|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Senckenberg Department of Pathology,
University of Frankfurt, Frankfurt/Main, and the Institute for
Genetics, University of Cologne, Cologne, Germany.
The derivation of follicular lymphomas (FLs) from germinal centers
is not only supported by their morphologic appearance with a nodular
growth pattern and a germinal center-like cellular composition, but
also by the presence of ongoing somatic hypermutation (a germinal center B cell-specific process) during their clonal expansion. The
intraclonal sequence diversity of the tumor cells and their follicular
growth pattern allows one to analyze lymphoma cell dissemination and
the way the tumor "metastasizes" to distinct follicles. In the
present study, we analyzed individual follicles of 3 FLs by
micromanipulation of single cells from individual lymphoma follicles
and amplification of immunoglobulin V region genes. Genealogical trees
for the VH and the VL gene rearrangements were
constructed to analyze the clonal relationship among individual cells
of 3 distinct follicles of each case. In all 3 cases there is evidence
that distinct tumor follicles are founded by many tumor cells,
suggesting that there is extensive migration of the tumor cells among
follicles. The observation that the tumor cells of FLs retain their
follicular growth patterns despite this cellular migration supports the
idea that they depend on the follicular microenvironment for their
clonal expansion.
(Blood. 2002;99:2192-2198) Follicular lymphoma (FL) is one of the most common
B-cell lymphomas in Europe and the United States, accounting for up to 40% of all non-Hodgkin lymphomas. It is a low-grade lymphoma with a
median survival of 8 to 10 years after diagnosis.1-4 A
majority of the cases (80% to 90%) are characterized by the
t(14;18)(q32;q21) chromosomal translocation, resulting in
overexpression of the proto-oncogene bcl-2 and protecting the cell
against apoptosis.5-8 FLs show a characteristic nodular
growth pattern resembling the architecture of reactive nonmalignant
germinal centers (GCs) in secondary lymphoid organs. The cellular
composition of FLs is also similar to that of reactive GCs, consisting
of a mixture of centrocytelike and centroblastlike cells, reactive T
cells, follicular dendritic cells, and a few
macrophages.9,10
The follicular growth pattern of the lymphoma and the morphologic
similarity of the tumor cells in FL with normal GC centroblasts and
centrocytes indicates a derivation of FLs from GC B cells. This is also
supported by molecular analysis of rearranged immunoglobulin (Ig) genes
in FL cells. In the GC reaction, Ig genes of GC B cells undergo the
process of somatic hypermutation, which introduces mutations at a high
rate into the Ig variable (V) region genes in the course of clonal
expansion of the cells.11 On this background, the
observation that FLs carry somatically mutated Ig genes and show
intraclonal sequence diversity suggests that the hypermutation machinery is active in the FL cells, and hence indicates a derivation of the lymphoma cells from transformed GC B cells.12,13
As the clonal tumor cell population in FL is the descendent of a single
B cell, the establishment of the malignant clone presumably started
with a single transformed GC B cell. This founder cell of the tumor
clone likely first proliferated in a GC where it underwent
malignant transformation, before descendents of the clone either
migrated to neighboring B cell follicles and/or established novel
follicles in the involved lymph node. In most tumors, the dissemination
of the malignant clone in the tissue cannot be studied because of
lack of appropriate markers, so that details of tumor cell
dissemination are largely unknown in most malignant diseases. However, the follicular growth pattern of FLs defines distinct histologic tumor cell subsets, and the intraclonal sequence diversity of the lymphoma cells represents a suitable and unique marker to
analyze the way in which the tumor clone "metastasizes" to distinct follicles.
In the present analysis, we studied lymphoma cell dissemination in FL
by isolating single tumor cells from 3 distinct follicles from each of
3 cases. By amplification and sequence analysis of rearranged Ig heavy
and light chain V genes, the somatic mutation pattern was used to
delineate the distribution of distinct members of the tumor clone among
separate follicles and hence the migration of the FL cells among follicles.
Patients and tissues
Approval was obtained from the Instiutional Review Board for these
studies. Informed consent was provided according to the Declaration
of Helsinki.
