| |
|
|
|
|
|
|
|||
|
IMMUNOBIOLOGY
From INSERM U 255, Université Pierre et Marie
Curie, Hopital Européen Georges Pompidou, Paris, France; Institut
Ludwig for Cancer Research, Brussels Branch, Belgium; and Schering
Plough, Dardilly, France.
Interleukin 17 (IL-17) is a proinflammatory cytokine produced by
activated CD4+ memory T cells. We previously showed that
IL-17 increased the growth rate of human cervical tumors transplanted
into athymic nude mice. To address the possible role of T cells in the
biologic activity of IL-17 for tumor control, we grafted 2 murine
hematopoietic immunogenic tumors (P815 and J558L) transfected with a
complementary DNA encoding murine IL-17 into syngeneic immunocompetent
mice. We found that growth of the 2 IL-17-producing tumors was
significantly inhibited compared with that of mock-transfected tumors.
In contrast to the antitumor activity of IL-17 observed in
immunocompetent mice, we observed no difference in the in vivo growth
of IL-17-transfected or mock-transfected P815 cells (P815-IL-17 and
P815-Neo, respectively) transplanted into nude mice. We then showed
that IL-17 increased generation of specific cytolytic T lymphocytes
(CTLs) directed against the immunodominant antigens from P815 called A,
B, C, D, and E, since all mice injected with P815-IL-17 developed a P815-specific CTL response, whereas only 6 of 16 mice immunized with
P815-Neo had a specific CTL response against the antigens. The
induction of CTLs was associated with establishment of a
tumor-protective immunity. These experiments suggest that T lymphocytes
are involved in the antitumor activity of IL-17. Therefore, IL-17, like
other cytokines, appears to be a pleiotropic cytokine with possible protumor or antitumor effects on tumor development, which often depends
on the immunogenicity of tumor models.
(Blood. 2002;99:2114-2121) Interleukin-17 (IL-17), originally identified by
Rouvier et al1 as cytolytic T-lymphocyte (CTL)-associated
antigen 8, is a T-cell-derived cytokine with homology to
Herpesvirus saimiri.1-2 It is expressed mainly
by activated CD4+CD45RO+ memory T
cells.3-4 CD4 T cells can be classified into T-helper (Th)
1 cells, which secrete interferon (IFN) IL-17 is considered to be a proinflammatory cytokine because it
increases IL-6 and IL-8 production by macrophages, fibroblasts, keratinocytes, and synovial cells2,3,7-9 and nitric oxide production by human osteoarthritic cartilage.10,11 IL-17
also induces secretion of IL-1 The IL-17 receptor is a type I transmembrane protein that is expressed
in virtually all cells and tissues, in contrast to the restricted
expression of IL-17, which is confined to T cells.2,17 This receptor has no sequence similarity with any other known cytokine
receptor. It interacts with the adapter molecule TNF receptor-associated factor 6, which is required for IL-17
signaling.18
The exact role of IL-17 in disease is unknown. IL-17 has been found to
promote cartilage destruction in various forms of
arthritis.19,20 Overproduction of IL-17 has been observed
in the synovium of patients with rheumatoid arthritis21 and
in PB lymphocytes from patients with systemic sclerosis.22
In a previous study, we found that IL-17 promotes
tumorigenicity of human cervical tumors in nude
mice.23 Because this paradoxical tumor-promoting activity
of IL-17 in the absence of T cells was unexpected, we conducted the
current study to analyze the effect of IL-17 on the growth of syngeneic
tumors in immunocompetent mice. We found that IL-17 inhibits the growth
of 2 hematopoietic tumors, mastocytoma P815 and plasmocytoma J558L. Our
findings strongly suggest that T cells are involved in this antitumor
activity of IL-17.
