|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From Weill Medical College of Cornell University,
Division of Hematology/Oncology, New York, NY; and Molecular/Cancer
Biology Laboratory, Haartman Institute, University of Helsinki,
Finland.
Similar to solid tumors, growth of leukemias may also be
angiogenesis dependent. Furthermore, tyrosine kinase receptors specific to endothelial cells are expressed on certain subsets of leukemias. We
have previously demonstrated the existence of a VEGF/VEGFR-2 autocrine
loop on leukemic cells that supports their growth and migration. Here,
we demonstrate that in response to leukemia-derived proangiogenic and
proinflammatory cytokines such as basic fibroblast growth factor and
IL-1, endothelial cells release increasing amounts of another vascular
endothelial growth factor (VEGF) family member, VEGF-C. In turn,
interaction of VEGF-C with its receptor VEGFR-3 (FLT-4) promotes
leukemia survival and proliferation. We demonstrate in 2 cell lines and
5 FLT-4+ leukemias that VEGF-C and a mutant form of the
molecule that lacks the KDR-binding motif induce receptor
phosphorylation, leukemia proliferation, and increased survival, as
determined by increased Bcl-2/Bax ratios. Moreover, VEGF-C protected
leukemic cells from the apoptotic effects of 3 chemotherapeutic agents.
Because most leukemic cells release proangiogenic as well as
proinflammatory cytokines, our data suggest that the generation of a
novel paracrine angiogenic loop involving VEGF-C and FLT-4 may promote
the survival of a subset of leukemias and protect them from
chemotherapy-induced apoptosis. These results identify the VEGF-C/FLT-4
pathway as a novel therapeutic target for the treatment of subsets of
acute leukemia.
(Blood. 2002;99:2179-2184) It has been suggested that, similar to solid
tumors, neovasculature in the bone marrow of leukemia patients may
regulate the growth of leukemia in a paracrine fashion.1-3
We and others have shown that bone marrow endothelium releases leukemic
growth factors such as granulocyte-macrophage colony-stimulating
factor, interleukin (IL)-6, and IL-10.4-6 In turn, tumor
cells such as leukemias release angiogenic growth factors In the present report, we demonstrate that another member of the VEGF
family, VEGF-C, promotes survival and proliferation of a subset of
acute leukemias. VEGF-C has been characterized as a lymphangiogenic and
angiogenic growth factor and shown to signal through the
receptors VEGFR-3 (FLT-4) and VEGFR-2 (KDR).9-12 In addition, recent studies in solid tumor murine models have correlated increased tumor-derived VEGF-C levels with lymphangiogenesis and lymphatic metastasis,13 suggesting a role of VEGF-C in
tumor progression by acting on lymphatic endothelium.
Endothelial cells express the VEGF-C receptor, FLT-4, and produce
VEGF-C, particularly in response to proinflammatory cytokines such as
IL-1 and tumor necrosis factor.14,15 Subsets of leukemic cells have also been shown to express FLT-4.16 However, it
has not been demonstrated whether FLT-4 is functional on these
malignant cells and conveys signals similar to those seen on
endothelial cells. Given that leukemic cells release proangiogenic as
well as proinflammatory cytokines like basic fibroblast growth factor (bFGF), IL-1, and tumor necrosis factor,
respectively,17-19 we hypothesize that VEGF-C production
by endothelial cells may be up-regulated in response to such cytokines.
In turn, as indicated by our results, VEGF-C may then support leukemic
survival and proliferation and protect FLT-4+ leukemias
from chemotherapy-induced apoptosis. Taken together, our results
suggest the existence of a novel angiogenic paracrine loop involving
VEGF-C and its receptor FLT-4, which may contribute to the progression
of a subset of acute leukemias and may function to protect the leukemic
cells from the proapoptotic effects of chemotherapy. We identify the
VEGFC/FLT-4 system as a potential target for therapeutic intervention
in acute leukemia.
All materials were obtained from Sigma Chemicals unless
otherwise stated.
