|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
From the Department of Medicine, Division of
Cardiology, Albert Einstein College of Medicine, Bronx, NY.
Human von Willebrand factor (VWF) gene sequences Endothelial cells form a monolayer that covers the
surface of all blood vessels. These cells participate in many
physiologic and pathophysiologic processes, and their accessible
locations make them an attractive target for development of gene
therapy approaches for the treatment of many diseases.1-6
Interest in endothelial cells has resulted in an expanding body of
research on the mechanism of endothelial-specific gene regulation. The goals of many of these studies are to first identify the regulatory regions of the endothelial-specific genes and then determine the molecular mechanism that governs the endothelial-specific activation of
gene expression. Target genes for these studies include
tie-1,7 tie-2,8 VEGF receptors 1 and
2,9-11 endothelin,12 PECAM-1,13 and VWF.14-16 The activation patterns of these promoters
have been studied in cell culture, and for some promoters also in
transgenic mice.8,14,15,17,18 Despite its limitations, in
vitro analysis in cell culture provides a feasible approach toward
determining the role of the multiple potential cis-acting elements
involved in regulating promoter activation.
We have previously demonstrated that a 734-bp region of the VWF gene
spanning sequences We have also reported the presence of another repressor designated
"R" that interacted with sequences +215 to +247 in the VWF
promoter.23 We demonstrated that while inhibition of
either the NF1 or "R" protein complex's interaction with VWF
promoter sequences was not sufficient to activate promoter function in nonendothelial cells, the simultaneous inhibition of the binding of
both repressors was sufficient to do so.23 The important role of repressors in regulating cell type-specific activity of the
VWF promoter is also supported by the studies of Nettelbeck et
al,19 which demonstrated a 20- and 169-fold enhancement of VWF promoter activity in bovine aortic endothelial (BAE) cells and
human umbilical vein endothelial cells (HUVEC), respectively (by using
a strategy that establishes a positive feedback loop involving
simultaneous expression of a strong artificial transcriptional activator), without the loss of specificity.19 This highly
maintained cell type-specific function of the VWF promoter was
hypothesized to be due to the role of repressors that inhibit the VWF
promoter activity in nonendothelial cells.19 We now report
that the "R" repressor protein is the transcription factor NFY with
a novel binding site that does not include the CCAAT sequence. We also report that NFY binds to a CCAAT element corresponding to sequences Plasmid construction
Cell culture and transfection
Statistical analyses The statistical analyses were carried out using the Student t test (2 samples assuming unequal variances).Gel mobility and supershift assays Nuclear extracts from cells were prepared by the method of Schreiber et al.25 Oligonucleotides corresponding to sequences +215 to +247 (sequence shown by dotted line in Figure 1) and 30 to +1 of the VWF promoter
were radioactively labeled using 32P- ATP and polynucleotide kinase.
The oligonucleotide probes were incubated with nuclear extracts (5 µg) in the presence or absence of competitors in a 20-µL reaction
mixture containing 100 mM KCl, 10 mM HEPES (pH 7.9), 2.5 mM
MgCl2, 0.5 mM dithiothreitol, and 1 µg poly (dI-dC) for
30 minutes at room temperature. The competitors were wild-type or
mutant oligonucleotides that correspond to VWF sequences +215 to +247,
oligonucleotides containing E2A binding site
5'GAACCAGAACACCTGCAGCA3', C/EBP binding site
5'TGCAGATTGCGCAATCTGCA3', and NFY binding site
5'CGTCTCCACCAATGGGAGGGCTGGGC3'. For gel mobility supershift
assays, extracts were preincubated with antibodies (1 µg) under the
conditions described above for 3 hours at 4°C prior to the addition
of the labeled probes and then further incubated for 15 minutes at room
temperature following addition of the probes. Antibodies used in the
supershift assays were mouse monoclonal anti-NF-YA antibody
(Pharmingen, San Diego, CA), rabbit polyclonal anti-NF-YB and
anti-NF-YC antibodies (gift of R Mantovani), monoclonal anti-E2A,
TAL1, and rabbit polyclonal anti IgG antibody (Santa Cruz
Biotechnology, Santa Cruz, CA). All protein-DNA complexes were resolved
on a 5% nondenaturing polyacrylamide gel in 1X Tris-borate ethylenediaminetetraacetic acid (EDTA) buffer. Gels were dried and subjected to authoradiography. Densities of protein-DNA complexes were quantified by phosphorimager analysis using ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
DNA methylation interference DNA methylation interference was carried out according to Schwarzenbach26 with slight modifications. Briefly, 2 DNA probes corresponding to sequences +215 to +247 of the VWF promoter were made by 32P-3' end labeling of either the top or bottom strands independently. The end-labeled DNA probes were partially methylated at the guanine residues by incubation for 5 minutes with dimethyl sulfate, followed by ethanol precipitation and resuspension in 10 mM Tris-HCl and 0.1 mM EDTA (pH 8.0) at 20 000 cpm/µL. Methylated DNA probes (300 000 cpm) were used in binding reactions with HeLa cell nuclear extracts (120 µg) for 30 minutes, in a total reaction volume of 100 µL. The binding buffer and gel electrophoresis conditions were the same as described for the gel mobility assay. After electrophoresis, wet gels were exposed to x-ray autoradiography film overnight, and portions of the gel containing bound DNA ("X" and "NX" fractions) and unbound DNA ("F" fraction) were excised. The DNA was purified from the gel by electroelution onto a diethylaminoethyl membrane, and exposed to 1M piperidine at 90°C for 30 minutes. The piperidine-treated unbound and protein-bound DNA were analyzed by gel electrophoresis on a 20% polyacrylamide/urea sequencing gel and exposed for autoradiography. The sequence of DNA was known by comparing the unbound ("F") fraction of the top-strand DNA probe to that of the bottom strand, running in parallel on the same gel.