Mice and tumor cell lines
Transfection of P815 and J558L cells
Enzyme-linked immunosorbent assay (ELISA) for mIL-17 An ELISA was used to measure mIL-17 in culture supernatants. Briefly, 96 breakaway microtiter plates with flat-bottomed wells (Nunc, Denmark) were coated with 100 µL anti-IL-17 antibody 8H4 (1 µg/mL) diluted in carbonate buffer (0.1 M sodium carbonate and sodium bicarbonate [pH 9.6]) overnight at 4°C. The plates were then saturated with 200 µL phosphate-buffered saline (PBS) and 1% bovine serum albumin (BSA) for 1 hour at room temperature. After washes with PBS and 0.05% Tween 20 (Merck, Schchardt, Germany), 100 µL recombinant mIL-17 or samples diluted in PBS and 1% BSA were added and incubation was allowed to proceed for 1.5 hours at 37°C. After washes, the plates were incubated with 100 µL nitrophenol (NIP)-labeled anti-IL-17 mAb 18H10 (0.5 µg/mL) diluted in PBS and 1% BSA for 1 hour at 37°C. After washes, 100 µL peroxidase-labeled anti-NIP (0.5 µg/mL) was added. One hour later, the reaction was revealed by addition of the peroxidase substrate (o-phenylenediamine dihydrochloride), and the optical density was read at a wavelength of 492 nm.Reverse transcriptase-polymerase chain reaction amplification for expression of mIL-17 messenger RNA RT-PCR was done as described previously.25 The following oligonucleotides were used: hypoxanthine phosphoribosyl transferase (HGPRT) sense, GTTGGATACAGGCCAGACTTTGTTG; HGPRT antisense, GATTCAACTTGCGCTCATCTTAGGC; mIL-17 sense, CACCCAGAGCACCAGCTGAT; and mIL-17 antisense, AATCAATAGCACGAACTG.In vitro growth assay P815 and J558L were plated on 96-well flat-bottomed plates at different concentrations. Cells were cultured for 3 days, and their proliferation was determined by using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as described previously.23Tumor growth in mice P815 and J558L tumor cells (1.5 × 106) were injected subcutaneously into DBA/2 and Balb/c mice, respectively. In some experiments, tumor cells were injected into athymic nude/nude mice. Eight to 10 mice per group were used in each experiment. Tumor volume (in microliters) was estimated from the dimensions of the tumor by using the following formula: volume = ab2/2, in which a was the length and b the width of the tumor.Immunization and detection of P815 ABCDE-specific CTLs Live P815-IL-17 or P815-Neo cells were injected into mice subcutaneously at 2 sites (5 × 105 cells/site). Two weeks later, blood (100 µL) was collected. In vitro stimulation of blood lymphocytes was done by mixing 3 × 105 lymphocytes purified with the Ficoll method with 105 irradiated (100 Gy) P815 cells and 2 × 106 irradiated (30 Gy) normal syngeneic spleen cells in 48-well plates (total volume, 0.8 mL). Cells were cultured for 7 days in Dulbecco modified Eagle medium supplemented with 10% FCS, L-arginine hydrochloric acid (116 mg/mL), L-asparagine (36 mg/mL), L-glutamine (216 mg/mL), glucose (4.5 g/L final concentration), 10 mM HEPES, and 5 × 10 5 M
2-mercaptoethanol.
Effector cells were harvested and then tested against P815 or P815A-E LUs were defined as the number of effector cells that lysed 50% of
104 targets cells in 4 hours. This number was estimated by
regression (1 Tumor-protection experiments DBA/2 mice were immunized with 5 × 104 live IL-17-transfected P815 cells. Eighteen days later, tumor-free mice were challenged with either wild-type P815 cells or KLN 205 carcinoma cells. In other experiments, DBA/2 mice were immunized with 5 × 104 IL-17-transfected P815 A-E cells. Fifteen
days later, tumor-free mice were challenged with wild-type P815
A-E cells.
Statistical analysis The Mann-Whitney test was used to analyze the in vivo differences in tumor size among the various groups of mice.
Characterization of IL-17-transfected P815 and J558L cell lines We transfected 2 hematopoietic cell lines, the mastocytoma P815 line and the plasmocytoma J558L line, with a cDNA encoding murine IL-17. Stable transfectants that expressed IL-17 mRNA after PCR amplification were obtained. In contrast, no mRNA expression for IL-17 was found in the parental cell lines or mock-transfected tumors (Figure 1A). Because this IL-17 signal could have been derived from contaminating plasmids associated with the extracted mRNA, we also assessed the culture supernatant for the presence of the protein. P815-IL-17 and J558L-IL-17 cells cultured for 72 hours secreted considerable amounts of IL-17 in their supernatants (3.5 ng/mL to 10 ng/mL for 5 × 105 cells; Figure 1B).
We then investigated the growth rate of wild-type, mock-transfected,
and IL-17-transfected cell lines. We found that IL-17-transfected and
mock-transfected tumors and parent cells (P815 and J558L) had identical
in vitro growth; Figure 2 shows a typical
experiment. Similar results were obtained after the cells were counted
on slides (data not shown).
Tumor growth of mock-transfected and IL-17-transfected P815 and J558L cells in immunocompetent mice The cell lines P815 and J558L, transfected with mIL-17 cDNA and then transplanted into immunocompetent DBA/2 and Balb/c mice, respectively, had a slower growth rate than mock-transfected cells (Figure 3A and 3B). For example, on day 19 after transplantation, a mean tumor volume of 2540 µL was observed with transplanted mock-transfected P815 cells (P815-Neo), whereas the tumor volume of the IL-17-transfected P815 cells was 938 µL (P < .05). This inhibitory activity of IL-17 on tumor growth was often apparent 12 to 15 days after tumor transplantation (Figure 3A and 3B). We did not find any significant difference between the growth of parental and mock-transfected tumors (data not shown). When high concentrations of tumor cells (> 106 cells) were used, IL-17 did not affect the tumor incidence rate, but when low concentrations were employed, the uptake of IL-17-expressing tumors decreased (data not shown).