Immunostaining and micromanipulation
DNA isolation from tissue sections For DNA isolation, QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) was used. Tissue sections, 20-µm- to 30-µm-thick, were digested overnight with 40 µL proteinase K solution (20 mg/mL) and 360 µL ATL (QIAmp Tissue Lysis) buffer at 55°C. From this solution, DNA was extracted and dissolved in H2O at a concentration of 100 µg/mL. A quantity of 10 µL of this solution was used in each amplification reaction.Whole-tissue and single-cell PCR The clonal VH and VL gene rearrangements of the FL clones were first identified by whole-tissue DNA PCR using either family-specific VH leader or framework region (FR) I primers and V or V FR I family-specific
primers together with the respective J gene segment
primers.11,14-16 In case 2, the clonal V
rearrangement was only identified in the single-cell analysis, perhaps
due to somatic mutations at the primer binding sites that reduced the amplification efficiency in the whole-tissue PCR below detection level.
Rearranged Ig genes from single cells were amplified in a seminested
PCR using primers for VH and V In the single-cell analyses, the first 15 cells of each case were analyzed with all VH and VL FR I primers, with the exception of 2 VH rearrangements where the whole-tissue PCR with VH leader primers identified mutations at the VH FR I primer binding sites. For those VH rearrangements, rearrangement-specific primers binding to sequences in the respective VH leader introns were used (case 1: 5'AGTGAATATGTGTG(AG)CAGTTTCTG3' [2 mutations different from germline], case 3: 5'GTTGTTGCGCTTGCAGGTGTCC3' [4 mutations different from germline]). The VH leader primers were not used for single-cell PCR, because longer PCR products are often amplified with lower efficiency. All V genes amplified from these cells showed the clonal rearrangements identified with the whole-tissue DNA PCR. The remaining cells were analyzed only with the family-specific VH and VL primers recognizing the tumor-specific rearrangements and the corresponding J primer mixes. Sequence analysis and construction of genealogical trees PCR products were gel-purified and directly sequenced on automatic sequencers (ABI377 and 3100; Applied Biosystems, Weiterstadt, Germany). Sequences were analyzed using the EMBL IMGT (international imMunoGenetics database) (www.genetik.uni-koeln.de/dnaplot/) and Genbank databases. Based on multiple sequence alignment obtained with the clustal W program of MacVector software 7.0 (Accelrys, München, Germany), genealogical trees for the VH and the VL gene rearrangements were constructed to analyze the clonal relationship among the individual cells of the 3 different follicles of each case. In some of the trees, modifications were made (ie, either by introducing backmutations or by assuming that some identical nucleotide exchanges happened independently in distinct cells) to optimize the congruence between the VH and the VL trees or to correct obvious mistakes in the trees generated by the software (eg, not discriminating 2 distinct mutations at the same position in separate cells; see figure legends for additional explanations).
Histologic analysis of the cases The lymph nodes of the 3 patients showed a histologic picture typical of FL with only a few centroblastlike cells (FL grade I). In case 3, the tumor showed both a follicular and diffuse growth pattern. In all cases, immunohistochemistry revealed positivity of the tumor cells for CD20 and Bcl- 2.Amplification and sequence analysis of the tumor-derived V gene rearrangements For the identification of the VH and VL gene rearrangements carried by the FL cells, whole-tissue DNA PCR was carried out with V gene family-specific primers and the respective J gene primers, and the resulting PCR products were directly sequenced. In case 1 and case 3, potentially functional VH and VL gene rearrangements were identified in the whole-tissue PCR. In case 2, a productive VH gene was amplified in the whole-tissue PCR, whereas the clonal V gene was
amplified only in the single-cell analysis (Table 1; the data for the clonal
V rearrangement of case 2 is also presented here). All
rearrangements were somatically mutated (Table 1). From the FL of
patient 1, a VH3-23 rearrangement with 13.6% mutation frequency and a
V B3 rearrangement with 6.8% mutation frequency were obtained. Case
2 carries a VH3-23 and a VL2 rearrangement, with 6.7% and 3.1%
mutation frequencies, respectively. The VH gene of case 3 uses the VH3-49 gene with 10.5% mutation, the light chain gene
rearrangement uses the V 3r gene and shows 11.2% mutation frequency.