NFY transcription factor is a component of the repressor protein complex "R" that interacts with VWF promoter sequences in the exon 1 Human VWF promoter sequences spanning nucleotides487 to +247
function as an endothelial-specific promoter. Deletion analysis and
specific base substitution mutations previously performed by others and
us demonstrated the presence of several cis-acting elements that either
activate or repress VWF promoter activity (Figure 1). Deletion analysis
demonstrated that whereas VWF promoter sequences that span 90 to +155
are active in both endothelial and nonendothelial cells, sequences
spanning 90 to +247 are active only in endothelial
cells.21,23 This indicates that the +155 to +247 region of
the VWF (that includes the GATA binding site) is required for
endothelial cell-specific activation of the VWF promoter, but the same
region also contains sequences that repress promoter activity in
nonendothelial cells.
Our previous analysis of the VWF promoter +155 to +247 region for the presence of potential repressor element(s) demonstrated that a protein complex (present in both endothelial and nonendothelial cells) designated "R" interacted with sequences +215 to +247 and functioned as a repressor.23 To characterize the "R" protein complex, we searched for the presence of potential DNA cis-acting elements with homology to previously reported transcription factors' binding sequences. Our analysis demonstrated the presence of an E box that is a binding site for the E2A transcription factors and their partner SCL/Tal1.27,28 Thus, to determine whether E2A transcription factors were a component of the "R" complex, and whether they were differentially present in "R" complexes in endothelial compared with nonendothelial cells, we carried out gel mobility experiments with nuclear extracts prepared from HeLa cells, bovine aortic smooth muscle (BSM), and BAE cells. For these analyses, nuclear extracts were incubated with the
double-stranded oligonucleotide probe corresponding to VWF sequences +215 to +247, in the presence or absence of competitor oligonucleotide that contained the consensus E2A binding site. Unlabeled
oligonucleotide sequence +215 to +247 (ds-R) was used as a specific
competitor, and for negative controls we used double-stranded
oligonucleotide competitors containing binding sites for NFY and C/EBP
transcription factors. The results of these analyses demonstrated that
nuclear extracts from all 3 cell types displayed a similar pattern of complex formation in the absence of competitors, although the intensity
of the bands corresponding to the complexes varied among the cell types
(Figure 2, lanes 2, 7, 12). The probe
formed a specific slow migrating major complex (MC) with nuclear
extracts from all cell types that were abolished in presence of
specific competitors as previously reported23 (Figure 2,
lanes 3, 8, 13). We also observed 3 faster migrating complexes (C2, C3,
and C4) with varying intensities (depending on the cell types).
However, the appearances of these complexes were not consistent in
repeated experiments (eg, see Figure 3),
suggesting that either these complexes were not specific or that the
condition for their formation was not optimal in these experiments.
Thus, the natures of these faster-migrating complexes were not pursued
further. The competitor that contained the E2A consensus binding site
did not abolish the formation of these specific complexes in any cell
type, suggesting that E2A is not the component of the "R" protein
that interacts with VWF sequences +215 to +247 (Figure 2, lanes 4, 9, 14). The competitor that contained the C/EBP consensus binding site
also had no effect on the formation of the MC. However, the competitor
that contained the NFY binding sequence inhibited the formation of the
MC (as well as most of the other minor complexes) in all cell types
(Figure 2, lanes 5, 10, 15). We have also used oligonucleotides that
contain Tal1 and Oct binding consensus sequences and demonstrated that these oligonucleotide competitors did not inhibit the formation of any
of these complexes (data not shown). These results suggested that the
E2A transcription factors are not a constituent of the "R" protein
complex that interact with VWF sequences +215 to +247, but the NFY
transcription factor may be a component of this "R" complex.
