SEARCH:   Advanced

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Suzuki, S. Articles by Asaka, M. Search for Related Content PubMed PubMed Citation Articles by Suzuki, S. Articles by Asaka, M. Related Collections Phagocytes Brief Reports Chemokines, Cytokines, and Interleukins Social Bookmarking                   What's this?  Previous Article  |  Table of Contents  |  Next Article  Blood, 1 March 2002, Vol. 99, No. 5, pp. 1863-1865 BRIEF REPORT Autocrine production of epithelial cell-derived neutrophil attractant-78 induced by granulocyte colony-stimulating factor in neutrophils Sachiko Suzuki, Masanobu Kobayashi, Kouji Chiba, Iori Horiuchi, Jingxin Wang, Takeshi Kondoh, Satoshi Hashino, Junji Tanaka, Masuo Hosokawa, and Masahiro Asaka From the Division of Cancer Pathobiology, Institute for Genetic Medicine, Hokkaido University, the Department of Gastroenterology and Hematology, Department of Hematology and Oncology, Hokkaido University Graduate School of Medicine, Sapporo, Japan.     Abstract Top Abstract Introduction Study design Results and discussion References Whereas mobilization to inflammatory sites is an important function of neutrophils, it remains to be determined whether granulocyte colony-stimulating factor (G-CSF) stimulates the mobilization of neutrophils to the inflammatory sites. This study compared the expression of more than 9000 genes in neutrophils treated with and without G-CSF with the use of a DNA microarray system to determine the effects of G-CSF on the function of neutrophils. It was found that messenger RNA expression of epithelial cell-derived neutrophil attractant-78 (ENA-78), which has been reported to be a chemotactic factor for neutrophils, was induced by G-CSF in neutrophils. The study demonstrated that the supernatant of G-CSF-treated neutrophils induced the chemotaxis of neutrophils and that anti-ENA-78 antibody and anti-CXCR-2 antibody inhibited the chemotaxis. These data suggest that G-CSF may enhance the mobilization of neutrophils and consequently augment the accumulation of neutrophils in the inflammatory sites through the secretion of ENA-78. (Blood. 2002;99:1863-1865) © 2002 by The American Society of Hematology.     Introduction Top Abstract Introduction Study design Results and discussion References Granulocyte colony-stimulating factor (G-CSF) is now widely used for the treatment of neutropenic patients with severe infection.1-3 It is not only a specific growth factor for the granulocyte colony-forming unit (CFU-G) but also an activator for mature neutrophils.4-6 G-CSF enhances the survival of neutrophils and stimulates superoxide production and phagocytosis.2,7 These findings indicate that G-CSF exerts its effects in the treatment of severe infection through the increase of neutrophils and activation of effector functions. Whereas mobilization to inflammatory sites is known to be an important function of neutrophils, the effect of G-CSF on the mobilization of neutrophils is controversial.8-10 In this study, we sought to demonstrate the effects of G-CSF on the function of neutrophils with the use of a DNA microarray system. By comparing the expression of more than 9000 genes by screening messenger RNAs (mRNAs) extracted from untreated neutrophils and those treated with G-CSF in vitro, we found that epithelial cell-derived neutrophil attractant-78 (ENA-78) was expressed 17-fold higher in the neutrophils treated with G-CSF than in those untreated. As ENA-78 is an attractant for neutrophils,11,12 we examined the expression of ENA-78 in the neutrophils treated with or without G-CSF by a Northern blot analysis and further examined the motility-stimulating activities for neutrophils in the supernatants of the neutrophils treated with or without G-CSF.     