an anti-CD8 mAb (but not
with anti-CD54 mAb used as negative control; Figure 2A-F), which masked
CD8, preventing sHLA-I/CD8 interaction, almost completely inhibited the
sHLA-I-induced apoptosis (Figure 2B,C,E,F; compare panel H with L and
lane 2 with 4). Furthermore, optimal cross-linking of CD8 achieved by
anti-CD8 mAb followed by GAM-coated beads led to NK cell apoptosis
(Figure 2B,C,E,F,I,M lane 3), suggesting that CD8 can actually deliver
an apoptotic signal. In addition, cross-linking of Fas antigen,
achieved by the anti-Fas-specific CH-11 mAb, induced apoptosis in any
kind of NK cell clone (Figure 2A-F), indicating that
CD8dull NK cell clones were also susceptible to
Fas-mediated PCD. Kinetics experiments showed that NK cell apoptosis
reached a maximum after 2 to 3 days of incubation with sHLA-I (Figure
3A-C) and that the optimal sHLA-I
concentration was 4 µg/mL, although detectable levels of apoptotic
cells were found also at 0.5 µg/mL (Figure 3D). Finally, sHLA-I did
not induce apoptosis of CD8+ resting NK cells, supporting
the idea that NK cells should be activated to become sensitive to
CD8-mediated PCD (not shown).
Different alleles of sHLA-I induce apoptosis of NK cells on CD8 engagement It is well known that CD8 is a surface receptor for the 3
domain of HLA-I.2-8 Indeed, it has been reported
that in T lymphocytes CD8 can interact with sHLA-I isolated from serum
of healthy donors13-16,19 or with
sHLA-G1.20 Thus, we assessed the question of whether different sHLA-I alleles can induce apoptosis in CD8-bearing NK cells.
sHLA-I isolated from serum of healthy donors, as well as sHLA-A2, -Cw4,
-Bw46, and -G1 isolated from culture SN of the HLA-I cell
line 721.221 transfected with these HLA-I alleles, induced apoptosis of
NK cells (Figure 3E). Again, this effect was strongly reduced by
masking the CD8 surface molecule with specific mAb (Figure 3E). The
pretreatment of NK cells with anti-CD54 mAb, used as negative control,
did not affect NK cell apoptosis induced by different sHLA-I alleles
(Figure 3E). Furthermore, titration experiments have shown that the
amount of sHLA that induces NK cell apoptosis was similar for sHLA-I
and sHLA-G1 (Figure 3D), as for sHLA-A2, -Cw4, and -Bw46 (not shown).
This finding suggests that CD8 recognizes a constant portion of sHLA-I
and that any sHLA-I allele could induce NK cell apoptosis through the
engagement of CD8.
FasL/Fas interaction is responsible for sHLA-I-induced apoptosis via CD8 in NK cells Apoptosis of lymphocytes is mainly mediated by the interaction of Fas expressed at the cell surface and FasL present on neighboring cells or released in the extracellular milieu.31-33 Thus, to determine whether FasL/Fas interaction was responsible for sHLA-I-mediated PCD of NK cells on CD8 engagement, we analyzed NK cells for the surface or cytoplasmic expression of FasL and cultured SN derived from NK cell on incubation with sHLA-I for the presence of FasL. As shown in Figure 4, FasL was present in the cytoplasm (Figure 4B) but not at the cell surface of NK cells (Figure 4A). More importantly, sFasL was detectable in the SN of NK cells incubated with sHLA-I for 1 hour (Figure 4C) at 10-fold higher amounts than in SN from untreated NK cells (5.3 ng/mL versus 0.5 ng/mL), suggesting that FasL is released from NK cells during this incubation time. Importantly, the sHLA-I-induced apoptosis of NK cells (Figure 4D) was evident with a delay from the time when FasL was detectable in the SN (Figure 4C). This finding suggests that FasL is secreted into the extracellular milieu before inducing apoptosis. This phenomenon was more evident when sFasL was analyzed in SN derived from NK cell cultures in which CD8 was cross-linked (Figure 4C,D) by GAM-coated beads. The amount of sFasL detectable in the SN 3 hours after optimal cross-linking of CD8 was similar to that observed by using sHLA-I; however, sFasL recovered starting from 6 to 48 hours was higher in CD8-cross-linked than sHLA-I-incubated NK cell cultures (Figure 4C). Although not shown, sFasL present in these SNs was functional, as it induced apoptosis of the Fas+ T-cell line Jurkat. In addition, FasL was almost undetectable at different time points (1, 2, 3, 6, 12, 24, and 48 hours) in the SN of NK cells incubated with sHLA-I when CD8 antigen was masked with specific anti-CD8 mAbs (Figure 4C). Finally, although anti-Fas mAb CH-11 induced apoptosis at similar level of sHLA-I, a low amount of FasL was found in these culture SNs compared with that present in SNs of untreated NK cells (0.75 ng/mL versus 0.5 ng/mL) (not shown). This suggests that sFasL detected in SNs on incubation with sHLA-I or CD8 cross-linking was not simply because of the unspecific release from dying NK cells.
