|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
CLINICAL OBSERVATIONS, INTERVENTIONS, AND THERAPEUTIC TRIALS
From the Division of Gastroenterology and Hepatology
and the Division of Hematology, University Department of Medicine, the
Clinical Trials Centre, and the Department of Pathology, Queen Mary
Hospital, Institute of Molecular Technology for Drug Discovery and
Synthesis, Biology, Hong Kong Special Administrative Region; the
Department of Infectious Disease, Nanfang Hospital, Guangzhou; and the
Department of Molecular Virology, Fudan University, Shanghai, People's
Republic of China.
The risk factors for hepatitis due to hepatitis B virus (HBV)
reactivation in patients positive for hepatitis B surface antigen (HBsAg) treated with autologous hematopoietic cell transplantation (HCT) are unknown. We evaluated 137 consecutive patients (23 positive for HBsAg, 37 positive for hepatitis B surface antibody, and
77 negative for HBV) who underwent HCT. Serial serum ALT were measured before transplant and after transplant at 1 to 4 weekly intervals for
the first year and then at 2 to 12 weekly intervals thereafter. Before HCT, basic core promoter (T1762/A1764)
and precore (A1896) HBV variants were determined in
HBsAg-positive and HBV DNA-positive (by polymerase chain reaction
assay) patients by direct sequencing and serum HBV DNA quantitation
using the Digene Hybrid Capture II assay. Cox proportional hazards
analysis was used to assess the association between pretransplantation
HBV virologic and host factors and occurrence of hepatitis due to HBV
reactivation. After HCT, hepatitis due to HBV reactivation was more
common in HBsAg-positive patients than in HBsAg-negative patients
(hazard ratio, 33.3; 95% confidence interval [CI], 7.35-142.86;
P < .0001). HBsAg-positive patients with detectable
serum HBV DNA before HCT (on Digene assay) had a significantly higher
risk of hepatitis due to HBV reactivation than HBsAg-positive patients
with no detectable serum HBV DNA (adjusted hazard ratio, 9.35; 95% CI,
1.65-52.6; P = .012). Thus, we found that hepatitis due
to HBV reactivation is common in HBsAg-positive patients undergoing
autologous HCT. A high HBV DNA level (>105 copies/mL) was
the most important risk factor for HBV reactivation, and its lowering
by administration of nucleoside analogues before transplantation should
be considered.
(Blood. 2002;99:2324-2330) Hepatitis due to reactivation of hepatitis B
virus (HBV) is a well-recognized complication in patients with chronic
HBV infection undergoing cytotoxic or immunosuppressive therapy. It has
been observed in patients positive for hepatitis B surface antigen (HBsAg)1-6 and in HBsAg-negative patients who had HBV
infection in the past (hepatitis B surface antibody [HBsAb], HBsAb
positive and hepatitis B core antibody [HBcAb], and anti-HBc
positive).7-11
In the past few decades, hematopoietic cell transplantation (HCT)
has become the standard treatment for various hematologic and
oncologic problems.12 In areas such as Southeast Asia,
where HBV infection is prevalent, HCT might be complicated by morbidity and mortality related to HBV.13 The median prevalence of
HBsAg positivity in Asian Chinese patients undergoing HCT has been
reported to be more than 10%.14 Hepatic complications
related to HBV infection after HCT are primarily associated with HBV
reactivation.2,5,10,11,13,15-17 The underlying
pathogenesis of HBV reactivation is likely to be related to the
intensive chemotherapy with or without total-body irradiation (TBI)
required to ablate the recipients' marrow.18 Prospective
serologic testing of patients with chronic HBV infection who have HBV
reactivation after chemotherapy showed that immunosuppression enhances
viral replication. This is reflected by increases in serum levels of
hepatitis B e antigen (HBeAg) and HBV DNA polymerase and naive
hepatocyte infection with HBV.6,18,19 Discontinuation of
cytotoxic or immunosuppressive drugs restores immune function, resulting in rapid destruction of infected hepatocytes. Clinically, this may manifest as hepatitis and hepatic failure and even cause death.7,20-22
Despite its clinical importance, few data are available on the
incidence and risk factors for hepatitis due to HBV reactivation after
chemotherapy or immunosuppression. In particular, relation between the
various HBV virologic variables and HBV reactivation is unclear.
