|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
HEMATOPOIESIS
From the Division of Immunology, Netherlands Cancer
Institute, Amsterdam, The Netherlands.
The development of plasmacytoid dendritic cells (pDC2) from human
CD34+ stem cells in vivo was studied in
RAG-2 Immature dendritic cell (DC) subsets have
been identified in peripheral blood, lymphoid organs, and thymus. Among
the immature DCs, interferon (IFN)-producing type 2 DC precursors or
plasmacytoid DCs (referred to here as pDC2) represent a recently
defined cell type that seems to link innate and adaptive immunity.
These cells are present in T-cell areas of the lymph
nodes1 and peripheral blood and have the capacity to
produce high levels of type 1 IFN on confrontation with viruses such as
herpes simplex and influenza virus.2,3 On activation with
IL-3 and CD40L or viruses, pDC2 differentiate into mature DCs capable
of stimulating CD4+ naive T cells to proliferate and
differentiate into T helper 2 (Th2)4 or T cells that
produce high levels of IFN- We and others have identified a cell type similar to pDC2 in the
medulla of the human thymus.7-11 Like the peripheral pDC2, these cells have the capacity to develop into mature DC2, but some
differences were observed in the expression of certain cell surface
antigens.8 Notably, though peripheral pDC2 do not express CD7 and are heterogeneous with respect to the expression of CD2 and
CD5, thymus DC2 express these antigens.8,9,11 Moreover, at
variance with peripheral pDC2, thymus pDC2 respond to granulocyte macrophage-colony-stimulating factor and produce less IFN- In recent studies, the developmental origin of pDC2 was addressed. The
results of these investigations strongly suggest that pDC2 belong to
the lymphoid lineage. Thymus and peripheral pDC2 express high levels of
transcripts for pre-T-cell receptor alpha (pT Anatomic sites of pDC2 development have yet to be determined. The
presence of these cells in the medulla suggests that they can
develop within the thymus. Consistent with this is our observation that
CD34+CD1 Reagents and monoclonal antibodies
Isolation of CD34+ cells from fetal liver and
fetal thymus
CFSE labeling of CD34+ cells CD34+ cells obtained from fetal liver or thymus were labeled with CFSE before injection into the RAG2 /
 c/ mice. Purified cells were transferred to
polypropylene tubes, washed, and resuspended in 1 mL phosphate-buffered
saline (PBS) (Ca and Mg free). CFSE was added, and the cells were
incubated for 10 minutes at 37°C. Thereafter, 1 mL per tube PBS-10%
bovine serum albumin (BSA) was added to bind the remaining CFSE. Cells were washed twice with 10 mL per tube cold PBS-1% BSA and were resuspended in 1 mL medium. Cells were counted, and the concentration was adjusted for injection into the RAG2/
c/ mice. CFSE was used at a final concentration of 5 to 25 µM per 0.05 to 2.5 × 107 cells.19
CFSE is a dye that is easily detectable by flow cytometry and
fluorescence microscopy in combination with other cell surface markers
and is maintained for several weeks, even in dividing cells, and is not
toxic in vitro or in vivo.20
Retrovirus- and lentivirus-mediated gene transfer The retroviral vector LZRS harboring internal ribosomal entry site-enhanced green fluorescence protein (GFP) was described previously.21,22 Helper virus-free recombinant retroviruses (titer 106/mL, as determined by transduction of mouse 3T3 fibroblast cells) were produced after transfection of the retroviral constructs into the 293T-based NX-A amphotropic packaging
cell line and selection on the selectable marker
puromycin.23 Transduction of
CD34+CD38 fetal liver cells was performed as
described previously.22 Briefly, the progenitor cells were
cultured overnight in the presence of 10 ng/mL IL-7 (R&D Systems) and
10 ng/mL SCF (R&D) followed by incubation for 7 to 8 hours or overnight
with virus supernatant in plates coated with fibronectin (30 µg/mL;
Takara Biomedicals, Otsu, Shiga, Japan).