Cytokines/reagents
Primary cells and cell lines
RNA extraction, complementary DNA synthesis, and RT-PCR Endothelial and leukemic cells were analyzed for KDR, VEGF-C, and FLT-4 expression by reverse transcriptase-polymerase chain reaction (RT-PCR) and Western analysis. For PCR, total RNA was extracted using TRI reagent following the manufacturer's instructions (Life Technologies, Rockville, MD). Complementary DNA was subsequently synthesized from total cellular RNA using First Strand Synthesis Kit (Life Technologies), and PCR was performed using a PCR thermal cycler (MWG Biotech, High Point, NC). The PCR program used to amplify VEGF-C, FLT-4, and -actin consisted of a precycle of 5 minutes at 94°C, 45 seconds at 60°C, and 45 seconds at 72°C. Following this initial
cycle, the reaction was continued for 35 cycles of 1 minute at 94°C,
45 seconds at 65°C, and 2 minutes at 72°C and concluded with 7 minutes at 72°C. The primer sequences were as follows: -actin
forward primer: TCATGTTTGAGACCTTCAA; -actin reverse primer:
GTCTTTGCGGATGTCCACG (-actin PCR product: 513 base pairs [bp]);
VEGF-C forward primer: GTGACCAACATGGAGTCGTG; VEGF-C reverse
primer: CCAGAGATTCCATGCCACTT (VEGF-C PCR product: 660 bp); FLT-4
forward primer: ATTTGTGATTTTGGCCTTGC; FLT-4 reverse primer:
CAGGCTCATGAACTTGAAAGC (FLT-4 PCR product: 550 bp); KDR forward primer:
GTGACCAACATGGAGTCGTG; and KDR reverse primer: CCAGAGATTCCATGCCACTT
(KDR PCR product: 660 bp).
Protein extraction and Western blotting Phosphorylated VEGFR-3/FLT-4 was detected by Western blotting. Cells were serum-starved overnight, and specified wells were pretreated 1 hour with the tyrosine kinase inhibitor AG1433 (2 µg/mL). Cells were then incubated with 100 ng/mL VEGF-C or 200 ng/mL mutant VEGF-C for 10 minutes at 37°C. After this brief stimulation, total protein extracts from leukemic cell lines and HUVECs were obtained by lysing the cells in cold radioimmunoprecipitation assay (RIPA) buffer (50 mM/L Tris, 5 mM/L ethylenediaminetetraacetic acid, 1% Triton X-114, 0.4% sodium cacodylate, and 150 mM NaCl) in the presence of protease inhibitors (1 mg/mL aprotinin, 10 mg/mL leupeptin, 1 mmol/L-glycerophosphate, 1 mM sodium orthovanadate, and 1 mM/L
phenylmethylsulfonyl fluoride). After centrifugation to remove cell
debris, supernatants (a total protein minimum of 500 ng) were
immunoprecipitated overnight at 4°C with protein G-agarose beads and
an antiphosphotyrosine antibody (Santa Cruz, Biotechnology) to
precipitate phosphorylated proteins (in the case of leukemia cell
lines) or with a mouse antihuman FLT-4 monoclonal antibody (provided by
K.A.) (in the case of the primary leukemias). Precipitated
proteins/antibody/beads were washed twice, resuspended in loading
buffer, and then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (7.5% gels) under reducing conditions (in the
presence of -mercaptoethanol). Proteins were subsequently blotted
onto a nitrocellulose membrane following conventional protocols.
Finally, blots were blocked in 1% bovine serum
albumin/phosphate-buffered saline-0.1% Tween 20 for 1 hour at room
temperature followed by incubation with primary and secondary
antibodies. Antibodies used included the mouse antihuman FLT-4 and a
secondary peroxidase-labeled goat antimouse antibody. For
coimmunoprecipitation experiments, cell extracts were incubated with
anti-FLT-4 antibody and blotted with an anti-KDR antibody. The ECL
chemiluminescence detection system and ECL film (Amersham Pharmacia
Biotech, Piscataway, NJ) were used to visualize the presence of
proteins on the nitrocellulose blots.
Cell proliferation/survival assays For proliferation studies, cells (1 × 105/mL) were cultured in serum-free RPMI medium for 6 hours before addition of the cytokines. Cells were collected, spun down, and counted after 24 and 48 hours. Cell number and viability were determined by trypan blue exclusion. Each experiment was done in triplicate, and experiments with the leukemic cell lines were performed twice. To investigate in greater detail the prosurvival mechanisms of VEGF-C, HEL and THP-1 cells were treated 24 hours in serum-free conditions in the absence or presence of VEGF-C (100 ng/mL) or mutVEGF-C (200 ng/mL), and levels of proapoptotic and antiapoptotic molecules, Bcl-2 and Bax, were measured by Western analysis.Chemotherapy and leukemia survival All 6 primary leukemias and the cell lines HEL and THP-1 (1 × 106 cells per condition) were left untreated or pretreated with VEGF-C (100 ng/mL) for 24 hours in serum-free conditions. In some conditions, VEGF-C was readded to the culture medium together with chemotherapeutic agents daily. After 48 hours, cells were collected and stained with the annexin V apoptosis kit following the manufacturer's instructions. Results are shown as the total number of annexin+ cells after 48 hours, as determined by flow cytometry analysis. Appropriate treatment concentrations of chemotherapeutic agents were assessed by preliminary titration experiments treating serum-starved HEL cells over a 48- to 72-hour period. Treatment concentrations used for subsequent experiments were as follows: cytarabine (Ara-C 200 ng/mL), daunorubicin (200 ng/mL), and etoposide (1 µM).Statistical analysis Statistical analysis was performed with data expressed as mean (SEM of 3 independent experiments, each experimental condition done in triplicate). To detect differences between data sets, the Student t test (2-tailed) was applied in which P < .05 was considered statistically significant.