To demonstrate directly whether NFY interacts with +215 to +247 sequences of the VWF promoter, supershift gel mobility experiments were carried out. In these assays, nuclear extracts from HeLa, BAE, and BSM cells were preincubated with anti-NFY/A antibody, anti-E2A antibody, or an IgG antibody prior to the addition of the probe. The results demonstrated that the anti-NFY/A antibody was able to supershift completely the slow migrating MC in all 3 cell types, whereas no supershift was observed with either the IgG or anti-E2A antibodies (Figure 3). These results clearly demonstrate that an NFY transcription factor complex containing the NFY/A subunit interacts with sequences +215 to +247 of the VWF promoter. Identification of the DNA sequences necessary for interaction of NFY with sequences +215 to +247 of the VWF gene The consensus binding site for NFY is reported to be CCAAT.29 Mutagenesis analyses by several laboratories have demonstrated that there is a strict requirement, with very few exceptions, for the presence of all 5 nucleotides to allow NFY binding.29 However, sequence analyses of the +215 to +247 region of the VWF promoter that interacted with NFY did not demonstrate the presence of a CCAAT element. To identify the nucleotide sequences in this region that directly interacted with the NFY complex, we performed DNA methylation interference analysis. The double-stranded oligonucleotide corresponding to sequences +215 to +247 was labeled at one end, exposed to dimethyl sulfate, and incubated with HeLa cell nuclear extracts. The NFY-DNA complexes and the free probes were separated by acrylamide gel electrophoresis and eluted prior to cleavage by piperidine and analysis on polyacrylamide denaturing gels. Comparison of the sequence pattern of the free probe (Figure 4, lane 1), the probe bound to NFY that forms MC complex (Figure 4, lane 2), and the probe bound to the protein in C3 complex (Figure 4, lane 3) demonstrated the absence of 2 fragments corresponding to piperidine cleavage after the G nucleotides (on the bottom strand) at positions +232 and +233 specifically in the NFY-bound probe. The intensity of the band corresponding to cleavage after the G nucleotide (on the bottom strand) at position +236 was also significantly reduced compared with the unbound probe. However, comparison of the intensity of this band in the NFY-bound probe and the probe in the C3 complex suggests that this nucleotide may not be specifically involved in NFY-DNA interaction (Figure 4).
These results demonstrate that the G nucleotides at positions +232 and +233 on the noncoding strand are directly involved in the interaction with the NFY transcription factor. These data are consistent with our previous mutation analysis, which demonstrated that the 3 base substitution mutations of nucleotides +229, +232, and +233 abolished the "R" protein-DNA interaction.23 However, these results do not exclude the possibility that additional
sequences in the +215 to +247 region may also be required for NFY
binding. To identify other potential DNA bases that may be involved in
this interaction, we performed gel mobility competition assays. For
these analyses, several double-stranded oligonucleotides corresponding
to sequences +215 to +247 were generated; each contained a different 3 base substitution mutation as shown in Figure
5A. These mutant oligonucleotides were
used as competitors (at concentrations 20× in excess of labeled probe)
in gel mobility assays. When the wild-type sequence was used as a probe
and the mutant oligonucleotides were present as competitors, the M1,
M3, M5, and M6 oligonucleotides efficiently competed with the wild-type
probe and inhibited NFY complex formation (Figure 5B). When these
mutant oligonucleotides were labeled and used as probes directly, they
formed an NFY-DNA complex (data not shown), thus indicating that base
substitution mutations in these oligonucleotides do not effect NFY-DNA
interaction. However, the M2, M4, and M7 oligonucleotides failed to
compete with the wild-type probe and did not inhibit complex formation (Figure 5B). When these oligonucleotides were used at higher
concentrations (100× excess), the M7 oligonucleotide was able to
compete with the wild-type probe, whereas M2 and M4 did not (data not
shown). In addition, when M2 and M4 oligonucleotides were labeled and used as probes directly, they failed to form an NFY-DNA complex (data
not shown).