A third-generation, self-inactivating lentiviral vector system was the basis of our lentiviral vector construct and was used as described.24,25 To obtain a fragment from hepatitis B virus (HBV) containing the enhancers I, II, and PRE, a 1237-bp HBV fragment was amplified by polymerase chain reaction with the primers GACGGAAATTGCACCTGTA and CATGGTGCTGGTGCGCAGA. The fragment was cloned as a SacI-SalI fragment containing 1142-bp HBV sequence (HBV subtype AYW accession J02203, bases 682-1818) in the sense orientation after the GFP open-reading frame into the lentiviral vector pRRLpgkgfpsin (PGK).24 GFP expression in the lentiviral vector pRRLpgkgfpsin is driven by a phosphoglycerate kinase promoter. Incorporation of the HIV central poly purine tract (PPT) was
essentially as described.26,27 A 180-bp fragment of the
infectious HIV-1 clone LAI-1 containing the PPT, nucleotides 4302 to
4482 of GenBank accession #NC_001802, was amplified using primers
CAGTATCGATAAGCTTACAAATGGCAGTATTCATCC and
CCTTATCGATTCCAAAGTGGATCTCTGCTGTCC. HIV PPT was cloned as
XhoI/blunt fragment in the sense orientation upstream of the
PGK promoter. Lentivirus was generated by cotransfection of 293T cells
and titrated as described.28 Transduction of
CD34+CD38 Generation of RAG-2 / mice were obtained from
Drs Anton Rolink and Shunichi Takeda (Basel Institute for Immunology,
Switzerland) and were crossed with c/ mice to obtain
H-2d RAG-2/ c/
mice.17,18 These double knockout mice have no functional T and B cells and no natural killer (NK) cells. Mice were bred and maintained in isolators and were fed autoclaved food and water, and all
manipulations were performed under laminar flow. Mice were used when
they were 6 to 10 weeks old.
RAG-2 Immunofluorescence staining and flow cytometry Surface immunophenotyping of thymocytes with directly conjugated antibodies was performed as previously described.29 FACScalibur (BDIS) was used in these experiments, and 10 000 to 1 000 000 events were acquired on each sample. Multiparameter data acquisition and analysis were performed with Cell Quest software (BDIS). The immunophenotype of CFSE+ donor cells was determined by placing an electronic gate on the CFSE+ cells.Histology and immunohistochemical analysis Tissue samples were taken from the thymus transplant. Material was fixed in 10% neutral formol-saline, processed to paraffin sections, and stained with hematoxylin. Triple staining of tissue sections of the thymus transplants was performed as described previously, with some modifications.8 Briefly, cryostat fragments of thymus tissue were cut into 4-µm sections, air-dried overnight, and fixed in acetone for 10 minutes at room temperature. Slides were first incubated with 5% (vol/vol) normal goat serum (Central Laboratory, Blood Transfusion Service of the Red Cross, Amsterdam, The Netherlands), then with optimal dilutions of primary mouse mAb in PBS containing1% (wt/vol) BSA (PBS/BSA)) for 30 minutes at room temperature, followed by incubation with biotinylated goat antimouse IgG (DAKO) and Cy5-conjugated streptavidin (Jackson Immunoresearch Laboratories, Palo Alto, CA). Upon blocking with normal mouse serum, sections were incubated with a second PE-labeled mouse mAb, rabbit anti-PE (Biogenesis, Poole, England), and Cy3-conjugated goat antirabbit IgG (Jackson Immunoresearch Laboratories). For each fluorochrome label, isotype control antibodies were included.Confocal laser scanning microscope analysis Confocal laser scanning microscope (CLSM) images were obtained on a Leica TCS SP (Leica Microsystems, Heidelberg, Germany) confocal system, equipped with an Ar/Kr/HeNe laser combination. Images were taken using a 40 × 1.25 NA objective. Possible cross-talk between CFSE, Cy3, and Cy5 signals, which could give rise to false-positive colocalization of different signals, was avoided by careful selection of the imaging conditions.