Study design Top Abstract Introduction Study design Results and discussion References Reagents Modified G-CSF was kindly supplied from Kyowa Hakko (Tokyo, Japan). Because this G-CSF is stabler in human plasma than intact human G-CSF,13 the plasma level of this G-CSF reaches 20 ng/mL after a drip infusion at 2 µg/kg. Anti-ENA-78 antibody, anti-CXCR-2 antibody, and recombinant ENA-78 were purchased from R&D Systems (Minneapolis, MN). Cells Neutrophils were separated from peripheral blood obtained from healthy volunteers. Neutrophils were separated from mononuclear cells by centrifugation on Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). After removal of mononuclear cells, precipitated cells were separated into a red blood cell fraction and a neutrophil fraction by mixing with 2% methylcellulose. After contaminated red blood cells were removed by hypotonic shock, neutrophils were washed with phosphate-buffered saline twice. Purity of the neutrophils recovered by this method was higher than 99%. DNA microarray system Total RNA was extracted from the neutrophils incubated for 24 hours with or without G-CSF at 10 ng/mL with the use of Trizol Reagent (Life Technologies, Tokyo, Japan). mRNA was purified from the total RNA with the use of a Quickprep mRNA purification kit (Amersham Pharmacia Biotech). Differentially expressed genes were screened with the use of a DNA microarray system, UniGEM human (Kurabo Industries, Osaka, Japan) Northern blot analysis Northern blot analysis was performed according to the method described previously.14 Briefly, total RNA (20 µg) was separated by electrophoresis in 1.2% denaturing formaldehyde-agarose gels and transferred to nylon membrane (Hybond N+, Amersham). After prehybridization, the membrane was hybridized with the complementary DNA (cDNA) probes for ENA-78 labeled with 32P by using a random primer DNA labeling kit (Takara Biomedicals, Tokyo, Japan). The probed membrane was then washed and exposed to radiographic film. cDNA fragments for ENA-78 were amplified by reverse transcriptase-polymerase chain reaction, cloned into a TA cloning vector, and then used as probes for Northern blot assay. Polymerase chain reaction primers were as follows: ENA-78 forward, GGTTGGATGCTCTTGTCCAA; reverse, CCTTCCAGAAAGTCTTCTAT. Flow-activated cell sorter analysis After staining with anti-CXCR-2 antibody and fluorescence-conjugated second antibody, the cells were analyzed with a FACScaliber (Becton Dickinson, Mountain View, CA). Transwell chamber assay For examination of the chemotactic activities in the supernatants of neutrophils, the Transwell chamber (Coster, Cambridge, MA) assay was performed according to the previously described method.15 Supernatants were prepared by incubating the neutrophils for 24 hours after incubation with G-CSF for 24 hours and washing them twice with RPMI-1640 medium. Supernatants (600 µL) diluted to 20% and neutrophils suspended in 100 µL RPMI-1640 medium were placed in the lower and upper chambers, respectively. After 4 to 8 hours of incubation, transmigrated cells in the lower chambers were counted under an inverted microscope at least in 20 areas. As a positive control, recombinant ENA-78 was added in the lower chambers at 10 ng/mL. In some experiments, anti-ENA-78 antibody or anti-CXCR-2 antibody was added in the lower chambers at up to 2 µg/mL.     Results and discussion Top Abstract Introduction Study design Results and discussion References Differentially expressed genes One hundred twenty-two and 50 genes, including EST clones, were expressed 2-fold and 3-fold higher, respectively, in the neutrophils treated with G-CSF than in those untreated. Table 1 shows 37 known genes among those expressed 3-fold higher in the neutrophils treated with G-CSF than in those untreated. In particular, ENA-78 and granulocyte chemotactic protein-2 (GCP-2), which were reported to be chemotactic factors for neutrophils,11,12,16,17 were expressed 17-fold and 4-fold higher, respectively, in the neutrophils treated with G-CSF than in those untreated. Previous