To determine whether sFasL present in NK cell culture SN was newly
synthesized, we analyzed NK cells for the expression of mRNA coding for
FasL on stimulation with either sHLA-I or on CD8 cross-linking. To this
aim, NK cells were incubated for different periods of time with sHLA or
on CD8 cross-linking, total mRNA was isolated, and the normalized
amount of mRNA was amplified by RT-PCR simultaneously with primers for
FasL and Taken together these findings indicate that sHLA-I, interacting with CD8 at the NK cell surface, leads to transcription of FasL mRNA and production of functional FasL protein. Thus, FasL is secreted in the extracellular milieu and, on binding with Fas, induces NK cell apoptosis. Intracellular calcium increases are involved in sHLA-I-mediated apoptosis of NK cells Secretion of synthesized proteins is a cellular function dependent on the rise of [Ca++]i.34,35 Thus, we analyzed whether (1) sHLA-I or CD8 engagement could induce calcium rises in NK cells and (2) calcium was needed for sHLA-I-induced apoptosis. To this aim, NK cell clones were labeled with Fura-2-AM, and variations in [Ca++]i were monitored in real time. As shown in Figure 5B, the addition of sHLA-I to CD8bright NK cell clones induces a strong and prompt [Ca++]i increase, with a maximum of 450 nM after about 200 seconds, lasting for at least 550 seconds at lower levels (400 nM). Masking of CD8 with anti-CD8 mAb (but not with anti CD54 mAb, used as control, not shown) abolished sHLA-I-mediated [Ca++]i rise (Figure 5C), suggesting that [Ca++]i increase was elicited by the binding of sHLA-I to CD8. Thus, we addressed the question of whether CD8 could also trigger [Ca++]i increases. As shown in Figure 5H, the engagement of CD8 in CD8bright NK cell clones led to a strong [Ca++]i rise, reaching a peak (750 nM) after about 100 seconds and lasting for more than 400 seconds at lower levels (400 nM). CD8 engagement in CD8dull NK cell clones did not induce any [Ca++]i rise (Figure 5E). However, CD16 evoked a strong [Ca++]i increase both in CD8bright and CD8dull NK cell clones (Figure 5I,F), indicating that both clones were able to mobilize calcium on engagement of appropriate molecules. Importantly, sHLA-I and the CD8-mediated [Ca++]i increase were mainly due to the entry of calcium from the extracellular medium, as the addition of the extracellular calcium chelator EGTA, prior to the addition of sHLA-I (Figure 5N) or CD8 cross-linking (Figure 5M), almost abrogated the [Ca++]i increase. The addition of an excess (4 mM) of CaCl2 to the extracellular milieu, in the presence of EGTA, after the addition of sHLA-I (Figure 5N) or CD8 cross-linking (Figure 5M) led to a strong [Ca++]i increase. This finding suggests that sHLA-I induces the opening of calcium channels by engaging CD8 at the cell surface of NK cells.
To determine whether extracellular calcium was needed for
sHLA-mediated apoptosis, we performed a series of experiments in the
presence of the calcium chelator EGTA or by blocking calcium entry with
verapamil as described.27,36 Apoptosis induced by sHLA-I
(Table 1) or on cross-linking of CD8 (not
shown) was strongly reduced (by 60%) in the absence of extracellular
calcium or by blocking calcium channels with verapamil. Altogether,
these findings indicate that the engagement of CD8 by sHLA-I activates
NK cells that open their calcium channels, allowing extracellular
calcium entry that is essential to induce apoptosis of NK cells.