Because these cases of hepatitis are preceded or accompanied by
enhanced HBV viral replication, reflected by an increasing serum level
of HBV DNA on Digene Hybrid Capture II assays (Murex, Digene,
Gaithersburg, MD), it is not known whether HBV-infected patients with a
higher HBV viral load have a higher risk of hepatitis due to HBV
reactivation after HCT. Other HBV viral factors that might be involved
in HBV reactivation are the presence of variants, notably, the G Unlike the situation with hepatitis C virus (HCV) infections, the
clinical importance of HBV genotype has received little attention.
Seven genotypes of HBV are recognized, distinguished by differences of
more than 8% in the entire nucleotide sequence of approximately 3200 nucleotides. They are designated by letters ranging from A to
G.35-37 HBV genotypes have distinct geographical distributions.31,38-40 Overall, genotypes B and C are
common in Asia, whereas genotypes A and D prevail in Western countries. Genotype E is restricted to Africa, and genotype F is dominant in
Central America. Genotype G was described more recently,37 and its distribution is still unknown. There is now an increasing awareness of the clinical importance of HBV genotype.29,33
In this study, we investigated the prevalence and risk factors for
occurrence of hepatitis due to HBV reactivation after autologous HCT in
an area endemic for HBV infection.
Patients
Recipients of HCT underwent tests of liver function (including
determinations of serum levels of alanine aminotransferase [ALT],
albumin, and bilirubin) at least once a week during the first 12 weeks,
1 to 4 times weekly until the end of week 52 after HCT, and at 2- to
12-week intervals until their last follow-up or death. Hepatitis
serologic variables (HBsAg, HBeAg, HBeAb, HBV DNA on Digene assay and
PCR, and HCV RNA on PCR) were assessed in serum samples collected
before and during hepatic events when there was any clinical suspicion
of liver damage due to HBV infection. The occurrence of hepatic events
(acute hepatitis, chronic hepatitis, anicteric or icteric hepatitis,
hepatic failure, and veno-occlusive disease [VOD]) and death were
recorded. At least one pretransplantation serum sample (obtained 1-6 weeks before HCT) was available for all HCT recipients in this study.
Serial serum samples were collected before HCT and after HCT at 1 to 4 weekly intervals for the first year and then at 2 to 12 weekly
intervals until their last follow-up or death. At least 6 posttransplantation serum samples were available for each patient
in the study. All serum samples were stored at Hepatitis serologic analysis and HBV DNA assay
HBV PCR sequencing The HBV DNA extracted was used to amplify the precore and BCP fragments with PCR using the following primer sets: P7 (5'-TCCTCTGCCGATCCATACTG) and BC1 (5'GGAAAGAAGTCAGAAGGCAA) or P8 (5'-TCTGCCGATCCATACTGCGG) and BC1 (5'GGAAAGAAGTCAGAAGGCAA) at a concentration of 50 pmol. Direct sequencing of the PCR products was carried out with the "fmol" sequencing kit (Promega, Southampton, England). Sequencing primers P9 and BC1 were end-labeled with 25 µCi 32P-adenosine triphosphase (Amersham International, Amersham, England) in a volume of 10 µL using 10 U polynucleotide kinase (Boehringer Mannheim, Penzberg, Germany) for 20 minutes at 37°C, and 1.5 µL of the reaction mix was used directly in sequencing reactions. PCR product (90 µL) was precipitated with an equal volume of 4 M sodium acetate and 2 vol isopropanol for 10 minutes at room temperature, formed into pellets by centrifugation for 10 minutes, and washed twice with 70% ethanol. After resuspension in 20 µL water, 9.5 µL DNA was added to the reaction buffer with the end-labeled primer and 5 U Taq enzyme. Dideoxynucleotide termination sequencing was done according to the manufacturer's instructions. Cycle sequencing was performed for 30 rounds.The denaturation, annealing, and extension steps were 30 seconds, 30 seconds, and 1 minute in length, respectively. Reproducibility of results was ascertained with selected samples by repeat sequencing with different primers as well as sequencing from both the 5' and 3' ends. The PCR band with variants was electroeluted, phosphorylated, and cloned into the SmaI site of pUC18 by using conventional procedures. Recombinant clones were identified by restriction-enzyme digestion, and purified plasmid DNA from individual clones was sequenced in both directions with universal primers by using a commercial sequencing kit (Sequenase 2.0; United States Biochemicals, Cleveland, OH).42 HBV genotyping was done with restriction