reports demonstrated that mast cells, nonsmall cell lung cancer cells, monocytes, and osteosarcoma cells produced ENA-78 and GCP-2, respectively, whereas there has been no report demonstrating the production of ENA-78 and GCP-2 by neutrophils.12,16,18,19 Therefore, we focused on these molecules in this study. Urokinase-type plasminogen activator, which has been reported to play an important role in the recruitment of neutrophils to the inflammatory sites,20 was also expressed 16.5-fold higher in the neutrophils treated with G-CSF than in those untreated. The role of plasminogen activator is now under examination.                                View this table: [in this window] [in a new window]   Table 1. Genes induced by granulocyte colony-stimulating factor in neutrophils ENA-78 mRNA expression and chemotaxis of neutrophils As shown in Figure 1A, the untreated neutrophils did not express ENA-78 mRNA, but the neutrophils treated with G-CSF expressed ENA-78 mRNA. ENA-78 mRNA expression was induced by G-CSF in a dose-dependent manner (data not shown). mRNA expression of GCP-2 was not observed in the treated or untreated neutrophils (data not shown). Figure 1B shows that CXCR2, a receptor for ENA-78, was expressed at the same level both on the neutrophils treated with and without G-CSF. As shown in Figure 1C, chemotaxis of neutrophils enhanced by recombinant ENA-78 was abrogated by anti-ENA-78 and anti-CXCR-2 antibodies. Chemotaxis was also enhanced by the supernatants of the G-CSF-treated neutrophils. Reversely, anti-ENA-78 and anti-CXCR-2 antibodies abrogated the enhanced chemotaxis. These results indicate that the neutrophils stimulated by G-CSF secrete ENA-78 and consequently stimulate the chemotaxis of neutrophils, suggesting that neutrophils accumulated in the inflammatory sites secrete ENA-78 and then augment the accumulation of neutrophils when treated with G-CSF. View larger version (26K): [in this window] [in a new window]   Figure 1. Expression of ENA-78 and CXCR-2 and chemotaxis of neutrophils. (A) mRNA expression of ENA-78 in neutrophils treated with or without G-CSF. Total RNAs were obtained from the untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours and then used for Northern blot analysis. Representative result of 3 different experiments is shown. (B) Expression of CXCR-2 on neutrophils. The untreated neutrophils and those treated with 10 ng/mL G-CSF for 24 hours were stained with anti-CXCR-2 antibody and fluorescein isothiocyanate-conjugated second antibody and then analyzed for expression of CXCR-2 with a FACScaliber. Representative result of 2 different experiments is shown. (C) Chemotaxis of neutrophils stimulated by conditioned medium of neutrophils. Supernatants of neutrophils treated with or without G-CSF (G+ or G, respectively) at 10 ng/mL were placed at 20% in the lower chambers. Anti-ENA-78 or anti-CXCR-2 antibody was added in the lower chambers at 2 µg/mL. Recombinant ENA-78 (10 ng/mL) was used as a positive control. Results are presented as percentage of numbers of transmigrated neutrophils treated with G CM. Data present the mean ± SD of 3 different experiments. Several previous reports demonstrating that the chemotaxis of neutrophils was decreased by the treatment with G-CSF seem to be inconsistent with our present result.8,9 However, in those previous studies they examined the chemotaxis of newly developed neutrophils after the in vivo treatment with G-CSF; it is not surprising that the chemotaxis of newly developed immature neutrophils was low. In contrast, we demonstrated that the treatment with G-CSF induced the production of a chemotactic factor, ENA-78, in the neutrophils. Our present results, in combination with the findings of survival-inducing activity of G-CSF, suggest that G-CSF is effective for the treatment of infection through the augmentation of the neutrophil accumulation in the inflammatory sites in addition to the increase of neutrophils and the activation of effector functions.     