Analysis of mutation pattern The ratio of replacement (R) to silent (S) mutations in the FRs of functional V gene rearrangements is an indicator whether cells have been under selective pressure for expression of an antigen receptor. In that case, R mutations are counterselected in the FRs to preserve the evolutionary optimized structure of the antibody V domain. In the absence of selection, like in out-of-frame rearrangements, R mutations in the FRs are not counterselected. The R/S ratios of the mutations within the FRs in productive rearrangements of various B-cell subsets with mutated V gene rearrangements have been shown to be in a range between 1.0 and 1.6, whereas for a collection of nonfunctional out-of-frame rearrangements, the ratio is 3.0, the value expected assuming random mutagenesis.17,18 The 79 shared mutations in the FRs of the 6 potentially functional VH and VL rearrangements amplified from the 3 FLs showed an R/S ratio of 1.1, which is in the range typical for antigen-selected cells.PCR analysis of single micromanipulated cells for VH,
V
For patient 1, the clonal VH and VL
rearrangements were obtained from 30 and 25 of the cells, respectively
(Table 2). One cell isolated from
follicle 3 harbored a unique VH3-11 rearrangement, and 2 cells with an
identical unmutated VH3-23 and V
For each of the 3 cases, 60 T cells were micromanipulated and 60 aliquots of buffer covering the sections during micromanipulation were
aspirated. These samples were analyzed as negative controls in parallel
to the FL B cells (Table 2). All these controls were negative in case
1. In case 2, the clonal VH rearrangement was amplified
from 3 T cell samples and one buffer control, and the clonal
V Intraclonal V gene diversity For each of the 6 clonal rearrangements amplified from the 3 FLs, intraclonal sequence diversity was detected in the single-cell analysis (Table 1; Figures 2-4). In case 1, 19 sequence variants among 30 sequences of the VH rearrangement and 12 sequence variants among 25 sequences of the V rearrangement were found. In case 2, 44 sequence variants were observed among 71 sequences of the
VH rearrangement and 17 sequence variants among 55 sequences of the V rearrangement. In case 3, 11 sequence
variants were observed among 37 VH sequences and 13 sequence variants among 30 V sequences.
The sequence variants differed from each other by few to many distinct
mutations (between 1 to 17). Consequently, there was considerable
variation in the mutation load of individual cells (Table 1). For
example, in case 1 the mutation load of the V Construction of genealogical trees For each case, a genealogical tree for the VH and the VL gene rearrangements was constructed to demonstrate the clonal relationship among the individual cells of the 3 different follicles (Figures 2-4). The genealogical trees are based on the clustal W alignment obtained with MacVector software 7.0 (see "Patients, materials, and methods" and the figure legends for additional explanations).All 6 genealogical trees demonstrate that the cells of the 3 individual
follicles (marked with the same "follicle-specific" color in each
case, Figures 2-4) were distributed diffusely among the branches of the
trees. Members of distinct subclones in the tree were usually found in
2 or 3 of the follicles. No indication was found that one of the
follicles was founded by a single or few FL cells which then expanded
and mutated restricted to that follicle. There was only in case 2 one
subclone of 13 cells in the VH tree that was restricted to
follicle 1 and in the V
The classification of FL as a GC B cell tumor is not only supported by the follicular growth pattern and the morphologic appearance of the lymphoma cells, but also by the regular detection of ongoing somatic hypermutation,12,19 which represents a GC B cell-specific process.11 Intraclonal V gene diversity was indeed observed for each of the 6 clonal rearrangements amplified from the 3 cases. As also observed by others,20 there was variation of the frequency of sequence variants, ranging from 11 in 37 (30%) sequences for the VH gene of case 3, to 19 in 30 (63%) for the VH gene of case 1. Nevertheless, due to the large number of cells analyzed, informative genealogical trees could also be generated for the rearrangements with less variability. In the construction of the trees it has to be considered that identical mutations found in separate follicles may have happened independently. Thus, there may have been a parallel development of the same mutations in separate follicles instead of cell migration among follicles, perhaps because of intrinsic mutation hot spots and/or selection of the tumor cells for recognition of a particular antigen. Indeed, to optimize the congruence of the VH and VL trees, independent occurence of some identical mutations in distinct cells was assumed (see the legends to Figures 2-4). However, there are several arguments why it is unlikely that there was significant parallel development of identical mutations in separate follicles. First, nearly