Production of VEGF-C by HUVECs and up-regulation by leukemia-derived cytokines We demonstrate that HUVECs transcribe VEGF-C, as determined by RT-PCR (data not shown). Moreover, HUVECs also release VEGF-C into the cell culture medium, as determined by immunoprecipitation of cell culture supernatants (in serum-free conditions) with VEGF-C-specific antibodies (Figure 1A). Treatment of HUVECs with the proinflammatory cytokine IL-1 or proangiogenic
factor bFGF increased the production of VEGF-C over a 24-hour period
(Figure 1). Importantly, this increase is not due to an overall
increase in protein synthesis, as shown with the Western blot against
actin (Figure 1A).
FLT-4 is expressed by subsets of leukemia and activated upon VEGF-C stimulation We examined FLT-4 and KDR expression, by RT-PCR, in leukemic cell lines representing different leukemic subsets, including HEL (megakaryocytic), THP-1 (monocytic), and HL-60 (promyelocytic). As previously shown, the 3 leukemic cell lines expressed KDR, whereas only HEL and THP-1 were FLT-4+ (data not shown).We also analyzed 19 freshly isolated peripheral blood leukemic samples for FLT-4 and KDR expression by RT-PCR. Of the 19 samples, 6 acute myeloid leukemias, 2 acute lymphocytic leukemias, and 1 chronic lymphocytic leukemia expressed FLT-4 at the messenger RNA level (data not shown). Six samples were subsequently chosen for further analysis, including 1 acute lymphocytic leukemia (referred to as sample 1) and 5 acute myeloid leukemias (samples 2-6). Of note, samples 1, 3, 4, 5, and 6 expressed FLT-4 and KDR, as determined by RT-PCR and flow cytometry, whereas sample 2 expressed KDR but not FLT-4 (data not shown). We next investigated whether FLT-4, present on primary leukemias and
the cell lines HEL and THP-1, was functional by analyzing ligand-induced receptor autophosphorylation. VEGF-C induced FLT-4 phosphorylation on HEL, THP-1 (Figure
2A), and the 5 FLT-4+ primary
leukemias (Figure 2D), similar to its effects on HUVECs. In addition,
we demonstrate in coimmunoprecipitation experiments that VEGF-C may
induce FLT-4/KDR heterodimerization (data for HEL shown in Figure 2B).
In a subsequent immunoprecipitation study in HEL cells (Figure 2C),
stimulation with either VEGF or VEGF-C led to the phosphorylation of
both FLT-4 and KDR, an effect abrogated by a general tyrosine kinase
inhibitor (AG1433). Similar results were seen in THP-1 cells and the
FLT-4+ leukemias (data not shown). This suggests that
binding of VEGF family members to their receptor(s) on leukemias may
lead to the recruitment and activation of other signaling molecules
such as other VEGF receptor tyrosine kinases.
VEGF-C induces leukemia proliferation We next investigated whether VEGF-C binding to its receptor on leukemic cells resulted in any phenotypic changes. VEGF-C increased leukemic cell proliferation in a dose-dependent manner (data shown for THP-1 cells, Figure 3A). Treatment at a concentration of 200 ng/mL led to an approximately 2-fold increase in viable cells compared with the untreated population. Notably, a mutant-form of VEGF-C (mutVEGF-C), capable of binding and signaling only through FLT-4 and not KDR, also induced leukemic cell proliferation, although to a lesser extent than that seen for VEGF-C (shown for HEL cells, Figure 3B). The proliferative effects of VEGF-C and mutVEGF-C were observed in both HEL and THP-1 cell lines as well as the 5 FLT-4+ primary samples analyzed (*P < .05 compared with untreated cells, Figure 3C). Importantly, sample 2 (KDR+ but FLT-4 ) did
not respond to the proliferative effects of VEGF-C (Figure 3C). This
result demonstrates that on subsets of leukemias VEGF-C induces
leukemic proliferation by interacting through FLT-4 and KDR.