These results demonstrate that base substitution mutations in M2 and M4 oligonucleotides abolish NFY-DNA interaction, since these oligonucleotides did not compete with the wild-type probe when used as competitors (at either 20× or 100× excess), and did not form the NFY-DNA complex when used as probes. The base substitution mutations in the M4 oligonucleotide correspond to sequences +232, +233, and +234. This is consistent with the results of a previous mutation analysis23 and methylation interference, which demonstrated the involvement of bases +232 and +233 in NFY-DNA interaction. The inhibition of NFY-DNA complex formation by base substitution mutation in M2 indicates that in addition to bases at +232 and +233, the CCG sequence at positions +226 to +228 is also necessary for efficient NFY-DNA interaction. These data demonstrate that the NFY transcription factor interacts with a novel DNA element in the VWF gene promoter that constitutes nucleotides +226 CCGNNNCCC +234 and does not correspond to the previously reported CCAAT sequence. In the absence of NF1 binding, mutation of the NFY binding sequence in the first exon results in VWF promoter activation in nonendothelial cells Our previous analysis demonstrated that base substitution mutation in sequences +229, +231, and +232 in VWF promoter (in the absence of NF1 binding) resulted in VWF promoter activation in bovine smooth muscle cells,23 thus functionally confirming that these base substitutions, which overlap with those shown by methylation interference and mutation analysis to be required for NFY binding, relieve inhibition of VWF promoter activity in smooth muscle cells. To further confirm the role of NFY as a repressor, we proceeded to determine the effect of mutations in the NFY binding sequence on VWF promoter activation in HEK293 as a model of a human nonendothelial cells. First, we confirmed the interaction of NFY with VWF sequences in gel mobility experiments using nuclear extracts prepared from HEK293 cells (data not shown). Next, we generated a mutant VWF promoter fragment that corresponded to sequences90 to +247 with base
substitutions in CCG element (in position +226 to +228), and we
generated 2 other mutant VWF promoter fragments that corresponded to
sequences 487 to +247, one containing the same base substitutions in
CCG element alone and the other containing the same mutation in CCG
element, in addition to base substitution mutations that abolish the
upstream NF1-DNA interaction. Base substitutions in CCG were the same
as the one described in Figure 5, which was shown to abolish NFY-DNA
interaction. Base substitutions in the NF1 binding site were the same
as those previously described.22 These mutant VWF promoter
fragments were fused to a human growth hormone structural gene to
generate plasmids HGH-1KY (containing VWF fragment 90 to +247 with
mutation in CCG element), HGH-KY (containing VWF fragment 487 to +247
with mutation in CCG element), and HGH-KRY (containing VWF fragment
487 to +247 with double mutation in CCG element and NF1 binding
site). We stably transfected HEK293 cells with these plasmids and those
of the wild-type HGH-1, HGHG-1K, and HGH-K. Stable transfection
analysis was carried out to generate conditions in which transfected
plasmids could integrate into host cellular chromatin. This approach
was based on previous reports on the function of NFY, which
demonstrated that this transcription factor mediates nucleosomal
assembly. Thus, to accurately determine the functional role of NFY in
VWF promoter activation, plasmids may need to acquire chromatin
structure. Our previous analysis of the "R" repressor function was
also performed in stably transfected cells.23
The level of growth hormone expressed in cells transfected with mutant
and wild-type plasmids were determined as previously described.23 The results (Figure
6A) demonstrated that the level of growth
hormone expression from plasmids HGH-1K and HGH-K was significantly
reduced (approximately 80%, P < .01) compared with that
from HGH-1. However, the expression from HGH-1KY was similar to that
from HGH-1 (5-fold increase in activity compared with wild-type HGH-1K,
P < .01), and expression from HGH-KRY was significantly increased (2-fold, P < .01) compared with that from
HGH-K. We hypothesize that in the context of the
These results demonstrated that in the absence of NF1 (and most likely Oct1) repressor binding, the base substitutions in the CCG element that inhibit NFY-DNA interaction relieve the repression of VWF promoter activation in nonendothelial cells. Expression of these plasmids in BAE cells demonstrated that VWF
promoter fragments corresponding to These results demonstrate that NFY (when binding to the downstream CCG element) did not function as an activator in endothelial cells. However, its function as a repressor in endothelial cells could not be directly demonstrated since the wild-type promoter fragments HGH-1K and HGH-K were as active as the core promoter (HGH-1) in the BAE cells. Interaction of NFY with the upstream CCAAT element results in activation of the VWF promoter The CCAAT consensus binding site for NFY is usually located approximately 60 bp to 100 bp upstream of the transcription start site in many eukaroyotic genes, although the presence of a CCAAT element at an unusual position (18 to 14) downstream of the TATA box in the
VWF gene is reported.30 We have recently demonstrated that
NFY interacts with this CCAAT element and through this interaction mediates irradiation induction of the VWF core promoter sequences 90
to +22.31 In order to determine the role of the NFY
interaction with this CCAAT element in the regulation of the
endothelial-specific VWF promoter fragment (sequences 487 to +247),
we carried out mutation and transfection analyses as described for the
downstream repressor NFY binding site. For these analyses, a mutation
in the CCAAT element that had previously been shown to inhibit the NFY-DNA interaction31 was incorporated into the sequence
487 to +247, and the resultant DNA fragment was fused to the human growth hormone structural gene to generate the plasmid K-NFY. Expression from the mutant VWF promoter was compared with that of the
wild-type plasmid HGH-K in stably transfected BAE cells by determining
the level of secreted growth hormone. The results demonstrate that the
mutation of the CCAAT element significantly reduces the VWF promoter
activity in BAE cells (Figure 7). We did
not perform similar transfection analysis in BSM cells since the
wild-type fragment is not expressed in BSM cells, thus no further
information would be gained by expressing a mutant promoter in which
mutation results in loss of function in expressing cell types.