half (75 R, 57 S) of the mutations are silent, and hence are not selectable. Second, only 37.7% of the nonclonal mutations shared by at least 2 cells are found at the main hypermutation hot spot in human V region genes, namely the RGYW/WRCY motif, a value similar to what is reported in the literature.21 Moreover, even typical hot spot mutations found at the same position in distinct cells may often derive from a single mutation event. Finally, some of the main branches are defined by more than one mutation, and/or are identified in the VH as well as in the respective VL trees. A parallel development of multiple mutations, however, appears highly unprobable. Taken together, although we cannot exclude that some identical mutations that occurred independently may have remained undetected, it is likely that the frequency of such events is low and that the trees therefore reliably reflect the evolution of the intraclonal V gene diversification. FLs grow in a follicular pattern, thereby defining spatially separated histologic subsets of the tumor clone, and the intraclonal V gene diversity allows one to define the genealogical relationship of members of the tumor clone. On this basis, a single-cell analysis of FL cells isolated from distinct follicles in the tissue represents an attractive model to study tumor cell dissemination. More specifically, we wanted to address the questions of whether distinct tumor follicles are founded by single, few, or many FL cells, and of whether there is evidence for considerable migration of tumor cells among follicles. As the present analysis revealed, there is indeed indication for extensive migration of FL cells among follicles. Cells belonging to branches in the genealogical trees with multiple members were usually found in each of the 3 follicles analyzed. In several instances members of branches in the genealogical trees were found in a single follicle (eg, the most left branch in Figure 3A). This is not unexpected, as the FL B cells continue to mutate while proliferating within the follicles. However, all 9 follicles harbored members of several separate branches in the genealogical trees (Figures 2-4). Hence, it appears that FLs are characterized by extensive tumor cell traffic among follicles in the course of the clonal expansion of the lymphoma cells and that each follicle is composed of various members of the tumor clone stemming from several distinct branches in the genealogical trees. Based on these features, it is likely that the "metastatic" dissemination of FL cells to new follicles is a process involving many tumor cells and not only rare members of the tumor clone that perhaps possess particular migration properties. While the present analysis is focused on tumor cell dissemination among
follicles in a given lymph node, in some cases of FL mutation patterns
among distinct lymph nodes showing FL infiltration were
compared.22,23 These studies did not reveal any distinct mutation patterns in the separate lymph nodes, indicating that many
cells of the FL clone are involved in tumor cell metastasis The migratory features of the FL cells appear to distinguish them from normal GC B cells. Although there are not many data published on this issue, studies in the mouse indicate that each GC represents a distinct entity and that there is little if any exchange of cells among these structures.25 This may be advantagous in a normal immune response to allow for the selection of many different and clonally unrelated memory B cells expressing Ig receptors with increased affinity to the immunizing antigen, thereby establishing a high-affinity yet diverse memory B cell population. While the extensive cell traffic among FL follicles shows that the follicular growth pattern is not due to migratory inabilities of the lymphoma cells, the growth of the tumor clone in distinct follicles underscores the idea that FL cells depend on the follicular microenvironment for their survival and clonal expansion.26-28 Therapeutical strategies targeting the interaction of FL cells with their follicular microenvironment might therefore represent attractive approaches to fight tumor progression.
We thank Ekaterini Hadzoglou for excellent technical assistance.
Submitted June 25, 2001; accepted November 8, 2001.
Supported by the Deutsche Krebshilfe, Dr Mildred Scheel Stiftung Bonn, Germany to M.-L.H., and a Heisenberg Award, Deutsche Forschungsgemeinschaft, Bonn, Germany to R.K.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Sabine Oeschger, University of Frankfurt, Senckenberg Department of Pathology, Theodor-Stern-Kai 7, D-60590 Frankfurt am Main, Germany; e-mail: oeschger{at}em.uni-frankfurt.de.
1. Harris NL. Principles of the revised European-American Lymphoma Classification (from the International Lymphoma Study Group). Ann Oncol. 1997;8:11-16. 2. Horning SJ. Natural history of and therapy for the indolent non-Hodgkin's lymphomas. Semin Oncol. 1993;20:75-88[Medline] [Order article via Infotrieve].
3.
Hubbard SM, Chabner BA, DeVita VT Jr, et al.