fragment-length polymorphism of an S region or a pre-S region amplicon, as described by Lindh et al.31 Definition of hepatic events Hepatitis was defined as a greater than 3-fold elevation in serum aminotransferase above the upper limit of normal on 2 consecutive determinations done at least 5 days apart and in the absence of clinical features suggestive of VOD or infection by cytomegalovirus or herpes simplex virus. Icteric hepatitis was defined as hepatitis associated with clinical jaundice and a serum bilirubin level that exceeded 30 µM (normal, <19 µM). Hepatitis was considered to be transient if the duration was less than 6 months and persistent if the duration was more than 6 months. Hepatitis was assumed to be due to HBV reactivation when it was preceded or accompanied by an elevation in serum HBV DNA to more than 10 times that of the pre-exacerbation baseline value, when serum HBV DNA test results turned from negative to positive, or when HBsAg test results became positive and remained so for 2 consecutive readings 5 days apart. Hepatic failure was defined as the presence of hepatic encephalopathy and deficits in blood coagulation (prothrombin time prolonged for more than 10 seconds). The clinical criteria used for diagnosis of VOD disease were a bilirubin level of at least 34.2 µM, hepatomegaly or right upper quadrant pain of liver origin, and a greater than 2% weight gain due to fluid accumulation; the diagnosis required that 2 of these 3 criteria occurred within 20 days of HCT. Moreover, the diagnosis was made only after hyperacute graft-versus-host disease, sepsis, cardiac failure, and tumor infiltration were ruled out.43Statistical analysis Clinical characteristics of patients were quantified and percentages calculated. Differences among groups were analyzed by using the median test for continuous data and the likelihood 2
or Fisher exact test for categorical data. The outcome of interest was
the survival time with hepatitis due to HBV reactivation, which was
defined as the time from marrow infusion to the time of diagnosis of
hepatitis due to HBV reactivation. Patients who died of other
causes and patients who were alive without hepatitis due to HBV
reactivation were censored. Cumulative survival with hepatitis due to
HBV reactivation was analyzed by using Kaplan-Meier curves.44 The Cox proportional hazards
model45 was used to compare differences in HBV hepatitis
survival between groups by obtaining hazard ratios and 95% confidence
intervals (CIs). Virologic factors possibly associated with the rate of
occurrence of hepatitis due to HBV reactivation were studied by using a
multivariate Cox proportional hazards model, and hazard ratios adjusted
for other model factors were obtained together with their 95% CIs. The
proportional hazards assumption was checked by examining the martingale
and deviance residuals. The SAS statistical program (version 8.0; SAS
Institute, Cary, NC) was used. A P value less than .05 was considered to represent a significant difference.
Clinical characteristics of patients undergoing autologous HCT Before HCT, 23 patients (16.8%) were positive for HBsAg, 37 (27.0%) were positive for anti-HBs (28 were also anti-HBc positive), and 77 (56.2%) were negative for HBV. There were no significant differences in sex, age, underlying disease, conditioning regimen, or percentage of patients with elevated serum ALT levels before HCT (Table 2).
Liver-related complications after autologous HCT One hundred thirty-seven patients were followed for a median of 25 months (range, 0.3-122 months). After autologous HCT, hepatitis developed in 32 patients (23%), with a mean onset at 136 ± 272 days after transplantation. Eleven cases were persistent and 21 were transient. Ten cases of persistent hepatitis (91%) and 3 cases of transient hepatitis (14%) were due to HBV reactivation (P < .0001). Most cases of persistent hepatitis (10 of 11) occurred in patients who were HBsAg positive before HCT, and only one patient negative for HBsAg had persistent hepatitis after HCT (P < .012). All cases of persistent hepatitis were due to HBV reactivation. Of the 32 cases of hepatitis after HCT, 13 were due to HBV reactivation and 13 were related to systemic sepsis; the cause of the remaining 6 cases was undetermined. Hepatitis due to HBV reactivation was more common in patients who were positive for HBsAg before HCT (11 of 23) than in patients who were HBsAg negative (2 of 114; P = .023). Seven of the 11 cases of severe hepatitis (icteric hepatitis or hepatic failure) were due to HBV reactivation, whereas only 