Acknowledgments We thank Kyowa Hakko for providing the G-CSF and Ms M. Yanome for assistance in preparing the manuscript.     Footnotes Submitted August 14, 2001; accepted October 23, 2001. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734. Reprints: Masanobu Kobayashi, Division of Cancer Pathobiology, Institute for Genetic Medicine, Hokkaido University, Kita-15, Nishi-7, Kita-Ku, Sapporo, 060-0815 Japan; e-mail: mkobaya{at}med.hokudai.ac.jp.     References Top Abstract Introduction Study design Results and discussion References 1. Moor MA. The clinical use of colony stimulating factors. Annu Rev Immunol. 1991;9:159-191[CrossRef][Medline] [Order article via Infotrieve]. 2. Stoltz DA, Bagby GJ, Nelson S. Use of granulocyte colony-stimulating factor in the treatment of acute infectious diseases. Curr Opin Hematol. 1997;4:207-212[Medline] [Order article via Infotrieve]. 3. Hartung T. Granulocyte colony-stimulating factor: its potential role in infectious disease. AIDS. 1999;2:S3-S9. 4. Pitrak DL. Effects of granulocyte colony-stimulating factor and granulocyte-macrophage colony-stimulating factor on the bactericidal functions of neutrophils. Curr Opin Hematol. 1997;4:183-190[Medline] [Order article via Infotrieve]. 5. Ogawa M. Effects of hemopoietic growth factors on stem cells in vitro. Hematol Oncol Clin North Am. 1989;3:453-464[Medline] [Order article via Infotrieve]. 6. Rapoport AP, Abboud CN, DiPersio JF. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF): receptor biology, signal transduction, and neutrophil activation. Blood Rev. 1992;6:43-57[CrossRef][Medline] [Order article via Infotrieve]. 7. Kapp A, Zeck-Kapp G. Activation of the oxidative metabolism in human polymorphonuclear neutrophilic granulocytes: the role of immuno-modulating cytokines. J Invest Dermatol. 1990;95:94S-99S[CrossRef][Medline] [Order article via Infotrieve]. 8. Spiekermann K, Emmendoerffer A, Elsner J, et al. Altered surface marker expression and function of G-CSF-induced neutrophils from test subjects and patients under chemotherapy. Br J Haematol. 1994;87:31-38[Medline] [Order article via Infotrieve]. 9. Azzara A, Carulli G, Rizzuti-Gullaci A, et al. Motility of rhG-CSF-induced neutrophils in patients undergoing chemotherapy: evidence for inhibition detected by image analysis. Br J Haematol. 1996;92:161-168[CrossRef][Medline] [Order article via Infotrieve]. 10. Itoh Y, Kuratsuji T, Tsunawaki S, Aizawa S, Toyama K. In vivo effects of recombinant human granulocyte colony-stimulating factor on normal neutrophil function and membrane effector molecule expression. Int J Hematol. 1991;54:463-469[Medline] [Order article via Infotrieve]. 11. Walz A, Schmutz P, Mueller C, Schnyder-Candrian S. Regulation and function of the CXC chemokine ENA-78 in monocytes and its role in disease. J Leuk Biol. 1997;62:604-611[Abstract]. 12. Lukacs NW, Hogaboam CM, Kunkel SL, et al. Mast cells produce ENA-78, which can function as a potent neutrophil chemoattractant during allergic airway inflammation. J Leuk Biol. 1998;63:746-751[Abstract]. 13. Okabe M, Asano M, Kuga T, et al. In vitro and in vivo hematopoietic effect of mutant human granulocyte colony-stimulating factor. Blood. 1990;75:1788-1793[Abstract/Free Full Text]. 14. Choi S, Kobayashi M, Wang J, et al. Activated leukocyte cell adhesion molecule (ALCAM) and annexin II are involved in the metastatic progression of tumor cells after chemotherapy with adriamycin. Clin Exp Metastasis. 2000;18:45-50[CrossRef][Medline] [Order article via Infotrieve]. 15. Imai K, Kobayashi M, Wang J, et al. Selective transendothelial migration of hematopoietic progenitor cells: a possible role in homing of progenitor cells. Blood. 1999;93:149-156[Abstract/Free Full Text]. 