To determine the in vivo persistence of the IL-17 transgene in tumors
transfected with mIL-17 cDNA and transplanted into mice, biopsies were
done on day 20 after transplantation. Murine IL-17 cDNA was detected in
all 4 biopsy specimens from mice given transplants of P815-IL-17 or
J558L-IL-17 cells but was not observed in mice previously given
injections of the control transfectants P815-Neo or J558L-Neo.
These findings indicated that the transgene was not lost during tumor
development (Figure 4).
Role of T lymphocytes in the antitumor activity of IL-17 Loss of IL-17-mediated antitumor activity in nude mice.
To investigate the possible role of T lymphocytes in the antitumor
activity of IL-17, we transplanted mIL-17-transfected or mock-transfected P815 cells into nude mice. In contrast to our finding
of inhibitory activity of IL-17 in immunocompetent mice, we observed no
difference in the in vivo growth of P815-IL-17 or P815 cells
transfected with the control plasmid P815-Neo (Figure 5). In agreement with these results,
IL-17 also did not inhibit growth of the J558L lymphoma in nude mice
(data not shown).
IL-17 increases generation of P815-specific CTLs.
P815 cells express 5 immunodominant antigens (A, B, C, D, and E)
recognized by most syngeneic CTLs.26 To measure
specifically the induction of CTLs directed against these antigens, we
used, in our cytotoxicity assay directed against P815, a 50-fold excess of an antigen-loss variant of P815 (P815A-E
In contrast, only 6 of the 16 mice immunized with P815-Neo had a specific CTL response against the P815 immunodominant antigens (Figure 6). This response was considered to be strong in only 2 of those mice (12%), whereas it was strong in 10 of the mice (62%) in which IL-17-producing tumor cells were used as immunogens (Figure 6). Mice not given transplants (controls) had no P815-specific CTL response (data not shown). The increase in CTL generation induced by IL-17 was not restricted to immunodominant antigens, since enhancement of CTL activity specific for P815 A-E was also observed
in spleens of mice in which IL-17-transfected P815 A-E cells had
been transplanted (data not shown).
To eliminate a possible direct activity of IL-17 on CTL effector
capacity, we measured the antitumor cytotoxicity of CTLs specific for
P815 A-E against P815 A-E tumor cells either producing or not
producing IL-17. We did not find any enhancement of the lysis of
IL-17-transfected P815A-E cells compared with that of P815A-E
cells (Figure 7). In addition, no
increase in expression of CTL effector molecules, such as perforin or
Fas-L, was observed when enriched CD8 T cells were stimulated with
recombinant IL-17 (data not shown).
It is notable that the ability of IL-17 to increase the generation of CTLs against the immunodominant antigens of P815 was observed only when live tumor cells were used in the immunization procedure. In experiments in which irradiated P815-Neo or P815-IL-17 cells were injected into mice, IL-17 production did not confer any benefit on the in vivo frequency of CTL induction (data not shown). Immunization with P815-IL-17 cells provides partial protection
against a challenge with wild-type P815.
We tested whether induction of CTLs was associated with
establishment of tumor-protective immunity. Because 40% to 60% of mice do not develop tumors when given subcutaneous injections with a
small number of P815-IL-17 cells (5 × 104), we
challenged tumor-free mice with parental P815. In the absence of
immunization, all mice developed tumors when given transplants of P815
cells. In some experiments, a few spontaneous rejections subsequently
occurred (Figure 8A).
In contrast, 80% of mice immunized with live P815-IL-17 cells were protected against challenge with wild-type P815 (Figure 8A). In control experiments to assess the specificity of this protection, we found that when irrelevant tumors, such as the KLN 205 melanoma, were transplanted into mice with or without immunization by P815-IL-17 cells, all mice developed tumors (Figure 8B). It was difficult to compare the protection induced by P815-IL-17 cells with that generated by P815 cells because, even at low concentrations, less than 15% of mice remained free of tumors after transplantation with P815 cells. Partial tumor protection against wild-type P815 A-E cells was also observed
in mice previously immunized with IL-17-transfected P815 A-E cells
(Figure 8C). In agreement with the results of the cytotoxicity assay,
when mice were immunized with irradiated P815-IL-17 or P815 Neo and
then challenged with wild-type P815, the tumor incidence ranged from
70% to 80%, with no differences related to the type of cells used in
the vaccination protocol (data not shown).