6 of the 21 cases of anicteric hepatitis were due to HBV reactivation (P = .072).The peak HBV DNA level preceded the peak serum ALT level by a median of 6 weeks (range, 0-12 weeks). HBV-related hepatitis resulted in 7 cases of severe hepatitis (54%), whereas there were only 4 cases of severe hepatitis not related to HBV (21%; P = .072 on 2-sided Fisher exact test). The median peak serum ALT levels were higher in patients with HBV-related hepatitis (632 IU/L; range, 120-2410 IU/L) than in those with non-HBV-related hepatitis (208 IU; range, 93-3200 IU/L; P = .029 on median test). However, the median peak bilirubin levels were similar in the HBV-related cases of hepatitis (15 µM/L; range, 5-680 µM/L) and the non-HBV-related cases (24 µM/L; range, 6-380 µM/L; P = 1.000 on median test). The median time to peak ALT levels was 110 days (range, 29-374 days) for HBV hepatitis cases and 27 days (range, 3-1500 days) for non-HBV hepatitis cases (P = .0002 on median test). Three patients in this series underwent lamivudine treatment for hepatitis reactivation (lamivudine was not available before late 1998). Two patients recovered completely after this treatment. The third patient had complete resolution of hepatitis but died later of leukemia relapse. The patients' survival was not affected by the occurrence of
hepatitis (P = .189 on log rank test; Figure
1A) or HBV-related hepatitis
(P = .618 on log rank test; Figure 1B). However, patients who had severe hepatitis after HCT had a poorer survival than patients
in whom severe hepatitis did not develop after HCT
(P < .0001 on log-rank test; Figure 1C). Eighteen
patients (13%) had VOD after transplantation; 4 of these patients
(17%) were positive for HBsAg, 7 (19%) were positive for anti-HBs,
and 7 (9%) were negative for HBV (P value not significant).
Pretransplantation characteristics associated with HBV-related hepatitis after autologous HCT Pretransplantation characteristics associated with hepatitis due to HBV reactivation after HCT were an elevated serum ALT level, HBsAg positivity, detectable serum HBV DNA (on Digene assay), and BCP (T1762/A1764). Three patients (50%) with elevated serum ALT before HCT and 10 patients (8%) with normal serum ALT before HCT had hepatitis due to HBV reactivation (P < .0001). Eleven patients (48%) who were positive for HBsAg before HCT had hepatitis due to HBV reactivation, where only 2 HBsAg-negative patients (2%) had hepatitis due to HBV reactivation (P < .0001). Nine patients (90%) with detectable serum HBV DNA and only 4 (4%) without detectable serum HBV DNA had hepatitis due to HBV reactivation (P < .0001). Pretransplantation serum HBV DNA levels were also significantly higher in patients with hepatitis due to HBV reactivation (median, 800 pg/mL; range, 0-3800 pg/mL) than in those without hepatitis due to HBV reactivation (median, 0 pg/mL; range, 0-800 pg/mL; P < .0001 on median test). In addition, 7 patients (88%) with BCP (T1762/A1764) and 5 (31%) without BCP (T1762/A1764) had hepatitis due to HBV reactivation (P = .025; Table 3).
Patients at risk of posttransplantation hepatitis due to HBV reactivation The overall cumulative incidence rates of hepatitis due to HBV reactivation were 4.2% (95% CI, 0.6%-7.9%), 10.5% (95% CI, 4.9%-16.2%), and 11.7% (95% CI, 5.7%-17.8%) at 3, 6, and 24 months, respectively, after HCT. Univariate analysis was done to determine whether pretransplantation variables such as sex, age at diagnosis, HBsAg and HBeAg status, HBV DNA positivity on PCR and Digene assays, HBV genotype, BCP (T1762/A1764), and elevated serum ALT level before HCT were associated with an increased cumulative incidence of hepatitis due to HBV reactivation. We found that patients who were positive for HBsAg before HCT had a higher cumulative incidence of hepatitis due to HBV reactivation (51.9%; 95% CI, 30.6%-73.3%) than patients who were negative for HBsAg (2.5%; 95% CI, 0%-6.1%; P < .0001). Other HBV virologic factors found to be associated with posttransplantation hepatitis due to HBV reactivation were detectable serum HBV DNA before HCT (on Digene assay), HBV genotype C, and the presence of BCP (T1762/A1764). Patients with elevated serum ALT levels before HCT also had a higher cumulative incidence of hepatitis due to HBV reactivation. When multivariate Cox regression analysis was used to assess patients positive for HBsAg, detectable HBV DNA on Digene assay before HCT was the only significant and independent risk factor associated with hepatitis due to HBV reactivation after HCT (adjusted hazard ratio, 9.35; 95% CI, 1.65-52.6; Table 4).