These results demonstrate that NFY functions as an activator of the VWF promoter when it interacts with its consensus binding sequence CCAAT. Components of NFY protein complexes that interact with the CCAAT and repressor element in the first exon are similar The NFY transcription factor generally consists of 3 subunits: NFY-A, NFY-B, and NFY-C, which are all necessary for protein-DNA interaction.32 However, various subunits of NFY can dimerize and interact with other proteins.33 We have demonstrated that NFY functions as both an activator and repressor of VWF promoter activity.To determine whether the constituents of the NFY complexes that bind to
the repressor element (at position +226 to +234) differ from those
which bind to the CCAAT element (at position
Efficiency of NFY interaction with the CCAAT element is higher than that of the repressor element Our data demonstrate that the NFY complex that interacts with the repressor and the CCAAT sequences contains similar components. However, the binding affinity of NFY for these 2 distinct sequences could be different, and thus contribute toward a mechanism for NFY's opposing roles as activator and repressor. To address this possibility, we carried out gel mobility experiments with the R- and CCAAT-containing IR probes in the presence of specific NFY competitors. The dissociation of the specific NFY-DNA complexes was determined by analyzing the complexes at various time points after addition of a fixed amount of the NFY-binding oligonucleotide competitor, and in an independent experiment in the presence of various concentrations of the competitor.The time-dependent analysis demonstrates that the dissociation of the
NFY complex from the oligonucleotide probe corresponding to the R
element occurs almost immediately in the presence of the NFY
competitor. However, dissociation of the NFY complex from the
CCAAT-containing oligonucleotide probe takes approximately 30 minutes
after addition of the competitor (Figure
9B).
The concentration-dependent analysis demonstrates that a 1- to 5-fold excess of the NFY-specific competitor was sufficient to reduce NFY complex formation with the repressor element by 60%, whereas a 10-fold excess of the same competitor was required to achieve the same level of inhibition of complex formation with the CCAAT-containing probe (Figure 9A). These results demonstrated that the binding efficiency of NFY for the CCAAT sequence is significantly greater than that of the repressor sequence.
The activation of the VWF gene promoter in endothelial cells is regulated by a complex mechanism that involves a number of activators and repressors. The role of repressors is important specifically in the maintenance of an inactivated state of the promoter in nonendothelial cells.19 We had previously demonstrated that a protein complex, designated "R," interacts with sequences +215 to +247 of the VWF promoter and inhibits promoter activation in smooth muscle cells.23 Using competition and supershift gel mobility assays, we now identify this "R" protein complex as the NFY factor. Transfection analysis in HEK 293 cells (as well as our previous transfection in BSM cells) confirmed the role of this NFY-DNA interaction as a repressor of VWF promoter activity in nonendothelial cells. The observation that the NFY-DNA complex is present in both endothelial and nonendothelial cells is consistent with the presence of other repressors (NF1 and Oct1) of the VWF promoter in both cell types. We could not demonstrate the repressor function of the NFY in endothelial cells since the promoter sequences that contain this repressor NFY binding site are already active in endothelial cells; thus, the gain of activity that is the assay for the role of repressor could not be determined. Based on these observations, we hypothesize that repressors have inhibitory functions on the VWF promoter in all cell types, however, an endothelial cell-specific mechanism exists that overcomes this inhibitory function specifically in endothelial cells. Such a mechanism may involve the presence of endothelial-specific activators that directly interact with DNA or coactivators that may interact and modify the function of either activators or repressors. The sequence analysis of the +215 to +247 region did not reveal the presence of the CCAAT sequence that has been reported as an absolute requirement for NFY interaction with DNA. DNA methylation interference, mutation, and competition gel mobility assays demonstrated that the sequence CCGNNNCCC (+226 to +234) in the VWF promoter constitutes the binding site of NFY. Recently, another novel binding site for NFY in the promoter of the CHOP gene was also reported.34 The NFY binding site in the CHOP promoter constitutes a CGTGC sequence as well as a CCAAT sequence, and NFY was shown to interact with both elements.34 Interaction of NFY with the commonly identified CCAAT element is generally known to be necessary for basal constitutive promoter activation, although NFY also mediates cell-specific and inducible gene expression.33,35-37 Our results demonstrate that NFY can also interact with nonconsensus sequences that do not include the CCAAT element, and it can function as a transcription repressor as well as an activator. The VWF promoter also contains a consensus CCAAT element spanning
nucleotides The NFY transcription factor is a heteromeric protein complex that consists of 3 subunits, NFY-A, NFY-B, and NFY-C.32 Alternative splicing generates different isoforms of the A subunit in some cell types, and subunits of NFY can interact with other proteins, thus providing a mechanism for the formation of NFY complexes with variable components.36,33 We have recently demonstrated that there is only a single NFY-A subunit in endothelial cells.31 Here we have also analyzed the components of NFY that interact with the CCAAT and the repressor element and show that the constituents of the NFY complex that bind to these sites are similar. However, we have also shown that NFY has a significantly greater binding affinity for the consensus CCAAT sequence compared to the nonconsensus repressor element. Our results suggest that neither different A subunit isoforms nor the basic composition of NFY appear to be the mechanism by which NFY performs its dual function in regulation of VWF gene expression. Other transcription factors also have dual functions. The transcription factor YY1 can function as either an activator or a repressor depending on its binding sequence and/or its interaction with specific cofactors.38,39 Some transacting factors, including NFY, interact with coactivators such as p300/CBP and PCAF that function as histone acetylases, and others can interact with corepressors that function as histone deacetylases.40-44 A switch between the activator and repressor functions of YY1 is correlated to interactions with factors that function as coactivators or corepressors.45,46 Based on these results, we hypothesize that NFY can play different roles in the regulation of gene activation, and these roles may be partially dependent on the NFY binding sequence. Although the basic components of the NFY complexes that interact with the VWF promoter are similar, we hypothesize that the dual function of NFY may be regulated through recruitment of different cofactors.