Down-regulation of sHLA-I-induced apoptosis by the engagement of IRS in NK cells It is well established after interaction with HLA-I that ISIR or CLIR may deliver an inhibitory signal that leads to the down-regulation of different NK cell-mediated functions.10-12 Thus, the observed sHLA-I-induced apoptosis in CD8+ NK cell clones would represent the result of opposing effects mediated by the interaction of sHLA-I with CD8 (proapoptotic) or with IRS (antiapoptotic). To test this hypothesis, NK cell clones were incubated with sHLA-I from healthy donors after covering of inhibitory receptors with specific mAbs to block the interaction of sHLA-I and IRS, thus up-regulating sHLA-I-induced apoptosis. A representative experiment is shown in Figure 6A using the NK cell clone S2, which was CD8bright and expressed the inhibitory receptor CD94 (a CLIR). The clone S2 did not express other NK cell receptors for HLA-I, as it was KIR2D (CD158a and
CD158b). The covering of CD94 with HP-3B1 mAb strongly
augmented the sHLA-I-mediated apoptosis (from 47% to 77%). A similar
effect was detected by using sHLA-G1 isoform, as HLA-I was recognized specifically by CD94 (Table 2).
Importantly, the amount of FasL detected in the SN of NK cells
pretreated with HP-3B1 mAb and then incubated with sHLA-I was increased
by about 70-fold (from 12.37 to 827.79 ng/mL; Figure 6B). Moreover,
simultaneous cross-linking of CD8 and CD94 reduced by 50% the
apoptosis mediated by CD8 alone (from 47% to 24%; Figure 6A) and by
90% the CD8-mediated [Ca++]i rise in NK
cells (Figure 6C). Similar results were obtained in all the NK cell
clones expressing, as IRS, only the CD94 complex (n = 5, not shown).
We further analyzed also whether the engagement of a KIR2D molecule
plays a role in the negative regulation of sHLA-I-mediated apoptosis.
As shown in Figure 6D, sHLA-I-induced apoptosis was strongly
increased by the covering, with a specific mAb, the KIR2D inhibitory
receptor GL183 in the KIR2D+ (CD158b+) NK cell
clone 209 (CD8bright, CD158b+). A similar
effect was found by using sHLA-Cw3, as HLA-I was specifically
recognized by KIR2D GL183 (Table 2). Again, FasL detected in the
culture SNs of NK cells precoated with anti-KIR2D mAb and incubated
with sHLA-I was strongly increased compared with NK cells incubated
with sHLA-I alone (from 27 to 119 ng/mL; 4.4-fold increase; Figure 6E).
Finally, the co-engagement of CD8 and KIR2D (GL183) reduced by 30%
apoptosis and by 90% [Ca++]i rise elicited
via CD8 (Figure 6F). Altogether these findings suggest that IRSs for
HLA-I inhibit the sHLA-I-mediated FasL secretion and the consequent
apoptotic signal.
Herein, we provide evidence that sHLA-I induces apoptosis of NK cell clones by interacting with CD8 antigen and triggering the Fas/FasL pathway. Indeed, the engagement of CD8 by sHLA-I activates NK cells to synthesize and secrete FasL that, in turn, binds to Fas expressed by NK cells and, finally, induces their programmed suicide. This phenomenon is calcium dependent and is down-regulated by the binding of sHLA-I to IRS, represented by either CLIR or KIR. We have analyzed in detail the expression of CD8 on NK cell
clones, and we found that this antigen is not present on all cells of a
given NK cell clone. Thus, NK cell clones were grouped on the basis of
the percentage of CD8+ cells and the level of expression of
CD8 into CD8dull, CD8intermediate, and
CD8bright. In addition, we observed that CD8 antigen was
present in the cytoplasm of all cells of CD8dull NK cell
clones and that it was up-regulated on CD8dull and
CD8intermediate cells along the culture period. In
addition, the NK cell-mediated lysis of both HLA-I+ and
HLA-I We also provide evidence that Fas/FasL interaction plays a key role in sHLA-I-mediated NK cell death. Indeed, FasL was detectable in the culture SN of NK cells incubated with sHLA-I; this finding suggests that interaction of sHLA-I with CD8 delivers an activating signal, leading to synthesis and secretion of FasL, which, in turn, binds to Fas and induces NK cell death. This hypothesis is further supported by blocking experiments with anti-Fas antibody and by neutralization of SNs with anti-FasL mAb. The molecular mechanism underlying sHLA-I-induced apoptosis of NK
cells is reminiscent of that operating in CD8+ T
lymphocytes13,19; however, at variance with most T
lymphocytes, CD8+ NK cells express at the cell surface
other receptors for HLA-I represented by IRS, either ISIR or
CLIR.10-12 Some of these receptors recognize specific
subgroups of HLA-I alleles, whereas others, such as CD94/NKG2, can
interact with different HLA-I alleles, HLA-G, and/or