Human fetal thymus and fetal liver transplants form a complete
thymus under the skin of Rag2 / c/ mice
were used rather than NOD/SCID mice. These mice also lack NK cells, as
do the NOD/SCID mice,31 but, more important, they do not
develop the thymomas present in most NOD/SCID mice beyond 5 months of
age,31 a complication that interferes with long-lasting experiments. Human fetal thymus and liver fragments were grafted subcutaneously. Most of the transplanted mice developed a
well-differentiated thymus that was already clearly palpable 8 weeks
after transplantation and that continued to grow for, on average, 4 additional months. The thymus transplant was still clearly detectable
in most mice 12 weeks to 1 year after transplantation. Histologic
staining of sections of thymus of these mice revealed a histology
similar to that of normal thymus, including cortex, medulla, and Hassal corpuscles (Figure 1). Human thymus
transplants have normal proportions of all T-cell subsets and also
contain pDC2 along with mature CD83+ DCs in the medulla and
at the corticomedullary junction (data not shown), exactly as has been
observed in a postnatal thymus.8
CFSE-labeled CD34+ fetal liver cells and fetal
thymocytes develop into pDC2 in the human thymus grafted in
Rag2 / c/ mice may mean that these
cells developed from precursor cells within the thymus because they did
not show the development of hematopoietic cells outside the thymus.
Alternatively, these pDC2 could already have been present in the fetal
liver or thymus fragments at the time of transplantation and might not
have been derived from CD34+ cells developing in the
thymus. To distinguish between these possibilities, CD34+
cells were MACS purified or FACS sorted from the human fetal liver
(99% pure), labeled with CFSE, and injected into the human thymus
implant of the Rag2/ c/ mice. Six
weeks after injection, the thymus implant was removed for analysis.
Flow cytometric (Figure 2) and CLSM
(Figure 3) analyses revealed the presence
of CFSE+ thymocytes (CD4+CD8+
cells) and CFSE+CD123+/high, cells indicating
that CD34+CD38 fetal liver cells developed
into T cells and pDC2. As expected, the
CFSE+CD4+CD8+ cells expressed CD1a
and varying levels of CD3 (data not shown), confirming that these cells
represented immature T cells. Note that the percentages of
CD123+/highCD45RA+ cells in the
CFSE-positive gate were much higher than in the CFSE-negative gate
(Tables 1,2). This is presumably because differentiation of the
precursor cells to pDC2 does not involve many cell divisions.
Development of CD34+ into T cells is accompanied by
multiple rounds of cell division, leading to a loss of the CFSE label.
CFSE+CD123+/high cells (which were also
CD45RA+; not shown) are located mainly in the medulla and
at the corticomedullary junction (Figure 3), where they are also found
in the normal postnatal thymus.8 Thus, thymus precursors
have the capacity to develop into pDC2 in a thymus microenvironment in
vivo. To provide support for the notion that CD34+
precursors migrate to the thymus, where they develop not only to T
cells but also to pDC2, we injected CFSE-labeled CD34+
fetal liver cells intravenously into Rag2/
c/ mice that carried a thymus graft.
CFSE+CD123+/highCD45+ and
CFSE+CD4+CD8+ cells (Tables
1, 2) could
be detected in the thymus transplant of these animals by flow
cytometric analysis, indicating that CD34+ cells migrated
to the human transplant after intravenous injection. Time-course
experiments were conducted to determine immunophenotypic changes
after intrathymic and intravenous injections of CFSE-labeled, MACS-purified CD34+ fetal liver cells. This was done
by sequential analyses of biopsy specimens taken from the
thymus graft. These experiments showed that
CFSE+CD123+/highCD45RA+ cells could
be detected as early as 1 week after intrathymic injection (data not
shown). Of significance, CFSE-labeled CD34+ thymocytes
injected intravenously or intrathymically developed into pDC2 (Table
3). These data confirmed the results of
our in vitro experiments, which demonstrated that
CD34+CD1a postnatal thymocytes have the
capacity to develop into pDC2 on coculture with the mouse stromal cell
line S17.12
CFSE-labeled CD34+ fetal liver cells develop into
different types of DCs on injection in the thymus transplant of
Rag2 cells developed into immature
CD123+/highCD11c and more mature
CD123+/highCD11c+ DCs. Thus, these data
may suggest that the full maturation of CD123+/high
lymphoid-derived pDC2 can occur in the thymus after intrathymic injection of CD34+ FL cells. CD83+ cells
expressing the myeloid marker CD13 were also found, suggesting that
these CD83+ cells are DCs of myeloid origin (data not
shown). Together these data indicate that different populations of DCs
develop from CD34+ precursors injected into the thymus.