Hepatitis due to HBV reactivation is a serious cause of morbidity and mortality in HBsAg-positive patients undergoing intensive immunosuppression or chemotherapy.1-11 This is a particularly important clinical issue in areas such as Hong Kong, where HBV infection is endemic.14,46 However, the incidence and risk factors for this clinical disorder have not been defined clearly. Hence, in this study, we investigated a cohort of Chinese patients (17% HBsAg positive and 20% anti-HBs and anti-HBc positive) who received intensive chemotherapy in association with autologous HCT. We found that nearly half of the HBsAg-positive patients in our series had hepatitis due to HBV reactivation after autologous HCT. The incidence was comparable to that reported in HBsAg-positive Chinese patients with lymphoma treated with chemotherapy.46 Although most of the posttransplantation cases of hepatitis due to HBV reactivation occurred in patients positive for HBsAg, this disorder also developed in 2 patients who were negative for HBsAg. One of these patients had natural immunity against HBV (anti-HBs and anti-HBc positive). This was probably related to reactivation from latent HBV infection, an assumption consistent with findings of previous studies.7-11 In patients with natural immunity against HBV, HBV DNA could still be detected in serum and peripheral blood mononuclear cells (PBMCs) by using sensitive PCR methods. Moreover, CD69+ (a marker of recent activation) cytotoxic T lymphocytes (CTLs) could still be detected in PBMCs from these patients, indicating the presence of an active CTL control on actively replicating HBV (at a very low level).47 The other HBsAg-negative patient in our study with hepatitis due to HBV reactivation was negative for HBV on PCR assay before HCT, and HBV was probably acquired from the multiple blood products given during HCT.48 The median time to onset of hepatitis due to HBV reactivation was 110 days after marrow infusion, significantly longer than for cases of hepatitis not due to HBV reactivation. The timing of the HBV-related cases of hepatitis coincides with immune reconstitution. Furthermore, peak HBV DNA levels preceded peak ALT levels in patients with hepatitis due to HBV reactivation by a median time of 6 weeks (or they accompanied peak ALT levels), suggesting the presence of an immune mechanism of liver damage. Because the cases of hepatitis due to HBV reactivation were
preceded or accompanied by an increasing level of viral replication, we
hypothesized that HBV virologic and host factors implicated to
influence HBV viral replication might affect the occurrence of
posttransplantation hepatitis due to HBV reactivation. Among those HBV
virologic factors, HBV genotype, BCP, and HBV viral load are of
particular interest. An association between BCP
(T1762/A1764) and severe liver disease was
previously reported.29-34 This might be related to the
accompanying changes in the secondary structure of the pregenome, which
might increase viral replication.34 Furthermore, the BCP
(T1762/A1764) double mutation enhanced
synthesis of core protein by 15 fold in an expression
system.28 In vitro, the mutation was shown to increase
transcription of pregenomic RNA by creation of a binding site for
hepatocyte nuclear factor 1.49 On the other hand, studies
in Taiwan and Japan suggested that, compared with HBV genotype B, HBV
genotype C was associated with more severe disease and a lower rate of
response to interferon- Using univariate analysis, we found that the risk factors associated with posttransplantation hepatitis due to HBV reactivation were HBsAg, detectable HBV DNA before HCT (on Digene assay), HBV genotype C, and the presence of BCP (T1762/A1764). We also observed that HBV genotype C was associated with the occurrence of BCP (T1762/A1764). These findings are similar to those of studies in Japan,29 Chinese populations,33,51 and Sweden.32 The underlying molecular explanation is unclear but might be related to the stabilization of the stem-loop structure of the encapsidation for various HBV genotypes with these HBV variants.51 Among the few pretransplantation viral and host factors related
to the occurrence of hepatitis due to HBV reactivation, a detectable
HBV DNA level (on Digene Hybrid Capture II assay) in HBsAg-positive
patients was found to be the principal predicting factor on
multivariate Cox regression analysis. Moreover, the pretransplantation
serum HBV DNA level was also significantly higher in patients with
hepatitis due to HBV reactivation than in those without this disorder.