HLA-E.10-12 It is conceivable that apoptosis of
CD8+ NK cell clones, which bear receptors for HLA-I in
addition to CD8, is the sum of opposing effects because of the
engagement of proapoptotic (CD8) and antiapoptotic (IRS) HLA-I
receptors. This finding is of particular interest, as, until now, IRSs
have been considered as receptors that inhibit several NK
cell-mediated functional activities, including cytolysis and cytokine
production,10-12 whereas they might also represent a
useful tool for NK cells to survive from apoptosis mediated by
HLA-I/CD8 interaction. The finding that IRSs can protect NK cells from
sHLA-I-mediated apoptosis is noteworthy. It has been recently shown
that interaction of IRS with purified major histocompatibility complex
class I molecules is sufficient to inhibit the release of interferon
Why does IRS not abolish sHLA-I-mediated apoptosis? In fact, it has been claimed that inhibitory signals delivered through IRS usually prevail on activating signals.10-12 Conversely, in our experimental system, sHLA-I could induce NK cell apoptosis despite the expression of functional IRS, including CD94 that recognizes most sHLA-I alleles. That CD94 actually interacts with sHLA-I, leading to a powerful inhibitory effect, is demonstrated by the finding that covering this receptor with specific mAbs, in those NK cell clones that bear only CD94 as known inhibitory receptor, led to a sharp increase of sHLA-I-mediated apoptosis and FasL secretion. A possible explanation of our results is that the proapoptotic signal from CD8 and the antiapoptotic signal from IRS do not take place at the cell membrane in close proximity, thus allowing the proapoptotic signal to overcome the inhibition mediated by IRS engagement. Indeed, in our experiments the natural ligand of CD8 was represented by the monomeric form of sHLA-I (>99%), which might interact selectively with either CD8 or IRS. Alternatively, as the binding site of certain IRS for HLA-I is different from that of CD8,10-12 binding of sHLA-I to either IRS or CD8 would determine a conformational change in HLA-I that does not allow a simultaneous binding to both IRS and CD8. In addition, experimental evidence for the inhibitory effect of IRS has often involved the use of antibodies, and not the natural ligand, to cross-link at the same time activating and inhibiting receptors.10-12 Along this line, we have found that engagement of IRS could almost abolish the CD8-mediated calcium mobilization and consequent cell death when these 2 molecules are co-engaged by specific mAbs. NK cells play a key role in antiviral immune response.37,10-12 Further, it has been found that CD8 is present on the surface of some decidual NK cells.39 Thus, we speculate that NK cell-mediated lysis of virus-infected cells or trophoblastic cells would be down-regulated by the interaction of sHLA-I with CD8, which, in turn, induces NK cell apoptosis. In the first instance, this speculation would be relevant to self-limiting antiviral response. However, this response would allow the elimination of potentially harmful maternal CD8+ NK cells and could play a role in the immune tolerance of fetal allograft. What is the pathophysiologic significance of the NK cell apoptosis induced by sHLA-I? sHLA-I derived from tumor targets can interact with CD8, thus inducing NK cell death without the need of NK-target cell interaction. However, NK cells during interaction with target cells might receive an apoptotic signal through the binding of CD8 with HLA-I expressed by the target cell. These phenomena may play a key role in regulating the response of innate immunity against tumors. In this context, we found NK cell apoptosis at sHLA-I concentrations as low as 1 pg/cell, and this amount is high compared with that of HLA-I present on a single lymphocyte (0.1 fg/cell8); thus, it is possible that tumor targets down-regulate NK cell activity when high amounts of cancer cells are dying as in a necrotic portion of the tumor. In addition, tumor cells might evade the control of innate immunity simply by releasing sHLA-I, which, in turn, leads to NK cell apoptosis. This situation could explain, at least in part, how tumors with low amounts of HLA-I at the cell surface escape both from NK cell-mediated killing (by releasing HLA-I) and T-cell recognition (by reducing presentation of tumor-specific antigens). In conclusion, apoptosis of NK cells through sHLA-I/CD8 interaction
could play a role in switching off NK cell-mediated responses (cytolysis and/or lymphokine production). The finding that CD8
Submitted July 13, 2001; accepted October 19, 2001.