VEGF-C and mutVEGF-C also induce prosurvival effects We used the 2 leukemic cell lines to investigate further the mechanisms by which VEGF-C promoted cell survival. Treatment of serum-starved THP-1 and HEL cells with VEGF-C or mutVEGF-C induced an up-regulation in Bcl-2 expression within 24 hours (Figure 4A). The levels of Bax remained fairly constant (Figure 4A), resulting in increased Bcl-2/Bax ratios (Figure 4B). This suggests that one mechanism by which VEGF-C may promote leukemic cell survival is through inhibition of apoptosis. Because mutVEGF-C produces similar effects on leukemia survival and Bcl-2 induction, these results also suggest that VEGF-C promotes leukemic cell survival by signaling through FLT-4.
VEGF-C and mutVEGF-C protect leukemia from chemotherapy-induced apoptosis As seen in Figure 5A, VEGF-C protected HEL and THP-1 leukemic cells from chemotherapy-induced cell death. This effect was seen with daunorubicin, etoposide, and Ara-C, with variable results for the 3 agents but achieving significance (P < .005, Figure 5A). As an example, VEGF-C increased the average total viable Ara-C-treated population by approximately 230% in THP-1 cells and 60% in HEL cells (after 48 hours, Figure 5, P < .05). Similar results, and confirming also the mitogenic effects of VEGF-C, were seen in the 5 FLT-4+ primary leukemias. VEGF-C protected the primary leukemic cells from chemotherapy-induced cell death, an effect that was significant (P < .05) for all 3 agents used but achieving its most impressive effects against Ara-C (Figure 5B). Importantly, VEGF-C or its mutant failed to protect leukemic cells from sample 2 from chemotherapy-induced apoptosis (Figure 5B). Finally, VEGF had only a marginal effect at protecting the 2 cell lines HEL and THP-1 from chemotherapy-induced apoptosis (results shown for Ara-C, significant for HEL cells, Figure 5A). These results suggest that VEGF-C signaling through FLT-4 induces leukemic cell survival in serum-free conditions and protects leukemic cells from the proapoptotic effects of chemotherapy.
There is a great deal of interest in determining whether growth of liquid tumors such as leukemia also involves an increase in angiogenesis. In this regard, emerging data suggest that there is an increase in bone marrow angiogenesis of patients with different hematologic malignancies such as leukemia.2,3,21-23 Moreover, disease progression in leukemic patients has been associated with increased plasma levels of proangiogenic cytokines, including VEGF and bFGF,24 secreted by leukemic cells in vitro and in vivo.1,8,25 As a result of an increase in circulating angiogenic growth factors, the expanding bone marrow endothelial mass may support leukemic growth in a paracrine fashion by releasing factors such as granulocyte-macrophage colony-stimulating factor and IL-6.5 In the present study, we demonstrate that VEGF-C may support leukemic
growth by acting in a paracrine fashion. VEGF-C is a member of the VEGF
growth factor family that has been previously shown to induce
proliferation of lymphatic as well as normal
endothelium.26,27 It is capable of signaling through both
VEGFR2 (KDR) and VEGFR3 (FLT-4) and induces endothelial proliferation
and migration.9,27 Recent studies in a murine breast cancer
model have shown that overexpression of VEGF-C in tumors leads to
increased lymphangiogenesis and lymphatic metastasis.13
While those studies examined the role of VEGF-C signaling on the
vasculature, our studies suggest an important role for
vasculature-derived VEGF-C signaling on subsets of leukemias. We show
that endothelial cells release VEGF-C into the cell culture
supernatants, a phenomenon augmented in response to leukemia-derived
proinflammatory and angiogenic cytokines such as IL-1 and bFGF. In
turn, VEGF-C induced proliferation and promoted cell survival of
FLT-4+ leukemias cultured in serum-free conditions.
More importantly, VEGF-C protected FLT-4/KDR+ leukemic
cells from chemotherapy-induced apoptosis in response to 3 different
agents: Ara-C, etoposide, and daunorubicin. The antiapoptotic effects
of VEGF-C involved induction of Bcl-2 and increased Bcl-2/Bax ratios.