Histologic progression in non-Hodgkin's lymphoma.
Blood.
1982;59:258-264 4. Bastion Y, Sebban C, Berger F, et al. Incidence, predictive factors, and outcome of lymphoma transformation in follicular lymphoma patients. J Clin Oncol. 1997;15:1587-1594[Abstract]. 5. Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature. 1990;348:334-336[CrossRef][Medline] [Order article via Infotrieve]. 6. Seto M, Jaeger U, Hockett RD, et al. Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J. 1988;7:123-131[Medline] [Order article via Infotrieve]. 7. McDonnell TJ, Deane N, Platt FM, et al. Bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation. Cell. 1989;57:79-88[CrossRef][Medline] [Order article via Infotrieve].
8.
Tsujimoto Y, Cossman J, Jaffe E, Croce CM.
Involvement of the bcl-2 gene in human follicular lymphoma.
Science.
1985;228:1440-1443 9. Poppema S, Kaleta J, Hugh J, Visser L. Neoplastic changes involving follicles: morphological, immunophenotypic and genetic diversity of lymphoproliferations derived from germinal center and mantle zone. Immunol Rev. 1992;126:163-178[CrossRef][Medline] [Order article via Infotrieve]. 10. Harris NL, Ferry JA. Follicular lymphoma and related disorders (germinal center lymphomas). In: Knowles DM, ed. Neoplastic Hematopathology. Baltimore, MD: Williams and Wilkins; 1992:645-674. 11. Küppers R, Zhao M, Hansmann ML, Rajewsky K. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO J. 1993;12:4955-4967[Medline] [Order article via Infotrieve]. 12. Cleary ML, Meeker TC, Levy S, et al. Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma. Cell. 1986;44:97-106[CrossRef][Medline] [Order article via Infotrieve].
13.
Levy S, Mendel E, Kon S, Avnur Z, Levy R.
Mutational hot spots in Ig V region genes of human follicular lymphomas.
J Exp Med.
1988;168:475-489
14.
Bräuninger A, Küppers R, Strickler JG, Wacker HH, Rajewsky K, Hansmann ML.
Hodgkin and Reed-Sternberg cells in lymphocyte predominant Hodgkin's disease represent clonal populations of germinal center-derived tumor B cells [published correction appears in Proc Natl Acad Sci U S A. 94:14211].
Proc Natl Acad Sci U S A.
1997;94:9337-9342
15.
Kanzler H, Küppers R, Hansmann ML, Rajewsky K.
Hodgkin and Reed-Sternberg cells in Hodgkin's disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells.
J Exp Med.
1996;184:1495-1505
16.
Bräuninger A, Küppers R, Spieker T, et al.
Molecular analysis of single B cells from T-cell-rich B-cell lymphoma shows the derivation of the tumor cells from mutating germinal center B cells and exemplifies means by which immunoglobulin genes are modified in germinal center B cells.
Blood.
1999;93:2679-2687 17. Klein U, Goossens T, Fischer M, et al. Somatic hypermutation in normal and transformed human B cells. Immunol Rev. 1998;162:261-280[CrossRef][Medline] [Order article via Infotrieve]. 18. Küppers R, Rajewsky K, Hansmann ML. Diffuse large cell lymphomas are derived from mature B cells carrying V region genes with a high load of somatic mutation and evidence of selection for antibody expression. Eur J Immunol. 1997;27:1398-1405[Medline] [Order article via Infotrieve].
19.
Bahler DW, Levy R.
Clonal evolution of a follicular lymphoma: evidence for antigen selection.
Proc Natl Acad Sci U S A.
1992;89:6770-6774
20.
Aarts WM, Bende RJ, Steenbergen EJ, et al.
Variable heavy chain gene analysis of follicular lymphomas: correlation between heavy chain isotype expression and somatic mutation load.
Blood.
2000;95:2922-2929 21. Dörner T, Foster SJ, Farner NL, Lipsky PE. Somatic hypermutation of human immunoglobulin heavy chain genes: targeting of RGYW motifs on both DNA strands. Eur J Immunol. 1998;28:3384-3396[CrossRef][Medline] [Order article via Infotrieve].
22.
Dogan A, Du MQ, Aiello A, et al.