Partially supported by grants from Ministero della Sanità (2000-2002), Associazione Italiana per la Ricerca sul Cancro (AIRC), and Istituto Superiore di Sanità (ISS) AIDS project and by grants from MURST National Program 2000: "Mechanisms and modulation of apoptosis: role in autoimmune and haematological diseases" (No. MM06118858-001). G.M.S. is a fellow of Federazione Italiana per la Ricerca sul Cancro (FIRC).
G.M.S. and P.C. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Alessandro Poggi, Laboratory of Immunology, National Institute for Cancer Research, c/o CBA, Torre A1, Largo R. Benzi, 10, 16132 Genoa Italy; e-mail: poggi{at}vega.cba.unige.it.
1. Parnes JR. Molecular biology and function of CD4 and CD8. Adv Immunol. 1989;44:265-311[Medline] [Order article via Infotrieve].
2.
Salter RD, Norment AM, Chen BP, et al.
Polymorphism in the
3.
Connolly JM, Hansen TH, Ingold AL, Potter TA.
Recognition by CD8 on cytotoxic T lymphocytes is ablated by several substitutions in the class I
4.
Salter RD, Benjamin RJ, Wesley PK, et al.
A binding site for the T-cell co-receptor CD8 on the 5. Potter TA, Rajan TV, Dick RF II, Bluestone JA. Substitution at residue 227 of H-2 class I molecules abrogates recognition by CD8-independent cytotoxic T lymphocytes. Nature. 1989;337:73-75[CrossRef][Medline] [Order article via Infotrieve]. 6. Fayen J, Huang JH, Meyerson H. Class I MHC alpha 3 domain can function as an independent structural unit to bind CD8 alpha. Mol Immunol. 1995;32:267-275[CrossRef][Medline] [Order article via Infotrieve].
7.
Sun J, Leahy DJ, Kavathas PB.
Interaction between CD8 and major histocompatibility complex (MHC) class I mediated by multiple contact surfaces that include the 8. Joyce S, Nathenson SG. Methods to study peptides associated with MHC class I molecules. Curr Opin Immunol. 1994;6:24-31[CrossRef][Medline] [Order article via Infotrieve]. 9. Janaway CA Jr. The T cell receptor as a multicomponent signalling machine: CD4/CD8 coreceptors and CD45 in T cell activation. Ann Rev Immunol. 1992;10:645-674[Medline] [Order article via Infotrieve]. 10. Moretta A, Bottino C, Vitale M, et al. Receptors for HLA-class I molecules in human natural killer cells. Annu Rev Immunol. 1996;14:619-648[CrossRef][Medline] [Order article via Infotrieve]. 11. Lanier LL. NK cell receptors. Annu Rev Immunol. 1998;16:359-393[CrossRef][Medline] [Order article via Infotrieve]. 12. Long EO. Regulation of immune responses through inhibitory receptors. Annu Rev Immunol. 1999;17:875-904[CrossRef][Medline] [Order article via Infotrieve]. 13. Zavazawa N. Soluble HLA class I molecules: biological significance and clinical implications. Mol Med Today. 1998;4:116-121[CrossRef][Medline] [Order article via Infotrieve]. 14. Zavazawa N, Kronke M. Soluble HLA class I molecules induce apoptosis in alloreactive cytotoxic T lymphocytes. Nat Med. 1996;2:1005-1010[CrossRef][Medline] [Order article via Infotrieve]. 15. Puppo F, Scudelletti M, Indiveri F, Ferrone S. Serum HLA class I antigens: markers and modulators of an immune response? Immunol Today. 1995;16:124-127[CrossRef][Medline] [Order article via Infotrieve]. 16. Puppo F, Indiveri F, Scudelletti M, Ferrone S. Soluble HLA antigens: new roles and uses. Immunol Today. 1997;18:154-155[CrossRef][Medline] [Order article via Infotrieve].
17.
Ghio M, Contini P, Mazzei C, et al.
Soluble HLA class I, HLA class II, and Fas ligand in blood components: a possible key to explain the immunomodulatory effects of allogeneic blood transfusions.
Blood.
1999;93:1770-1777 18. Carbone E, Terrazzano G, Colonna M, et al. Natural killer clones recognize specific soluble HLA class I molecules. Eur J Immunol. 1996;26:683-689[Medline] [Order article via Infotrieve].
19.
Puppo F, Contini P, Ghio M, et al.