In this study, we found that IL-17 inhibited the growth rate of 2 hematopoietic tumors, mastocytoma P815 and lymphoma J558L, that were transplanted into immunocompetent mice. A direct effect of IL-17 on the in vivo proliferation of tumors seems unlikely to have occurred because wild-type, mock-transfected, and IL-17-transfected tumors showed the same in vitro proliferation kinetics (Figure 2). Several findings strongly suggest that a host-dependent mechanism involving T lymphocytes was involved in the antitumor activity of IL-17. First, when transplanted into nude mice, IL-17-transfected P815 cells and P815 cells transfected with the vector alone did not show any difference in growth in vivo (Figure 5). Second, IL-17 increased the generation of P815-specific CTLs, since all mice injected with P815-IL-17 developed a P815-specific CTL response, whereas CTL activity in the spleen was only found in 37% of mice given transplants of mock-transfected P815 (Figure 6). Third, when immunized with P815-IL-17, 80% of mice were protected against challenge with wild-type P815. Because of the unexpected tumor-inhibitory effects of control immunoglobulins, we could not demonstrate directly by means of depletion experiments that this protection was mediated by T lymphocytes. However, we showed that this tumor immunity was specific to the tumor cells used for immunization, since no protection was observed in mice challenged with irrelevant tumors. Furthermore, other researchers previously found that induction of protective immunity against P815 is always under the control of T lymphocytes.27,28 Different mechanisms may contribute to the IL-17 enhancement of tumor-specific T cells. We and others showed that IL-17 increases production of IL-6 by different cell lines.23,29 In addition, we here observed increased expression of IL-6 in biopsy specimens from IL-17-producing tumors compared with parent or mock-transfected tumors (data not shown). Because previous studies in immunogenic models showed that the antitumor activity of IL-6 was associated with induction of tumor-specific CTLs,30-32 IL-6 may play a role in the activation of specific T cells by IL-17. Jovanovic et al7 reported that IL-17 stimulated the secretion of IL-12 by macrophages. IL-12 is known to be a cytokine that promotes Th1 immunity and leads to activation of CTLs.33 It has also been used as an adjuvant to elicit CTLs against tumor antigens in mice.34 Increasing evidence suggests that tumor cells do not directly activate T lymphocytes and that dendritic cells (DCs) are responsible for the presentation of tumor antigens to T cells.35,36 T-cell priming during tumor development may be inefficient because DCs are most often blocked in an immature state inside tumors.37 IL-17 promotes maturation of DC progenitors, as indicated by increases in cell-surface expression of costimulatory molecules, major histocompatibility complex class II antigens, and allostimulatory capacity when CD11+ DCs were treated with IL-17.38 This may lead to an improvement in T-cell priming by tumor cells producing IL-17. Furthermore, we have found that IL-17 recruits cells from the monocyte-macrophage lineage in the tumor microenvironment23 (data not shown) and that this process may be the result of induction of specific chemokines.39 In contrast, in neither the previous study23 nor the current study (data not shown) did we observe any recruitment of neutrophils at the tumor site. A direct role of IL-17 on T lymphocytes could not be excluded because an IL-17 antagonist inhibited IL-2 production and T-cell proliferation induced by alloantigens or mitogens, suggesting a key role for endogenously produced IL-17 in T-cell growth.2,40 However, we did not observe a direct influence of IL-17 on the CTL effector capacity, since IL-17 did not enhance the activity of specific CTLs in a cytotoxicity assay. IL-17 also did not increase expression of CTL effector molecules such as perforin or Fas-L (data not shown). It is notable that we found that irradiation of tumor cells eliminated the IL-17 effect on the enhancement of specific CTLs and the induction of tumor immunity. Other researchers have also reported that proliferating tumor cells deliver a stronger immunogenic signal than nonproliferating tumors.41 Furthermore, in some models, irradiation enhances the immunogenicity of tumors, and this could compete with and mask the adjuvant properties of other immunostimulatory molecules.42 Although our results indicate a role for T cells in the antitumor activity of IL-17, we cannot exclude the possibility that other effectors cooperate with T cells to inhibit tumor growth. Enhancement of natural killer activity appears to be associated with reduction of metastatic lung nodules in mice given transplants of tumors transfected with IL-17.43 In conclusion, IL-17 appears to be a pleiotropic cytokine, since human tumors transfected with IL-17 showed increased growth in nude mice,23 whereas immunogenic tumors were inhibited in immunocompetent mice by means of a T-cell-dependent mechanism. These opposite activities in the regulation of tumor growth are not restricted to IL-17 but may also be demonstrated by other cytokines.44,45 For example, IL-6 is considered to be an in vivo growth factor for lymphoma or plasmocytoma transplanted into immunocompetent mice, and it was found to increase the proliferation of human tumors transplanted into nude mice.46-48 However, IL-6 also inhibited the growth of immunogenic tumors by stimulating antitumor T-cell activity.30-32,49,50 Similarly, several studies showed that IL-4 has a potent antitumor activity that does not appear to be T-cell dependent.51,52 In contrast, a protumor activity of IL-4 mediated by Th2 lymphocytes has also been reported.53 These antagonistic activities of cytokines in the regulation of tumor growth, which often depends on the immunogenicity of the tumor model, must be taken into consideration when these molecules are used in trials of immunotherapy.