We thank Dr R. Mantovani for the gift of NF-YB and NF-YC antibodies, and Dr Q. Zhan for helpful discussion.
Submitted May 23, 2001; accepted November 13, 2001.
Supported by research grant HL-54678 (N.J.) from the National Institutes of Health.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Nadia Jahroudi, F717, Forchheimer Bldg, Department of Medicine, Division of Cardiology, Albert Einstein College of Medicine, 1300 Morris Park Ave, Bronx, NY 10461; e-mail: njahroud{at}aecom.yu.edu.
1.
Cines DB, Pollak ES, Buck CA, et al.
Endothelial cells in physiology and in the pathophysiology of vascular disorders.
Blood.
1998;91:3527-3561 2. Risau W. Differentiation of endothelium. FASEB J. 1995;9:926-933[Abstract].
3.
Garlanda C, Dejana E.
Heterogeneity of endothelial cells.
Arterioscler Thromb Vasc Biol.
1997;17:1193-1202
4.
Jager U, Zhao Y, Porter CD.
Endothelial cell-specific transcriptional targeting from a hybrid long terminal repeat retrovirus vector containing human prepro-endothelin-1 promoter sequences.
J Virol.
1999;73:9702-9709 5. Jaggar RT, Chan HY, Harris AL, Bicknell R. Endothelial cell-specific expression of tumor necrosis factor-alpha from the KDR or E-selectin promoters following retroviral delivery. Hum Gene Ther. 1997;8:2239-2247[Medline] [Order article via Infotrieve]. 6. Ozaki K, Yoshida H, Saito I, Ikeda Y, Sugimura T, Terada M. Use of von Willebrand factor promoter to transduce suicidal gene to human endothelial cells, HUVEC. Hum Gene Ther. 1996;7:1483-1490[Medline] [Order article via Infotrieve].
7.
Korhonen J, Lahtinen I, Halmekyto M, et al.
Endothelial-specific gene expression directed by the tie gene promoter in vivo.
Blood.
1995;86:1828-1835
8.
Schlaeger TM, Bartunkova S, Lawitts JA, et al.
Uniform vascular-endothelial-cell-specific gene expression in both embryonic and adult transgenic mice.
Proc Natl Acad Sci U S A.
1997;94:3058-3063
9.
Morishita K, Johnson DE, Williams LT.
A novel promoter for vascular endothelial growth factor receptor (flt-1) that confers endothelial-specific gene expression.
J Biol Chem.
1995;270:27948-27953
10.
Ronicke V, Risau W, Breier G.
Characterization of the endothelium-specific murine vascular endothelial growth factor receptor-2 (Flk-1) promoter.
Circ Res.
1996;79:277-285
11.
Kappel A, Schlaeger TM, Flamme I, Orkin SH, Risau W, Breier G.
Role of SCL/Tal-1, GATA, and Ets transcription factor binding sites for the regulation of Flk-1 expression during murine vascular development.
Blood.
2000;96:3078-3085
12.
Paul M, Zintz M, Bocker W, Dyer M.
Characterization and functional analysis of the rat endothelin-1 promoter.
Hypertension.
1995;25:683-693 13. Almendro N, Bellon T, Rius C, et al. Cloning of the human platelet endothelial cell adhesion molecule-1 promoter and its tissue-specific expression. J Immunol. 1996;157:5411-5421[Abstract].
14.
Jahroudi N, Lynch DC.
Endothelial-cell-specific regulation of von Willebrand factor gene expression.
Mol Cell Biol.