Soluble human MHC class I molecules induce soluble Fas ligand secretion and trigger apoptosis in activated CD8+ Fas (CD95)+ T lymphocytes.
Int Immunol.
2000;12:195-203
20.
Fournel S, Aguerre-Girr M, Huc X, et al.
Cutting edge: soluble HLA-G1 triggers CD95/CD95 ligand-mediated apoptosis in activated CD8+ cells by interacting with CD8.
J Immunol.
2000;164:6100-6104 21. Le Bouteiller P, Blaschitz A. The functionality of HLA-G is emerging. Immunol Rev. 1999;167:233-244[CrossRef][Medline] [Order article via Infotrieve]. 22. Puppo F, Costa M, Contini P, et al. Determination of soluble HLA-G and HLA-A, -B, and -C molecules in pregnancy. Transplant Proc. 1999;31:1841-1843[CrossRef][Medline] [Order article via Infotrieve]. 23. Bresciani A, Pirozzi G, Spera M, et al. Increased levels of serum HLA class I antigens in patients with systemic lupus erythematosus. Correlation with disease activity. Tissue Antigens. 1998;52:44-50[Medline] [Order article via Infotrieve]. 24. Puppo F, Brenci S, Montinaro E, et al. Inhibition of alloreactive cytotoxic T cell activity by HIV-positive sera: potential role of circulating soluble HLA class I molecules. AIDS Res Hum Retroviruses. 1994;10:1061-1064[Medline] [Order article via Infotrieve]. 25. Poggi A, Pella N, Morelli L, et al. p40, a novel surface molecule involved in the regulation of the non-major histocompatibility complex-restricted cytolytic activity in humans. Eur J Immunol. 1995;25:369-376[Medline] [Order article via Infotrieve].
26.
Moretta A, Poggi A, Pende D, et al.
CD69-mediated pathway of lymphocyte activation: anti-CD69 monoclonal antibodies trigger the cytolytic activity of different lymphoid effector cells with the exception of cytolytic T lymphocytes expressing T cell receptor
27.
Poggi A, Rubartelli A, Zocchi MR.
Involvement of dyhidropyridine-sensitive channels in dendritic cell function: competition by HIV-Tat.
J Biol Chem.
1998;273:7205-7209 28. Taswell C. Limiting dilution assay for the determination of immunocompetent cell frequencies. I. Data analysis. J Immunol. 1981;126:1614-1619[Abstract]. 29. Poggi A, Pellegatta F, Leone BE, Moretta L, Zocchi MR. Engagement of the leukocyte-associated Ig-like receptor-1 induces programmed cell death and prevents NF-kB nuclear translocation in human myeloid leukemias. Eur J Immunol. 2000;30:2751-2758[CrossRef][Medline] [Order article via Infotrieve].
30.
Grynkiewicz G, Poenie M, Tsien RY.
A new generation of Ca2+ indicators with greatly improved fluorescence properties.
J Biol Chem.
1985;260:3440-3450 31. Nagata S. Fas and Fas ligand: a death factor and its receptor. Adv Immunol. 1994;57:129-144[Medline] [Order article via Infotrieve]. 32. Tanaka M, Suda T, Takahashi T, Nagata S. Expression of the functional soluble form of human Fas ligand in activated lymphocytes. EMBO J. 1995;14:1129-1135[Medline] [Order article via Infotrieve]. 33. Wallach D, Varfolomeev E, Malinin L, Goltsev YV, Kovalenko AV, Boldin MP. Tumor necrosis factor receptor and Fas signalling mechanisms. Annu Rev Immunol. 1999;17:331-367[CrossRef][Medline] [Order article via Infotrieve].
34.
Rodriguez A, Webster P, Ortego J, Andrews NW.
Lysosomes behave as Ca2+-regulated exocytic vesicles in fibroblasts and epithelial cells.
J Cell Biol.
1997;137:93-104
35.
Stinchcombe JC, Griffiths GM.
Regulated secretion from hemopoietic cells.
J Cell Biol.
1999;147:1-5
36.
Zocchi MR, Rubartelli A, Morgavi P, Poggi A.
HIV-1 Tat inhibits human natural killer cell function by blocking L-type calcium channels.
J Immunol.