Therefore, it is logical to reduce the HBV viral load and to keep it
below the detection limit of the Digene assay (105
copies/mL) before HCT and immediately afterward. Determining whether
additional reductions in the HBV viral load will be beneficial will
require studies using more sensitive HBV DNA quantitation methods.52 Treatment with interferon- In this series, VOD (Seattle criteria) was observed in 15% of patients after HCT. This finding is consistent with those in some other series,65-67 but the rate is higher than that in a recent European study (3.1%).68 The discrepancy in the incidence of VOD is probably related to our common use of high-dose cytoreductive therapy, which is a known risk factor for VOD43,68; our use of less stringent criteria for the diagnosis of VOD; and the presence of HBV infection in a substantial proportion of our patients. In conclusion, we found that hepatitis due to HBV reactivation was common in patients positive for HBsAg who underwent autologous HCT. Among such patients, a high HBV DNA level (>105 copies/mL) was the most important risk factor for HBV reactivation. Additional clinical trials of the preemptive use of nucleoside analogues to lower the HBV DNA level before transplantation are needed.
We thank Yuen Wing Sze and Amy Kwok for assistance in data management.
Submitted April 6, 2001; accepted November 21, 2001.
Supported by a grant from the Cheng Si-yuan (China International) Hepatitis Research Foundation to the University of Hong Kong; China National 973 research grant (G 1999 054105 (Y.M.W. and G.K.K.L); an ear-marked grant from the Hong Kong Research Grant Council; and a grant from the University Research Committee (R.L.).
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Raymond Liang, Division of Hematology and Oncology, University Department of Medicine, Queen Mary Hospital, 102 Pokfulam Road, Hong Kong SAR, China; e-mail: rliang{at}hkucc.hku.hk.
1. Markovic S, Drozina G, Vovk M, Fidler-Jenko M. Reactivation of hepatitis B but not hepatitis C in patients with malignant lymphoma and immunosuppressive therapy. A prospective study in 305 patients. Hepatogastroenterology. 1999;46:2925-2930[Medline] [Order article via Infotrieve]. 2. Ustun C, Koc H, Karayalcin S, et al. Hepatitis B virus infection in allogeneic bone marrow transplantation. Bone Marrow Transplant. 1997;20:289-296[CrossRef][Medline] [Order article via Infotrieve]. 3. Alexopoulos CG, Vaslamatzis M, Hatzidimitriou G. Prevalence of hepatitis B virus marker positivity and evolution of hepatitis B virus profile, during chemotherapy, in patients with solid tumours. Br J Cancer. 1999;81:69-74[CrossRef][Medline] [Order article via Infotrieve].
4.
Reed EC, Myerson D, Corey HT, Meyers JD.
Allogeneic marrow transplantation in patients positive for hepatitis B surface antigen.
Blood.
1991;77:195-200 5. Pariente EA, Goudeau A, Dubois F, et al. Fulminant hepatitis due to reactivation of chronic hepatitis B virus infection after allogeneic bone marrow transplantation. Dig Dis Sci. 1988;33:1185-1191[CrossRef][Medline] [Order article via Infotrieve]. 6. Hoofnagle JH, Dusheiko GM, Schafer DF, et al. Reactivation of chronic hepatitis B virus infection by cancer chemotherapy. Ann Intern Med. 1982;96:447-449. 7. Nagington J, Cossart YE, Cohen BJ. Reactivation of hepatitis B after transplantation operations. Lancet. 1977;68:105-112. 8. Villa E, Theodossi A, Portmann B, Eddleston AL, Williams R. Reactivation of hepatitis B virus infection in two patients: immunofluorescence studies of liver tissue. Gastroenterology. 1981;80:1048-1053[Medline] [Order article via Infotrieve]. 9. Blanpain C, Knoop C, Delforge ML, et al. Reactivation of hepatitis B after transplantation in patients with pre-existing anti-hepatitis B surface antigen antibodies: report on three cases and review of the literature. Transplantation. 1998;66:883-886[CrossRef][Medline] [Order article via Infotrieve]. 10. Dhedin N, Douvin C, Kuentz M, et al. Reverse seroconversion of hepatitis B after allogeneic bone marrow transplantation: a retrospective study of 37 patients with pretransplant anti-HBs and anti-HBc. Transplantation. 1998;66:616-619[CrossRef][Medline] [Order article via Infotrieve]. 11. Martin BA, Rowe JM, Kouides PA, DiPersio JF. Hepatitis B reactivation following allogeneic bone marrow transplantation: a case report and review of the literature. Bone Marrow Transplant. 1995;15:145-148[Medline] [Order article via Infotrieve]. 12. Horowitz MM. Uses and growth of hematopoietic cell transplantation. In: Thomas ED,Blume KG,Forman SJ, eds. Hematopoietic Cell Transplantation. 2nd ed. Cambridge, MA: Blackwell; 1999:12-18. 13. Chen PM, Liu JH, Fan FS, et al. Liver disease after bone marrow transplantation: the Taiwan experience. Transplantation. 1995;59:1139-1143[CrossRef][Medline] [Order article via Infotrieve].