These effects of VEGF-C were not observed in the
FLT-4 During leukemia progression, mobilization of leukemic blasts into the peripheral circulation will result in increased circulating levels of angiogenic or proinflammatory cytokines, which in turn may increase VEGF-C production by bone marrow endothelium. An increase in VEGF-C production may result in augmented leukemia proliferation and resistance to chemotherapy. In this paradigm, it remains to be demonstrated whether VEGF-C production by bone marrow endothelial cells in leukemic patients is higher than in their normal counterparts or whether antiangiogenic therapies down-regulate VEGF-C production. Additionally, because endothelial cells have also been shown to express FLT-4 and certain subsets of leukemias release VEGF-C, it is unclear whether additional paracrine or autocrine FLT-4/VEGF-C signaling loops play an important role in disease progression. Although further investigation is needed to address these questions, the present results suggest that circulating VEGF-C levels may correlate with disease prognosis. To our knowledge, the present report is the first demonstration that
VEGF-C, by acting in a paracrine fashion, may actually contribute to
the development of leukemia. A previous study documented the expression
of FLT-4 in over one third of human primary acute leukemias
screened.16 Therefore, agents that target the VEGF-C/FLT-4 signaling pathway may have therapeutic potential for these subsets of
leukemias. Our results also emphasize the role of the
microenvironment Finally, the specific contribution of the different VEGF family members to the process of solid or liquid tumor angiogenesis has not been properly defined. We recently reported that besides stimulating endothelial growth, VEGF by interaction with its VEGFR-2 may support leukemic cell growth and migration in an autocrine manner.8 The results shown here suggest that antiangiogenic strategies may require targeting autocrine and paracrine signaling of several VEGF family members. Considering the effects of VEGF-C in chemotherapy-treated leukemias, a combination of chemotherapy and anti-VEGF-C/FLT-4 therapy may prove to be the most effective in treating certain subsets of leukemias.
Submitted March 16, 2001; accepted October 15, 2001.
Supported by a Translational Research Award from the Leukemia and Lymphoma Society; National Heart, Lung, and Blood Institute (NHLBI) grants R01s HL-58707, HL-61849, HL-66592, HL-67839; Research Scholar Grant from American Cancer Society (RSG-01-091-01); and the Lupin Foundation; (S.R.). S.D. was supported by Portuguese Science and Technology Foundation.
S.D. and M.C. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Shahin Rafii, Weill Medical College of Cornell University, Division of Hematology/Oncology, 1300 York Ave, Rm C-606, New York, NY 10021; e-mail: srafii{at}mail.med.cornell.edu.
1.
Fiedler W, Graeven U, Ergun S, et al.
Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia.
Blood.
1997;89:1870-1875
2.
Hussong JW, Rodgers GM, Shami PJ.
Evidence of increased angiogenesis in patients with acute myeloid leukemia.
Blood.
2000;95:309-313 3. Perez-Atayde AR, Sallan SE, Tedrow U, Connors S, Allred E, Folkman J. Spectrum of tumor angiogenesis in the bone marrow of children with acute lymphoblastic leukemia. Am J Pathol. 1997;150:815-821[Abstract].
4.
Rafii S, Shapiro F, Pettengell R, et al.
Human bone marrow microvascular endothelial cells support long-term proliferation and differentiation of myeloid and megakaryocytic progenitors.
Blood.
1995;86:3353-3363 5. Candal FJ, Rafii S, Parker JT, et al. BMEC-1: a human bone marrow microvascular endothelial cell line with primary cell characteristics. Microvasc Res. 1996;52:221-234[CrossRef][Medline] [Order article via Infotrieve]. 6. Almeida-Porada G, Ascensao JL. Isolation, characterization, and biologic features of bone marrow endothelial cells. J Lab Clin Med. 1996;128:399-407[CrossRef][Medline] [Order article via Infotrieve].
7.
Bellamy WT, Richter L, Frutiger Y, Grogan TM.
Expression of vascular endothelial growth factor and its receptors in hematopoietic malignancies.
Cancer Res.
1999;59:728-733 8. Dias S, Hattori K, Zhu Z, et al. Autocrine stimulation of VEGFR-2 activates human leukemic cell growth and migration. J Clin Invest. 2000;106:511-521[Medline] [Order article via Infotrieve]. 9. Joukov V, Pajusola K, Kaipainen A, et al. A novel vascular endothelial growth factor, VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR (VEGFR-2) receptor tyrosine kinases. EMBO J. 1996;15:1751[Medline] [Order article via Infotrieve]. 10. Kukk E, Lymboussaki A, Taira S, et al. VEGF-C receptor binding and pattern of expression with VEGFR-3 suggests a role in lymphatic vascular development. Development. 1996;122:3829-3837[Abstract].