16. Proost P, De Wolf-Peeters C, Conings R, et al. Identification of a novel granulocyte chemotactic protein (GCP-2) from human tumor cells. In vitro and in vivo comparison with natural forms of GRO, IP-10, and IL-8. J Immunol. 1993;150:1000-1010[Abstract]. 17. Van Damme J, Wuyts A, Froyen G, et al. Granulocyte chemotactic protein-2 and related CXC chemokines: from gene regulation to receptor usage. J Leukoc Biol. 1997;62:563-569[Abstract]. 18. Koch AE, Kunkel SL, Harlow LA, et al. Epithelial neutrophil activating peptide-78: a novel chemotactic cytokine for neutrophils in arthritis. J Clin Invest. 1994;94:1012-1018. 19. Arenberg DA, Keane MP, DeGiovine B, et al. Epithelial-neutrophil activating peptide (ENA-78) is an important angiogenic factor in non-small cell lung cancer. J Clin Invest. 1998;102:465-472[Medline] [Order article via Infotrieve]. 20. Gyetko MR, Sud S, Kendall T, Fuller JA, Newstead MW, Standiford TJ. Urokinase receptor-deficient mice have impaired neutrophil recruitment in response to pulmonary Pseudomonas aeruginosa infection. J Immunol. 2000;165:1513-1519[Abstract/Free Full Text]. © 2002 by The American Society of Hematology.   CiteULike    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this? This article has been cited by other articles: S. Sengupta, S. Ghosh, and V. Nagaraja Moonlighting function of glutamate racemase from Mycobacterium tuberculosis: racemization and DNA gyrase inhibition are two independent activities of the enzyme Microbiology, September 1, 2008; 154(9): 2796 - 2803. [Abstract] [Full Text] [PDF] M. Lin, E. Carlson, E. Diaconu, and E. Pearlman CXCL1/KC and CXCL5/LIX are selectively produced by corneal fibroblasts and mediate neutrophil infiltration to the corneal stroma in LPS keratitis J. Leukoc. Biol., March 1, 2007; 81(3): 786 - 792. [Abstract] [Full Text] [PDF] N. Chegini, X. Luo, Q. Pan, A. Rhoton-Vlasak, and D.F. Archer Endometrial expression of epithelial neutrophil-activating peptide-78 during the menstrual cycle or in progestin-only contraceptive users with breakthrough bleeding and the influence of doxycycline therapy Hum. Reprod., February 1, 2007; 22(2): 427 - 433. [Abstract] [Full Text] [PDF] T. Fietz, K. Hattori, E. Thiel, and B. Heissig Increased soluble urokinase plasminogen activator receptor (suPAR) serum levels after granulocyte colony-stimulating factor treatment do not predict successful progenitor cell mobilization in vivo Blood, April 15, 2006; 107(8): 3408 - 3409. [Full Text] [PDF] S. Iida, T. Kohro, T. Kodama, S. Nagata, and R. Fukunaga Identification of CCR2, flotillin, and gp49B genes as new G-CSF targets during neutrophilic differentiation J. Leukoc. Biol., August 1, 2005; 78(2): 481 - 490. [Abstract] [Full Text] [PDF] K. E. Lawlor, I. K. Campbell, D. Metcalf, K. O'Donnell, A. van Nieuwenhuijze, A. W. Roberts, and I. P. Wicks Critical role for granulocyte colony-stimulating factor in inflammatory arthritis PNAS, August 3, 2004; 101(31): 11398 - 11403. [Abstract] [Full Text] [PDF] Y. Koga, A. Matsuzaki, A. Suminoe, H. Hattori, and T. Hara Neutrophil-Derived TNF-Related Apoptosis-Inducing Ligand (TRAIL): A Novel Mechanism of Antitumor Effect by Neutrophils Cancer Res., February 1, 2004; 64(3): 1037 - 1043. [Abstract] [Full Text] [PDF] A. Pellagatti, D. Vetrie, C. F. Langford, S. Gama, H. Eagleton, J. S. Wainscoat, and J. Boultwood Gene Expression Profiling in Polycythemia Vera Using cDNA Microarray Technology Cancer Res., July 15, 2003; 63(14): 3940 - 3944. [Abstract] [Full Text] [PDF] This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Rights and Permissions Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Suzuki, S. Articles by Asaka, M. Search for Related Content PubMed PubMed Citation Articles by Suzuki, S. Articles by Asaka, M. Related Collections Phagocytes Brief Reports Chemokines, Cytokines, and Interleukins Social Bookmarking                   What's this?

	Copyright © 2002 by American Society of Hematology         Online ISSN: 1528-0020