14.
Liang R, Lau GKK, Kwong YL.
Chemotherapy and bone marrow transplantation for cancer patients who are also chronic hepatitis B carriers: a review of the problem.
J Clin Oncol.
1999;17:394-398 15. Iwai K, Tashima M, Itoh M, et al. Fulminant hepatitis B following bone marrow transplantation in an HBsAg-negative, HBsAb-positive recipient; reactivation of dormant virus during the immunosuppressive period. Bone Marrow Transplant. 2000;25:105-108[CrossRef][Medline] [Order article via Infotrieve]. 16. Kostaridou S, Ladis V, Kattamis A, Laras A, Hadziyannis SJ. HBeAg-negative hepatitis B in a previously thalassemic patient during immunosuppressive therapy for chronic GVHD. Bone Marrow Transplant. 1998;22:919-921[CrossRef][Medline] [Order article via Infotrieve]. 17. Caselitz M, Link H, Hein R, et al. Hepatitis B associated liver failure following bone marrow transplantation. J Hepatol. 1997;27:572-577[CrossRef][Medline] [Order article via Infotrieve]. 18. Davis GL, Hoofnagle JH. Reactivation of chronic hepatitis B virus infection. Gastroenterology. 1987;92:2028-2031[Medline] [Order article via Infotrieve]. 19. McMillan JS, Shaw T, Angus PW, Locarnini SA. Effect of immunosuppressive and antiviral agents on hepatitis B virus replication in vitro. Hepatology. 1995;22:36-43[CrossRef][Medline] [Order article via Infotrieve]. 20. Wands JR, Chura CM, Roll FJ, Maddrey WC. Serial studies of hepatitis-associated antigen and antibody in patients receiving antitumor chemotherapy for myeloproliferative and lymphoproliferative disorders. Gastroenterology. 1975;68:105-112[Medline] [Order article via Infotrieve]. 21. Scullard GH, Smith CI, Merigan TC, Robinson WS, Gregory PB. Effects of immunosuppressive therapy on viral markers in chronic active hepatitis B. Gastroenterology. 1981;81:987-991[Medline] [Order article via Infotrieve]. 22. Galbraith RM, Eddleston ALWF, Williams R, Zuckerman AJ. Fulminant hepatic failure in leukemia and choriocarcinoma related to withdrawal of cytotoxic drug therapy. Lancet. 1975;2:528-530[Medline] [Order article via Infotrieve]. 23. Carman WF, Jacyna MR, Hadziyannis S, et al. Mutation preventing formation of hepatitis B e antigen in patients with chronic hepatitis B infection. Lancet. 1989;2:588-591[Medline] [Order article via Infotrieve]. 24. Buckwold VE, Xu Z, Chen M, Yen TS, Ou JH. Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene expression and viral replication. J Virol. 1996;70:5845-5851[Abstract]. 25. Hasegawa K, Huang JK, Wands JR, Obata H, Liang TJ. Association of hepatitis B viral precore mutations with fulminant hepatitis B in Japan. Virology. 1991;185:460-463[CrossRef][Medline] [Order article via Infotrieve]. 26. Omata M, Ehata T, Yokosuka O, Hosoda K, Ohto M. Mutations in the precore region of hepatitis B virus DNA in patients with fulminant and severe hepatitis. N Engl J Med. 1991;324:1699-1704[Abstract]. 27. Tiollais P, Pourcel C, Dejean A. The hepatitis B virus. Nature. 1985;317:489-495[CrossRef][Medline] [Order article via Infotrieve].
28.
Baumert TF, Marrone A, Vergalla J, Liang TJ.
Naturally occurring mutations define a novel function of the hepatitis B virus core promoter in core protein expression.
J Virol.
1998;72:6785-6795 29. Orito E, Mizokami M, Sakugawa H, et al. A case-control study for clinical and molecular biological differences between hepatitis B viruses of genotypes B and C. Japan HBV Genotype Research Group. Hepatology. 2001;33:218-223[CrossRef][Medline] [Order article via Infotrieve].