1998;161:2938-2943 37. Trinchieri G. Biology of natural killer cells. Adv Immunol. 1989;47:187-376[Medline] [Order article via Infotrieve]. 38. Kambayashi T, Michaelsson J, Fahlen L, et al. Purified MHC class I molecules inhibit activated NK cells in a cell-free system in vitro. Eur J Immunol. 2001;31:869-875[CrossRef][Medline] [Order article via Infotrieve]. 39. Loke YW, King A. Human Implantation: Cell Biology and Immunology. Cambridge United Kingdom: Cambridge University Press; 1995.
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  A. K. Moesta, L. Abi-Rached, P. J. Norman, and P. Parham Chimpanzees Use More Varied Receptors and Ligands Than Humans for Inhibitory Killer Cell Ig-Like Receptor Recognition of the MHC-C1 and MHC-C2 Epitopes J. Immunol., March 15, 2009; 182(6): 3628 - 3637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. B. Bernstein, M. C. Plasterer, S. E. Schiff, C. M. R. Kitchen, S. Kitchen, and J. A. Zack CD4 Expression on Activated NK Cells: Ligation of CD4 Induces Cytokine Expression and Cell Migration J. Immunol., September 15, 2006; 177(6): 3669 - 3676. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Jewett, N. A. Cacalano, C. Head, and A. Teruel Coengagement of CD16 and CD94 receptors mediates secretion of chemokines and induces apoptotic death of naive natural killer cells. Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 1994 - 2003. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Contini, M. Ghio, A. Merlo, A. Poggi, F. Indiveri, and F. Puppo Apoptosis of Antigen-Specific T Lymphocytes upon the Engagement of CD8 by Soluble HLA Class I Molecules Is Fas Ligand/Fas Mediated: Evidence for the Involvement of p56lck, Calcium Calmodulin Kinase II, and Calcium-Independent Protein Kinase C Signaling Pathways and for NF-{kappa}B and NF-AT Nuclear Translocation J. Immunol., December 1, 2005; 175(11): 7244 - 7254. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Poggi, C. Prevosto, A.-M. Massaro, S. Negrini, S. Urbani, I. Pierri, R. Saccardi, M. Gobbi, and M. R. Zocchi Interaction between Human NK Cells and Bone Marrow Stromal Cells Induces NK Cell Triggering: Role of NKp30 and NKG2D Receptors J. Immunol., November 15, 2005; 175(10): 6352 - 6360. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Poggi, A.-M. Massaro, S. Negrini, P. Contini, and M. R. Zocchi Tumor-Induced Apoptosis of Human IL-2-Activated NK Cells: Role of Natural Cytotoxicity Receptors J. Immunol., March 1, 2005; 174(5): 2653 - 2660. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Le Friec, F. Gros, Y. Sebti, V. Guilloux, C. Pangault, R. Fauchet, and L. Amiot Capacity of myeloid and plasmacytoid dendritic cells especially at mature stage to express and secrete HLA-G molecules J. Leukoc. Biol., December 1, 2004; 76(6): 1125 - 1133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Mirandola, C. Ponti, G. Gobbi, I. Sponzilli, M. Vaccarezza, L. Cocco, G. Zauli, P. Secchiero, F. A. Manzoli, and M. Vitale Activated human NK and CD8+ T cells express both TNF-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors but are resistant to TRAIL-mediated cytotoxicity Blood, October 15, 2004; 104(8): 2418 - 2424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ahmad and F. Alvarez Role of NK and NKT cells in the immunopathogenesis of HCV-induced hepatitis J. Leukoc. Biol., October 1, 2004; 76(4): 743 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hue, R. C. Monteiro, S. Berrih-Aknin, and S. Caillat-Zucman Potential Role of NKG2D/MHC Class I-Related Chain A Interaction in Intrathymic Maturation of Single-Positive CD8 T Cells J. Immunol., August 15, 2003; 171(4): 1909 - 1917. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Bukur, V. Rebmann, H. Grosse-Wilde, H. Luboldt, H. Ruebben, I. Drexler, G. Sutter, C. Huber, and B. Seliger Functional Role of Human Leukocyte Antigen-G Up-Regulation in Renal Cell Carcinoma Cancer Res., July 15, 2003; 63(14): 4107 - 4111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Spaggiari, P. Contini, A. Dondero, R. Carosio, F. Puppo, F. Indiveri, M. R. Zocchi, and A. Poggi Soluble HLA class I induces NK cell apoptosis upon the engagement of killer-activating HLA class I receptors through FasL-Fas interaction Blood, December 1, 2002; 100(12): 4098 - 4107. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
(IFN-