Follicular lymphomas contain a clonally linked but phenotypically distinct neoplastic B-cell population in the interfollicular zone.
Blood.
1998;91:4708-4714 23. Küppers R, Sousa AB, Baur AS, Strickler JG, Rajewsky K, Hansmann ML. Common germinal-center B-cell origin of the malignant cells in two composite lymphomas, involving classical Hodgkin's disease and either follicular lymphoma or B-CLL. Mol Med. 2001;5:285-292. 24. Su W, Spencer J, Wotherspoon AC. Relative distribution of tumour cells and reactive cells in follicular lymphoma. J Pathol. 2001;193:498-504[CrossRef][Medline] [Order article via Infotrieve].
25.
Jacob J, Kelsoe G.
In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers.
J Exp Med.
1992;176:679-687 26. Umetsu DT, Esserman L, Donlon TA, DeKruyff RH, Levy R. Induction of proliferation of human follicular (B type) lymphoma cells by cognate interaction with CD4+ T cell clones. J Immunol. 1990;144:2550-2557[Abstract]. 27. Freedman AS, Saporito L, Rhynhart K, Morimoto C, Nadler LM. Adhesion of follicular lymphoma cells to lymphoid germinal centers-a potential mechanism of tumor cell homing following autologous transplantation. Leuk Lymphoma. 1994;13:47-52[Medline] [Order article via Infotrieve]. 28. Martin I, Bonnefoix T, Roucard C, et al. Role of autologous CD4+ T cell clones in human B non-Hodgkin's lymphoma: aborted activation and G1 blockade induced by cell-cell contact. Eur J Immunol. 1999;29:3188-3195[CrossRef][Medline] [Order article via Infotrieve].
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  J. Agopian, J.-M. Navarro, A.-C. Gac, Y. Lecluse, M. Briand, P. Grenot, P. Gauduchon, P. Ruminy, P. Lebailly, B. Nadel, et al. Agricultural pesticide exposure and the molecular connection to lymphomagenesis J. Exp. Med., July 6, 2009; 206(7): 1473 - 1483. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lejeune and T. Alvaro Clinicobiological, prognostic and therapeutic implications of the tumor microenvironment in follicular lymphoma Haematologica, January 1, 2009; 94(1): 16 - 21. [Full Text] [PDF]
|
|
|
|
 |
|
 P. Ruminy, F. Jardin, J.-M. Picquenot, F. Parmentier, N. Contentin, G. Buchonnet, S. Tison, V. Rainville, H. Tilly, and C. Bastard S{micro} mutation patterns suggest different progression pathways in follicular lymphoma: early direct or late from FL progenitor cells Blood, September 1, 2008; 112(5): 1951 - 1959. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Natkunam The Biology of the Germinal Center Hematology, January 1, 2007; 2007(1): 210 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Alvaro, M. Lejeune, M.-T. Salvado, C. Lopez, J. Jaen, R. Bosch, and L. E. Pons Immunohistochemical Patterns of Reactive Microenvironment Are Associated With Clinicobiologic Behavior in Follicular Lymphoma Patients J. Clin. Oncol., December 1, 2006; 24(34): 5350 - 5357. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Roulland, J.-M. Navarro, P. Grenot, M. Milili, J. Agopian, B. Montpellier, P. Gauduchon, P. Lebailly, C. Schiff, and B. Nadel Follicular lymphoma-like B cells in healthy individuals: a novel intermediate step in early lymphomagenesis J. Exp. Med., October 30, 2006; 203(11): 2425 - 2431. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Ladetto, M. Compagno, I. Ricca, M. Pagano, A. Rocci, M. Astolfi, D. Drandi, P. F. di Celle, M. Dell'Aquila, B. Mantoan, et al. Telomere length correlates with histopathogenesis according to the germinal center in mature B-cell lymphoproliferative disorders Blood, June 15, 2004; 103(12): 4644 - 4649. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
20°C. From each section used for micromanipulation,
aliquots of the buffer covering the section were aspirated and analyzed in parallel to the B cells as negative controls. Furthermore, CD3+ T cells were micromanipulated from adjacent tissue
sections of the same cases as additional negative controls.
in line
with the findings of the present investigation. Whether disseminating FL cells normally establish novel follicles or migrate to established reactive follicles was recently analyzed by Su et al.