30.
Takahashi K, Aoyama K, Ohno N, et al.
The precore/core promoter mutant (T1762A1764) of hepatitis B virus: clinical significance and an easy method for detection.
J Gen Virol.
1995;76:3159-3164
31.
Lindh M, Andersson AS, Gusdal A.
Genotypes, nt 1858 variants, and geographic origin of hepatitis B virus 32. Lindh M, Hannoun C, Dhillon AP, Norkrans G, Horal P. Core promoter mutations and genotypes in relation to viral replication and liver damage in East Asian hepatitis B virus carriers. J Infect Dis. 1999;179:775-782[CrossRef][Medline] [Order article via Infotrieve]. 33. Kao JH, Chen PJ, Lai MY, Chen DS. Hepatitis B genotypes correlate with clinical outcomes in patients with chronic hepatitis B. Gastroenterology. 2000;118:554-559[CrossRef][Medline] [Order article via Infotrieve]. 34. Kidd-Ljunggren K. Variability in hepatitis B virus DNA: phylogenetic, epidemiological and clinical implications. Scand J Infect Dis. 1996;28:111-116[Medline] [Order article via Infotrieve].
35.
Okamoto H, Tsuda F, Sakugawa H, et al.
Typing hepatitis B virus by homology in nucleotide sequence: comparison of surface antigen subtypes.
J Gen Virol.
1988;69:2575-2583 36. Norder H, Courouce AM, Magnius LO. Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology. 1994;198:489-503[CrossRef][Medline] [Order article via Infotrieve].
37.
Stuyver L, De Gendt S, Van Geyt C, et al.
A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness.
J Gen Virol.
2000;81:67-74 38. Magnius LO, Norder H. Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene. Intervirology. 1995;38:24-34[Medline] [Order article via Infotrieve]. 39. Mizokami M, Nakano T, Orito E, et al. Hepatitis B virus genotype assignment using restriction fragment length polymorphism patterns. FEBS Lett. 1999;450:66-71[CrossRef][Medline] [Order article via Infotrieve]. 40. Usuda S, Okamoto H, Iwanari H, et al. Serological detection of hepatitis B virus genotypes by ELISA with monoclonal antibodies to type-specific epitopes in the preS2-region product. J Virol Methods. 1999;80:97-112[CrossRef][Medline] [Order article via Infotrieve]. 41. Lau GKK, Lok ASF, Liang RHS, et al. Clearance of HBsAg after bone marrow transplantation: role of adoptive immunity transfer. Hepatology. 1997;25:1497-1501[CrossRef][Medline] [Order article via Infotrieve]. 42. Hou J, Lau GKK, Cheng J, Cheng CC, Luo K, Carman WF. T1762/A1764 variants of the basal core promoter of hepatitis B virus and its serological and clinical correlation in Chinese. Liver. 1995;19:411-417.
43.
McDonald GB, Hinds MS, Fisher LD, et al.
Veno-occlusive disease of the liver and multiorgan failure after bone marrow transplantation: a cohort study of 355 patients.
Ann Intern Med.
1993;118:255-267 44. Kaplan EL, Meier P. Non-parametric estimation from incomplete observations. J Am Stat Assoc. 1958;53:458-481. 45. Cox DR. Regression model and life tables. J R Stat Soc. 1972;34:187-220. 46. Lok AS, Liang RH, Chiu EK, Wong KL, Chan TK, Todd D. Reactivation of hepatitis B virus replication in patients receiving cytotoxic therapy. Report of a prospective study. Gastroenterology. 1991;100:182-188[Medline] [Order article via Infotrieve]. 47. Rehermann B, Ferrari C, Pasquinelli C, Chisari FV. The hepatitis B virus persists for decades after patients' recovery from acute viral hepatitis despite |
Top
Abstract
Introduction
A
mutation at nucleotide 1896 in the precore region (A1896),
which converts codon 28 for tryptophan to a stop codon
70°C) were tested retrospectively for
HBV DNA by using the Digene assay. The precore and core promoter HBV
DNA sequences for all marrow recipients positive for HBsAg or HBV DNA
(on PCR assay) were determined by direct DNA sequencing.
therapy.
large-scale analysis using a new genotyping method.
J Infect Dis.
1997;175:1285-1293