We thank Anne Moineau and Isabelle Joyeux for expert technical assistance and John Abrams for providing the anti-IL-17 antibodies. Note: During revision of the manuscript for this paper, Hirahara et al54 showed that IL-17 induced a T-cell-dependent, tumor-specific immunity in another tumor model.
Submitted May 24, 2001; accepted October 29, 2001.
Supported by Université Pierre et Marie Curie, the Institut National de la Santé et de la Recherche Médicale, the Ligue Nationale Contre le Cancer l'Association pour la Recherche contre le Cancer, and the Indo-French Center for the Promotion of Advanced Research. A.C. was a fellow of the Ligue Nationale contre le Cancer and the Fondation pour la Recherche Médicale.
F.F. has declared a financial interest in Schering Plough, whose potential product was studied in the present work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Eric Tartour, Unité d'Immunologie Biologique, Hopital Européen Georges Pompidou, 20 Rue Leblanc, 75908 Paris Cedex 15; e-mail: eric.tartour{at}egp.ap-hop-paris.fr.
1. Rouvier E, Luciani MF, Mattei MG, Denizot F, Golstein P. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene. J Immunol. 1993;150:5445-5456[Abstract]. 2. Yao Z, Fanslow WC, Seldin MF, et al. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity. 1995;3:811-821[CrossRef][Medline] [Order article via Infotrieve].
3.
Fossiez F, Djossou O, Chomarat P, et al.
T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines.
J Exp Med.
1996;183:2593-2603 4. Spriggs MK. Interleukin-17 and its receptor. J Clin Immunol. 1997;17:366-369[CrossRef][Medline] [Order article via Infotrieve].
5.
Aarvak T, Chabaud M, Miossec P, Natvig JB.
IL-17 is produced by some proinflammatory Th1/Th0 cells but not by Th2 cells.
J Immunol.
1999;162:1246-1251
6.
Ziolkowska M, Koc A, Luszczykiewicz G, et al.
High levels of IL-17 in rheumatoid arthritis patients: IL-15 triggers in vitro IL-17 production via cyclosporin A-sensitive mechanism.
J Immunol.
2000;164:2832-2838
7.
Jovanovic DV, Di Battista JA, Martel-Pelletier J, et al.
IL-17 stimulates the production and expression of proinflammatory cytokines, IL-
8.
Teunissen MB, Koomen CW, de Waal Malefyt R, Wierenga EA, Bos JD.
Interleukin-17 and interferon-
9.
Chabaud M, Fossiez F, Taupin JL, Miossec P.
Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines.
J Immunol.
1998;161:409-414
10.
Shalom-Barak T, Quach J, Lotz M.
Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF- 11. Attur MG, Patel RN, Abramson SB, Amin AR. Interleukin-17 up-regulation of nitric oxide production in human osteoarthritis cartilage. Arthritis Rheum. 1997;40:1050-1053[Medline] [Order article via Infotrieve]. 12. Kurasawa K, Hirose K, Sano H, et al. Increased interleukin-17 production in patients with systemic sclerosis. Arthritis Rheum. 2000;43:2455-2463[CrossRef][Medline] [Order article via Infotrieve].
13.
Awane M, Andres PG, Li DJ, Reinecker HC.
NF-
14.
Laan M, Cui ZH, Hoshino H, et al.
Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways.
J Immunol.
1999;162:2347-2352
15.
Schwarzenberger P, Huang W, Ye P, et al.
Requirement of endogenous stem cell factor and granulocyte-colony-stimulating factor for IL-17-mediated granulopoiesis.
J Immunol.
2000;164:4783-4789
16.
Witowski J, Pawlaczyk K, Breborowicz A, et al.
IL-17 stimulates intraperitoneal neutrophil infiltration through the release of GRO 17. Yao Z, Spriggs MK, Derry JM, et al. Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine. 1997;9:794-800[CrossRef][Medline] [Order article via Infotrieve].
18.
Schwandner R, Yamaguchi K, Cao Z.
Requirement of tumor necrosis factor receptor-associated factor (TRAF) 6 in interleukin 17 signal transduction.
J Exp Med.