1994;14:999-1008
15.
Aird WC, Jahroudi N, Weiler GH, Rayburn HB, Rosenberg RD.
Human von Willebrand factor gene sequences target expression to a subpopulation of endothelial cells in transgenic mice.
Proc Natl Acad Sci U S A.
1995;92:4567-4571
16.
Guan J, Guillot PV, Aird WC.
Characterization of the mouse von Willebrand factor promoter.
Blood.
1999;94:3405-3412 17. Sclaeger TM, Qin Y, Fujiwara Y, Magram J, Sato TN. Vascular endothelial cell lineage-specific promoter in transgenic mice. Development. 1995;121:1089-1098[Abstract].
18.
Aird WC, Edleberg JM, Weiler-Guettler H, Simmons WW, Smith TW, Rosenberg RD.
Vascular bed-specific expression of an endothelial cell gene is programmed by the tissue microenvironment.
J Cell Biol.
1997;138:1117-1124 19. Nettlebeck DM, Jerome V, Muller R. A strategy for enhancing the transcriptional activity of weak cell type-specific promoters. Gene Ther. 1998;5:1656-1664[CrossRef][Medline] [Order article via Infotrieve]. 20. Schwachtgen JL, Janel N, Barek L, Duterque-Coquillaud M, Ghysdael J, Kerbiriou-Nabias D. Ets transcription factors bind and transactivate the core promoter of the von Willebrand factor gene. Oncogene. 1997;15:3091-3102[CrossRef][Medline] [Order article via Infotrieve].
21.
Schwachtgen JL, Remacle JE, Janel N, et al.
Oct-1 is involved in the transcriptional repression of the von Willebrand factor gene promoter.
Blood.
1998;92:1247-1258
22.
Jahroudi N, Ardekani AM, Greenberger JS.
An NF1-like protein functions as a repressor of the von Willebrand factor promoter.
J Biol Chem.
1996;271:21413-21421 23. Ardekani AM, Greenberger JS, Jahroudi N. Two repressor elements inhibit expression of the von Willebrand factor gene promoter in vitro. Thromb Haemost. 1998;80:488-494[Medline] [Order article via Infotrieve].
24.
Jahroudi N, Ardekani AM, Greenberger JS.
Ionizing irradiation increases transcription of the von Willebrand factor gene in endothelial cells.
Blood.
1996;88:3801-3814
25.
Schreiber E, Matthias P, Muller MM, Schaffner W.
Rapid detection of octamer binding proteins with "mini-extracts," prepared from a small number of cells.
Nucleic Acids Res.
1989;17:6419
26.
Schwarzenbach HJ, Newell W, Matthias P.
Involvement of the Ets family factor PU.1 in the activation of immunoglobulin promoters.
J Biol Chem.
1995;270:898-907 27. Blackwell TK, Weintraub H. Differences and similarities in DNA-binding peferences of Myo D and E2A protein complexs revealed by binding site selection. Science. 1990;23:1104-1110.
28.
Begley CG, Green AR.
The SCL gene: from case report to critical hematopoietic regulator.
Blood.
1999;93:2760-2770
29.
Mantovani R.
A survey of a 178 NF-Y binding CCAAT boxes.
Nucleic Acids Res.
1998;26:1135-1143
30.
Collins CJ, Underdahl JP, Levene RB, et al.
Molecular cloning of the human gene for von Willebrand factor and identification of the transcription initiation site.
Proc Natl Acad Sci U S A.
1987;84:4393-4397 31. Bertagna A, Jahroudi N. The NFY transcription factor mediates induction of the von Willebrand factor promoter by irradiation. Thromb Haemost. 2001;85:837-844[Medline] [Order article via Infotrieve].
32.
Maity SN, Sinha S, Ruteshousher EC, de Crombrugghe B.
Three different polypeptides are necessary for DNA binding of the mammalian heteromeric CCAAT binding factor.
J Biol Chem.
1992;267:16574-16580
33.
Bellorini M, Lee DK, Dantonel JK, et al.
CCAAT binding NF-Y-TBP interactions: NF-YB and NF-YC require short domains adjacent to their histone fold motifs for association with TBP basic residues.
Nucleic Acids Res.
1997;25:2174-2181
34.
Ubeda M, Habener JF.
CHOP gene expression in response to endoplasmic-reticular stress requires NFY interaction with different domains of a conserved DNA-binding element.
Nucleic Acids Res.
2000;28:4987-4997
35.
Marziali G, Perrotti E, Ilari R, et al.
The activity of the CCAAT-box binding factor NF-Y is modulated through the regulated expression of its A subunit during monocyte to macrophage differentiation: regulation of tissue-specific genes through a ubiquitous transcription factor.
Blood.
1999;93:519-526
36.
Ishimaru F, Mari B, Shipp MA.