11.
Cao Y, Linden P, Farnebo J, et al.
Vascular endothelial growth factor C induces angiogenesis in vivo.
Proc Natl Acad Sci U S A.
1998;95:14389-14394
12.
Lee J, Gray A, Yuan J, Luoh SM, Avraham H, Wood WI.
Vascular endothelial growth factor-related protein: a ligand and specific activator of the tyrosine kinase receptor Flt4.
Proc Natl Acad Sci U S A.
1996;93:1988-1992 13. Skobe M, Hawighorst T, Jackson DG, et al. Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat Med. 2001;7:192-198[CrossRef][Medline] [Order article via Infotrieve].
14.
Ristimaki A, Narko K, Enholm B, Joukov V, Alitalo K.
Proinflammatory cytokines regulate expression of the lymphatic endothelial mitogen vascular endothelial growth factor-C.
J Biol Chem.
1998;273:8413-8418
15.
Yonekura H, Sakurai S, Liu X, et al.
Placenta growth factor and vascular endothelial growth factor B and C expression in microvascular endothelial cells and pericytes. Implication in autocrine and paracrine regulation of angiogenesis.
J Biol Chem.
1999;274:35172-35178 16. Fielder W, Graeven U, Ergun S, et al. Expression of FLT4 and its ligand VEGF-C in acute myeloid leukemia. Leukemia. 1997;11:1234-1237[CrossRef][Medline] [Order article via Infotrieve]. 17. Allouche M, Bayard F, Clamens S, Fillola G, Sie P, Amalric F. Expression of basic fibroblast growth factor (bFGF) and FGF-receptors in human leukemic cells. Leukemia. 1995;9:77-86[Medline] [Order article via Infotrieve]. 18. Wano Y, Hattori T, Matsuoka M, et al. Interleukin 1 gene expression in adult T cell leukemia. J Clin Invest. 1987;80:911-916. 19. Wakamiya N, Stone R, Takeyama H, Spriggs D, Kufe D. Detection of tumor necrosis factor gene expression at a cellular level in human acute myeloid leukemias. Leukemia. 1989;3:51-56[Medline] [Order article via Infotrieve]. 20. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745-2756. 21. Vacca A, Ribatti D, Roncali L, Dammacco F. Angiogenesis in B cell lymphoproliferative diseases. Biological and clinical studies. Leuk Lymphoma. 1995;20:27-38[Medline] [Order article via Infotrieve]. 22. Pruneri G, Bertolini F, Soligo D, et al. Angiogenesis in myelodysplastic syndromes. Br J Cancer. 1999;81:1398-1401[CrossRef][Medline] [Order article via Infotrieve].
23.
Padro T, Ruiz S, Bieker R, et al.
Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia.
Blood.
2000;95:2637-2644
24.
Aguayo A, Kantarjian H, Manshouri T, et al.
Angiogenesis in acute and chronic leukemias and myelodysplastic syndromes.
Blood.
2000;96:2240-2245
25.
Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N.
Vascular endothelial growth factor is a secreted angiogenic mitogen.
Science.
1989;246:1306-1309
26.
Jeltsch M, Kaipainen A, Joukov V, et al.
Hyperplasia of lymphatic vessels in VEGF-C transgenic mice.
Science.
1997;276:1423-1425 27. Joukov V, Kaipainen A, Jeltsch M, et al. Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 1997;173:211-215[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  Autocrine Loop between Vascular Endothelial Growth Factor (VEGF)-C and VEGF Receptor-3 Positively Regulates Tumor-Associated Lymphangiogenesis in Oral Squamoid Cancer Cells Am. J. Pathol., October 1, 2009; 175(4): 1709 - 1721.