2000;191:1233-1240 19. Kotake S, Udagawa N, Takahashi N, et al. IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 1999;103:1345-1352[Medline] [Order article via Infotrieve]. 20. Chabaud M, Garnero P, Dayer JM, Guerne PA, Fossiez F, Miossec P. Contribution of interleukin 17 to synovium matrix destruction in rheumatoid arthritis. Cytokine. 2000;12:1092-1099[CrossRef][Medline] [Order article via Infotrieve]. 21. Chabaud M, Durand JM, Buchs N, et al. Human interleukin-17: a T cell-derived proinflammatory cytokine produced by the rheumatoid synovium. Arthritis Rheum. 1999;42:963-970[CrossRef][Medline] [Order article via Infotrieve].
22.
Matusevicius D, Kivisakk P, He B, et al.
Interleukin-17 mRNA expression in blood and CSF mononuclear cells is augmented in multiple sclerosis.
Mult Scler.
1999;5:101-104
23.
Tartour E, Fossiez F, Joyeux I, et al.
Interleukin 17, a T-cell-derived cytokine, promotes tumorigenicity of human cervical tumors in nude mice.
Cancer Res.
1999;59:3698-3704 24. Daeron M, Latour S, Malbec O, et al. The same tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc gamma RIIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation. Immunity. 1995;3:635-646[CrossRef][Medline] [Order article via Infotrieve]. 25. Haicheur N, Escudier B, Dorval T, et al. Cytokines and soluble cytokine receptor induction after IL-12 administration in cancer patients. Clin Exp Immunol. 2000;119:28-37[CrossRef][Medline] [Order article via Infotrieve]. 26. Brichard VG, Warnier G, Van Pel A, Morlighem G, Lucas S, Boon T. Individual differences in the orientation of the cytolytic T cell response against mouse tumor P815. Eur J Immunol. 1995;25:664-671[Medline] [Order article via Infotrieve]. 27. Brandle D, Bilsborough J, Rulicke T, Uyttenhove C, Boon T, Van den Eynde BJ. The shared tumor-specific antigen encoded by mouse gene P1A is a target not only for cytolytic T lymphocytes but also for tumor rejection. Eur J Immunol. 1998;28:4010-4019[CrossRef][Medline] [Order article via Infotrieve]. 28. Rosato A, Zambon A, Milan G, et al. CTL response and protection against P815 tumor challenge in mice immunized with DNA expressing the tumor-specific antigen P815A. Hum Gene Ther. 1997;8:1451-1458[Medline] [Order article via Infotrieve]. 29. Fossiez F, Banchereau J, Murray R, Van Kooten C, Garrone P, Lebecque S. Interleukin-17. Int Rev Immunol. 1998;16:541-551[Medline] [Order article via Infotrieve].
30.
Porgador A, Tzehoval E, Katz A, et al.
Interleukin 6 gene transfection into Lewis lung carcinoma tumor cells suppresses the malignant phenotype and confers immunotherapeutic competence against parental metastatic cells.
Cancer Res.
1992;52:3679-3686
31.
Mullen CA, Coale MM, Levy AT, et al.
Fibrosarcoma cells transduced with the IL-6 gene exhibited reduced tumorigenicity, increased immunogenicity, and decreased metastatic potential.
Cancer Res.
1992;52:6020-6024 32. Mule JJ, Custer MC, Travis WD, Rosenberg SA. Cellular mechanisms of the antitumor activity of recombinant IL-6 in mice. J Immunol. 1992;148:2622-2629[Abstract]. 33. Trinchieri G. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv Immunol. 1998;70:83-243[Medline] [Order article via Infotrieve].
34.
Noguchi Y, Richards EC, Chen YT, Old LJ.
Influence of interleukin 12 on p53 peptide vaccination against established Meth A sarcoma.
Proc Natl Acad Sci U S A.
1995;92:2219-2223
35.
Chiodoni C, Paglia P, Stoppacciaro A, Rodolfo M, Parenza M, Colombo MP.
Dendritic cells infiltrating tumors cotransduced with granulocyte/macrophage colony-stimulating factor (GM-CSF) and CD40 ligand genes take up and present endogenous tumor-associated antigens, and prime naive mice for a cytotoxic T lymphocyte response.
J Exp Med.
1999;190:125-133
36.
Huang A-Y, Golumbek P, Ahmadzadeh M, Jaffee E, Pardoll D, Levitsky H.
Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens.
Science.
1994;264:961-965
37.
Bell D.
In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas.
J Exp Med.
1999;190:1417-1426
38.
Antonysamy MA.
Evidence for a role of IL-17 in organ allograft rejection: IL-17 promotes the functional differentiation of dendritic cell progenitors.
J Immunol.