The type 2 CD10/neutral endopeptidase 24.11 promoter: functional characterization and tissue-specific regulation by CBF/NF-Y isoforms.
Blood.
1997;89:4136-4145
37.
Nakshatri H, Bhat-Nakshatri P, Currie RA.
Subunit association and DNA binding activity of the heteromeric transcription factor NF-Y is regulated by cellular redox.
J Biol Chem.
1996;271:28784-28791
38.
Shrivastava A, Calame K.
An analysis of genes regulated by the multi-functional transcriptional regulator Yin Yang-1.
Nucleic Acids Res.
1994;22:5151-5155 39. Shi Y, Lee JS, Galvin KM. Everything you have ever wanted to know about Yin Yang 1. Biochim Biophys Acta. 1997;1332:F49-66[Medline] [Order article via Infotrieve]. 40. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y. The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell. 1996;87:953-959[CrossRef][Medline] [Order article via Infotrieve]. 41. Torchia J, Glass CK, Rosenfeld MG. Co-activators and co-repressors in the integration of transcriptional response. Curr Opin Cell Biol. 1998;10:373-383[CrossRef][Medline] [Order article via Infotrieve].
42.
Currie RA.
NF-Y is associated with the histone acetyltransferases GCN5 and P/CAF.
J Biol Chem.
1998;273:1430-1434
43.
Faniello MC, Bevilacqua MA, Condorelli G, et al.
The B subunit of the CCAAT- binding factor NFY binds the central segment of the co-activator p300.
J Biol Chem.
1999;274:7623-7626
44.
Burke LJ, Baniahmad A.
Co-repressors 2000.
FASEB J.
2000;14:1876-1888 45. Shi Y, Seto E, Chang L-S, Shenk T. Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell. 1991;67:377-388[CrossRef][Medline] [Order article via Infotrieve].
46.
Coull JJ, Romerio F, Sun JM, et al.
The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1.
J Virol.
2000;74:6790-6799
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  N. Siefers, K. K. Dang, R. W. Kumimoto, W. E. Bynum IV, G. Tayrose, and B. F. Holt III Tissue-Specific Expression Patterns of Arabidopsis NF-Y Transcription Factors Suggest Potential for Extensive Combinatorial Complexity Plant Physiology, February 1, 2009; 149(2): 625 - 641. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Kleinschmidt, M. Nassiri, M. S. Stitt, K. Wasserloos, S. C. Watkins, B. R. Pitt, and N. Jahroudi Sequences in Intron 51 of the von Willebrand Factor Gene Target Promoter Activation to a Subset of Lung Endothelial Cells in Transgenic Mice J. Biol. Chem., February 1, 2008; 283(5): 2741 - 2750. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Agarwal, Y. Hao, A. Kapoor, C.-H. Dong, H. Fujii, X. Zheng, and J.-K. Zhu A R2R3 Type MYB Transcription Factor Is Involved in the Cold Regulation of CBF Genes and in Acquired Freezing Tolerance J. Biol. Chem., December 8, 2006; 281(49): 37636 - 37645. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Takahashi, N. Hayashi, S. Kaminogawa, and C. Ra Molecular Mechanisms for Transcriptional Regulation of Human High-Affinity IgE Receptor beta-Chain Gene Induced by GM-CSF J. Immunol., October 1, 2006; 177(7): 4605 - 4611. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. J. F. de Wolf, R. M. J. Cupers, R. M. Bertina, and H. L. Vos The Constitutive Expression of Anticoagulant Protein S Is Regulated through Multiple Binding Sites for Sp1 and Sp3 Transcription Factors in the Protein S Gene Promoter J. Biol. Chem., June 30, 2006; 281(26): 17635 - 17643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Wei, W. K. Miskimins, and R. Miskimins Stage-specific Expression of Myelin Basic Protein in Oligodendrocytes Involves Nkx2.2-mediated Repression That Is Relieved by the Sp1 Transcription Factor J. Biol. Chem., April 22, 2005; 280(16): 16284 - 16294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hough, C. D. Cuthbert, C. Notley, C. Brown, C. Hegadorn, E. Berber, and D. Lillicrap Cell type-specific regulation of von Willebrand factor expression by the E4BP4 transcriptional repressor Blood, February 15, 2005; 105(4): 1531 - 1539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, Y. Peng, Y. Ma, and N. Jahroudi Histone H1-like protein participates in endothelial cell-specific activation of the von Willebrand factor promoter Blood, September 15, 2004; 104(6): 1725 - 1732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Peng and N. Jahroudi The NFY Transcription Factor Inhibits von Willebrand Factor Promoter Activation in Non-endothelial Cells through Recruitment of Histone Deacetylases J. Biol. Chem., February 28, 2003; 278(10): 8385 - 8394. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
HGH were as previously described for the generation of the wild-type HGH-1K
fragment.