|
|
|
|
 |
|
 M. H. Muders, H. Zhang, E. Wang, D. J. Tindall, and K. Datta Vascular Endothelial Growth Factor-C Protects Prostate Cancer Cells from Oxidative Stress by the Activation of Mammalian Target of Rapamycin Complex-2 and AKT-1 Cancer Res., August 1, 2009; 69(15): 6042 - 6048. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lahat, A. Lazar, X. Wang, W.-L. Wang, Q.-S. Zhu, K. K. Hunt, R. E. Pollock, and D. Lev Increased Vascular Endothelial Growth Factor-C Expression Is Insufficient to Induce Lymphatic Metastasis in Human Soft-Tissue Sarcomas Clin. Cancer Res., April 15, 2009; 15(8): 2637 - 2646. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kodama, Y. Kitadai, M. Tanaka, T. Kuwai, S. Tanaka, N. Oue, W. Yasui, and K. Chayama Vascular Endothelial Growth Factor C Stimulates Progression of Human Gastric Cancer via Both Autocrine and Paracrine Mechanisms Clin. Cancer Res., November 15, 2008; 14(22): 7205 - 7214. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. J.M. de Jonge, A. C. Weidenaar, A. ter Elst, H. M. Boezen, F. J.G. Scherpen, J. C.A. Bouma-ter Steege, G. J.L. Kaspers, B. F. Goemans, U. Creutzig, M. Zimmermann, et al. Endogenous Vascular Endothelial Growth Factor-C Expression Is Associated with Decreased Drug Responsiveness in Childhood Acute Myeloid Leukemia Clin. Cancer Res., February 1, 2008; 14(3): 924 - 930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Lowenberg Acute Myeloid Leukemia: The Challenge of Capturing Disease Variety Hematology, January 1, 2008; 2008(1): 1 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wissmann and M. Detmar Pathways Targeting Tumor Lymphangiogenesis Clin. Cancer Res., December 1, 2006; 12(23): 6865 - 6868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. A. Avramis, E. H. Panosyan, F. Dorey, J. S. Holcenberg, and V. I. Avramis Correlation between High Vascular Endothelial Growth Factor-A Serum Levels and Treatment Outcome in Patients with Standard-Risk Acute Lymphoblastic Leukemia: A Report from Children's Oncology Group Study CCG-1962 Clin. Cancer Res., December 1, 2006; 12(23): 6978 - 6984. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J.M. de Jonge, A. ter Elst, H. M. Boezen, A. C. Weidenaar, F. J.G. Scherpen, J. C.A. B.-t. Steege, G. J.L. Kaspers, B. F. Goemans, U. Creutzig, W. A. Kamps, et al. Endogenous VEGF-C mRNA Expression Increases In Vitro Drug Resistance of Pediatric AML Cells and Is an Independent Prognostic Factor for the Time To Reach Complete Remission in AML. Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 838 - 838. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Schmeisser, M. Christoph, A. Augstein, R. Marquetant, M. Kasper, R.C. Braun-Dullaeus, and R.H. Strasser Apoptosis of human macrophages by Flt-4 signaling: Implications for atherosclerotic plaque pathology Cardiovasc Res, September 1, 2006; 71(4): 774 - 784. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. R. Foster, S. C. Satchell, J. Seckley, M. S. Emmett, K. Joory, C. Y. Xing, M. A. Saleem, P. W. Mathieson, D. O. Bates, and S. J. Harper VEGF-C promotes survival in podocytes Am J Physiol Renal Physiol, July 1, 2006; 291(1): F196 - F207. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fragoso, T. Pereira, Y. Wu, Z. Zhu, J. Cabecadas, and S. Dias VEGFR-1 (FLT-1) activation modulates acute lymphoblastic leukemia localization and survival within the bone marrow, determining the onset of extramedullary disease Blood, February 15, 2006; 107(4): 1608 - 1616. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Shaked, D. Cervi, M. Neuman, L. Chen, G. Klement, C. R. Michaud, M. Haeri, B. J. Pak, R. S. Kerbel, and Y. Ben-David The splenic microenvironment is a source of proangiogenesis/inflammatory mediators accelerating the expansion of murine erythroleukemic cells Blood, June 1, 2005; 105(11): 4500 - 4507. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Loges, G. Heil, M. Bruweleit, V. Schoder, M. Butzal, U. Fischer, U. M. Gehling, G. Schuch, D. K. Hossfeld, and W. Fiedler Analysis of Concerted Expression of Angiogenic Growth Factors in Acute Myeloid Leukemia: Expression of Angiopoietin-2 Represents an Independent Prognostic Factor for Overall Survival J. Clin. Oncol., February 20, 2005; 23(6): 1109 - 1117. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Le Gouill, K. Podar, M. Amiot, T. Hideshima, D. Chauhan, K. Ishitsuka, S. Kumar, N. Raje, P. G. Richardson, J.-L. Harousseau, et al. VEGF induces Mcl-1 up-regulation and protects multiple myeloma cells against apoptosis Blood, November 1, 2004; 104(9): 2886 - 2892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Wang, J. Teruya-Feldstein, Y. Wu, Z. Zhu, D. J. Hicklin, and M. A. S. Moore Targeting autocrine and paracrine VEGF receptor pathways inhibits human lymphoma xenografts in vivo Blood, November 1, 2004; 104(9): 2893 - 2902. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Karp, I. Gojo, R. Pili, C. D. Gocke, J. Greer, C. Guo, D. Qian, L. Morris, M. Tidwell, H. Chen, et al. Targeting Vascular Endothelial Growth Factor for Relapsed and Refractory Adult Acute Myelogenous Leukemias: Therapy with Sequential 1-{beta}-D-Arabinofuranosylcytosine, Mitoxantrone, and Bevacizumab Clin. Cancer Res., June 1, 2004; 10(11): 3577 - 3585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fukahi, M. Fukasawa, G. Neufeld, J. Itakura, and M. Korc Aberrant Expression of Neuropilin-1 and -2 in Human Pancreatic Cancer Cells Clin. Cancer Res., January 15, 2004; 10(2): 581 - 590. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Weinreich, D. M. Elaraj, M. Puhlmann, S. M. Hewitt, N. M. Carroll, E. D. Feldman, E. M. Turner, P. J. Spiess, and H. R. Alexander Effect of Interleukin 1 Receptor Antagonist Gene Transduction on Human Melanoma Xenografts in Nude Mice Cancer Res., September 15, 2003; 63(18): 5957 - 5961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ruggeri, J. Singh, D. Gingrich, T. Angeles, M. Albom, H. Chang, C. Robinson, K. Hunter, P. Dobrzanski, S. Jones-Bolin, et al. CEP-7055: A Novel, Orally Active Pan Inhibitor of Vascular Endothelial Growth Factor Receptor Tyrosine Kinases with Potent Antiangiogenic Activity and Antitumor Efficacy in Preclinical Models Cancer Res., September 15, 2003; 63(18): 5978 - 5991. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. F. Meresman, M. A. Bilotas, E. Lombardi, M. Tesone, C. Sueldo, and R. I. Baranao Effect of GnRH analogues on apoptosis and release of interleukin-1{beta} and vascular endothelial growth factor in endometrial cell cultures from patients with endometriosis Hum. Reprod., September 1, 2003; 18(9): 1767 - 1771. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Schuch, M. Machluf, G. Bartsch Jr, M. Nomi, H. Richard, A. Atala, and S. Soker In vivo administration of vascular endothelial growth factor (VEGF) and its antagonist, soluble neuropilin-1, predicts a role of VEGF in the progression of acute myeloid leukemia in vivo Blood, December 15, 2002; 100(13): 4622 - 4628. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Longo, J. A. Kennell, M. J. Ochocinska, S. E. Ross, W. S. Wright, and O. A. MacDougald Wnt Signaling Protects 3T3-L1 Preadipocytes from Apoptosis through Induction of Insulin-like Growth Factors J. Biol. Chem., October 4, 2002; 277(41): 38239 - 38244. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
namely,
vascular endothelial growth factor (VEGF)
were obtained from
R&D Systems (Minneapolis, MN). The tyrosine kinase inhibitor AG1433 was
obtained from Calbiochem (San Diego, CA). Anti-KDR and secondary
horseradish peroxidase-conjugated antibodies were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA). Anti-Bcl-2 antibody was purchased
from Oncogene Research Products (Boston, MA), and anti-Bax antibody was
purchased from Santa Cruz Biotechnology.
, indicates
untreated; 
, chemotherapy;
,
chemotherapy + VEGF-C; 
, Arg-C+VEGF. (B) Similar to the cell lines,
6 primary leukemia samples were cultured in serum-free conditions for
48 hours in the presence of different chemotherapeutic agents (Ara-C,
etoposide, daunorubicin). In some conditions the cells were pretreated
with VEGF-C (100 ng/mL) or mutVEGF-C (200 ng/mL) for 24 hours, prior to
the addition of the chemotherapeutic agent. In these conditions, the
cells received cytokines plus chemotherapeutic agent daily. Apoptotic
cells were determined by annexin V staining, as described in
"Materials and methods." As shown, VEGF-C and mutVEGF-C protected
FLT-4+ primary cells from chemotherapy-induced apoptosis
(samples1, 3, 4, 5, and 6). Importantly, neither VEGF-C nor mutVEGF-C
protected a FLT-4