1999;162:577-584 39. Van Kooten C. Interleukin-17 activates human renal epithelial cells in vitro and is expressed during renal allograft rejection. J Am Soc Nephrol. 1998;9:1526-1534[Abstract]. 40. Yao Z, Painter SL, Fanslow WC, et al. Human IL-17: a novel cytokine derived from T cells. J Immunol. 1995;155:5483-5486[Abstract].
41.
Cavallo F, Signorelli P, Giovarelli M, et al.
Antitumor efficacy of adenocarcinoma cells engineered to produce interleukin 12 (IL-12) or other cytokines compared with exogenous IL-12.
J Natl Cancer Inst.
1997;89:1049-1058
42.
Hock H, Dorsch M, Kunzendorf U, et al.
Vaccinations with tumor cells genetically engineered to produce different cytokines: effectivity not superior to a classical adjuvant.
Cancer Res.
1993;53:714-716 43. Hirahara N, Nio Y, Sasaki S. Reduced invasiveness and metastasis of Chinese hamster ovary cells transfected with human interleukin-17 gene. Anticancer Res. 2000;20:3137-3142[Medline] [Order article via Infotrieve]. 44. Tartour E, Fridman WH. Cytokines and cancer. Int Rev Immunol. 1998;16:683-704[Medline] [Order article via Infotrieve].
45.
Qin Z, Kruger-Krasagakes S, Kunzendorf U, Hock H, Diamantstein T, Blankenstein T.
Expression of tumor necrosis factor by different tumor cell lines results either in tumor suppression or augmented metastasis.
J Exp Med.
1993;178:355-360
46.
Vink A, Coulie P, Warnier G, et al.
Mouse plasmacytoma growth in vivo: enhancement by interleukin 6 (IL-6) and inhibition by antibodies directed against IL-6 or its receptor.
J Exp Med.
1990;172:997-1000 47. Durandy A, Emilie D, Peuchmaur M, et al. Role of IL-6 in promoting growth of human EBV-induced B-cell tumors in severe combined immunodeficient mice. J Immunol. 1994;152:5361-5367[Abstract]. 48. Lu C, Sheehan C, Rak JW, Chambers CA, Hozumi N, Kerbel RS. Endogenous interleukin 6 can function as an in vivo growth-stimulatory factor for advanced-stage human melanoma cells. Clin Cancer Res. 1996;2:1417-1425[Abstract]. 49. Armstrong CA, Murray N, Kennedy M, Koppula SV, Tara D, Ansel JC. Melanoma-derived interleukin 6 inhibits in vivo melanoma growth. J Invest Dermatol. 1994;102:278-284[CrossRef][Medline] [Order article via Infotrieve]. 50. Katz A, Shulman LM, Revel M, Feldman M, Eisenbach L. Combined therapy with IL-6 and inactivated tumor cells suppresses metastasis in mice bearing 3LL lung carcinomas. Int J Cancer. 1993;53:812-818[Medline] [Order article via Infotrieve].
51.
Tepper RI, Coffman RL, Leder P.
An eosinophil-dependent mechanism for the antitumor effect of interleukin-4.
Science.
1992;257:548-551 52. Wei MX, Tamiya T, Hurford RK Jr, Boviatsis EJ, Tepper RI, Chiocca EA. Enhancement of interleukin-4-mediated tumor regression in athymic mice by in situ retroviral gene transfer. Hum Gene Ther. 1995;6:437-443[Medline] [Order article via Infotrieve].
53.
Kobayashi M, Kobayashi H, Pollard R-B, Suzuki F.
A pathogenic role of Th2 cells and their cytokine products on the pulmonary metastasis of murine B16 melanoma.
J Immunol.
1998;160:5869-5873 54. Hirahara N, Nio Y, Sasaki S, et al. Inoculation of human interleukin-17 gene-transfected Meth-A fibrosarcoma cells induces T cell-dependent tumor-specific immunity in mice. Oncology. 2001;61:79-89[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
J. M. Coquet, S. Chakravarti, K. Kyparissoudis, F. W. McNab, L. A. Pitt, B. S. McKenzie, S. P. Berzins, M. J. Smyth, and D. I. Godfrey Diverse cytokine production by NKT cell subsets and identification of an IL-17-producing CD4-NK1.1- NKT cell population PNAS, August 12, 2008; 105(32): 11287 - 11292. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Muranski, A. Boni, P. A. Antony, L. Cassard, K. R. Irvine, A. Kaiser, C. M. Paulos, D. C. Palmer, C. E. Touloukian, K. Ptak, et al. Tumor-specific Th17-polarized cells eradicate large established melanoma Blood, July 15, 2008; 112(2): 362 - 373. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Flierl, D. Rittirsch, H. Gao, L. M. Hoesel, B. A. Nadeau, D. E. Day, F. S. Zetoune, J. V. Sarma, M. S. Huber-Lang, J. L. M. Ferrara, et al. Adverse functions of IL-17A in experimental sepsis FASEB J, July 1, 2008; 22(7): 2198 - 2205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Le Gouvello, S Bastuji-Garin, N Aloulou, H Mansour, M-T Chaumette, F Berrehar, A Seikour, A Charachon, M Karoui, K Leroy, et al. High prevalence of Foxp3 and IL17 in MMR-proficient colorectal carcinomas Gut, June 1, 2008; 57(6): 772 - 779. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Badoual, G. Bouchaud, N. E. H. Agueznay, E. Mortier, S. Hans, A. Gey, F. Fernani, S. Peyrard, P. L. -Puig, P. Bruneval, et al. The Soluble {alpha} Chain of Interleukin-15 Receptor: A Proinflammatory Molecule Associated with Tumor Progression in Head and Neck Cancer Cancer Res., May 15, 2008; 68(10): 3907 - 3914. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Nam, M. Terabe, M.-J. Kang, H. Chae, N. Voong, Y.-a. Yang, A. Laurence, A. Michalowska, M. Mamura, S. Lonning, et al. Transforming Growth Factor {beta} Subverts the Immune System into Directly Promoting Tumor Growth through Interleukin-17 Cancer Res., May 15, 2008; 68(10): 3915 - 3923. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yusuf, T. H. Nasti, S. K. Katiyar, M. K. Jacobs, M. D. Seibert, A. C. Ginsburg, L. Timares, H. Xu, and C. A. Elmets Antagonistic Roles of CD4+ and CD8+ T-Cells in 7,12-Dimethylbenz(a)anthracene Cutaneous Carcinogenesis Cancer Res., May 15, 2008; 68(10): 3924 - 3930. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yusuf, T. H. Nasti, J. A. Long, M. Naseemuddin, A. P. Lucas, H. Xu, and C. A. Elmets Protective Role of Toll-like Receptor 4 during the Initiation Stage of Cutaneous Chemical Carcinogenesis Cancer Res., January 15, 2008; 68(2): 615 - 622. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Liu, J.-P. Tsai, C.-R. Shen, Y.-P. Sher, C.-L. Hsieh, Y.-C. Yeh, A.-H. Chou, S.-R. Chang, K.-N. Hsiao, F.-W. Yu, et al. Induction of a distinct CD8 Tnc17 subset by transforming growth factor-{beta} and interleukin-6 J. Leukoc. Biol., August 1, 2007; 82(2): 354 - 360. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Numasaki, M. Tagawa, F. Iwata, T. Suzuki, A. Nakamura, M. Okada, Y. Iwakura, S. Aiba, and M. Yamaya IL-28 Elicits Antitumor Responses against Murine Fibrosarcoma J. Immunol., April 15, 2007; 178(8): 5086 - 5098. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Goetz, V. J. Suman, J. N. Ingle, A. M. Nibbe, D. W. Visscher, C. A. Reynolds, W. L. Lingle, M. Erlander, X.-J. Ma, D. C. Sgroi, et al. A two-gene expression ratio of homeobox 13 and interleukin-17B receptor for prediction of recurrence and survival in women receiving adjuvant tamoxifen. Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2080 - 2087. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. You, X.-B. Shi, G. DuRaine, D. Haudenschild, C. G. Tepper, S. Hao Lo, R. Gandour-Edwards, R. W. de Vere White, and A. H. Reddi Interleukin-17 Receptor-Like Gene Is a Novel Antiapoptotic Gene Highly Expressed in Androgen-Independent Prostate Cancer Cancer Res., January 1, 2006; 66(1): 175 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umemura, T. Kawabe, K. Shudo, H. Kidoya, M. Fukui, M. Asano, Y. Iwakura, G. Matsuzaki, R. Imamura, and T. Suda Involvement of IL-17 in Fas ligand-induced inflammation Int. Immunol., August 1, 2004; 16(8): 1099 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Dodon, Z. Li, S. Hamaia, and L. Gazzolo Tax protein of human T-cell leukaemia virus type 1 induces interleukin 17 gene expression in T cells J. Gen. Virol., July 1, 2004; 85(7): 1921 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, et al. Cutting Edge: Roles of Toll-Like Receptor 4 and IL-23 in IL-17 Expression in Response to Klebsiella pneumoniae Infection J. Immunol., May 1, 2003; 170(9): 4432 - 4436. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Numasaki, J.-i. Fukushi, M. Ono, S. K. Narula, P. J. Zavodny, T. Kudo, P. D. Robbins, H. Tahara, and M. T. Lotze Interleukin-17 promotes angiogenesis and tumor growth Blood, April 1, 2003; 101(7): 2620 - 2627. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||