Whether CFSE-labeled mature DC populations represent the full spectrum
of DCs that can develop from intrathymic precursors is not determined
because some DCs might have undergone multiple cell divisions,
resulting in loss of the CFSE label. Experiments analyzing DC
subpopulations developed from genetically labeled CD34+
cells should solve this.
pDC2 and B cells develop in Rag2 /
c/ mice with transplanted thymi, we consistently
failed to detect any CD123+/high pDC2 in the peripheral
blood, lung, spleen, or bone marrow, even at time points up to 5 months
after transplantation of liver and thymus (results not shown). One
small explanation for these observations is that the pDC2 do not
survive in the periphery of these mice. To investigate this we injected
purified CD34+CD38 fetal liver cells
intravenously in mice without a human thymus transplant. Peripheral
blood, spleen, liver, and bone marrow of these mice were analyzed after
16 weeks for the presence of pDC2 and other human cells. Abundant
CD45+ human leukocytes could be found in these mice (Figure
5), consistent with earlier observations
in NOD/SCID mice.32,33 In addition to finding a majority
of B cells (Figure 5), we found significant numbers of
CD123+/highCD4+ pDC2 (Figure 5) in the
periphery of these mice. Although not shown, pDC2 purified from the
liver of the injected mice produced IFN- on infection with
UV-inactivated herpes simplex virus, similar to the action of pDC2 in
healthy mice.2 These cells co-expressed CD45RA and the
pDC2 marker BDCA2 (results not shown), confirming their pDC2
identity.34 Relatively high numbers of pDC2 were found in
the liver and in the bone marrow (Figure 5). These data strongly
suggest that B and pDC2 cells developed from the CD34+ SCID
repopulating cell (SRC) defined by La Rochelle et al.35 To
confirm this we made use of the documented fact that the SRC is a
resting cell that can be efficiently transduced with a lentiviral but
not a retroviral vector.35,36 Therefore, we examined
whether CD34+CD38 fetal liver cells
transduced with a lentiviral (HIV) vector or a retroviral vector
harboring GFP develop into pDC2 and B cells. CD34+CD38 cells were isolated by FACS sorting
and were cultured overnight either with medium or with the cytokines
SCF and IL-7. CD34+ cells cultured in medium were
transduced with GFP in the HIV vector, and the cells cultured in
cytokines were transduced with GFP in the LZRS vector and then injected
intravenously into RAG2/ c/ mice.
Part of the transduced cells was cultured further with cytokines and
inspected for GFP expression 4 days later. This analysis demonstrated
that 75% of the HIV-GFP-transduced cells and 40% of the
GFP-LZRS-transduced cells expressed GFP (results not shown). Figure
6 shows the analysis of the pDC2 and B
cells in the liver of the mice injected with HIV-GFP-transduced cells. Sixty-five percent of the cells expressing human CD45 were GFP positive. Percentages of pDC2 and B cells in the GFP-positive and
-negative gate were similar. The same percentages of pDC2 and B cells
were found in the RAG2/ c/ mice
injected with LZRS-GFP transduced CD34+
cells, but these cells did not express any GFP (results not shown), consistent with the findings of Dick et al.36 These
results confirm that B and pDC2 cells develop from CD34+
SRC in the periphery of the injected RAG2/
c/ mice. More important, the data indicate that the
absence of pDC2 in the periphery of RAG2/
c/ mice with a thymus graft did not result from an
inability of these cells to survive in the periphery. To exclude that
the thymus graft somehow interferes with the survival of pDC2 in the
periphery, we injected CD34+ FL cells in mice with an
already established graft. Figure 7 demonstrates that these mice not only have T cells but that they have
pDC2 and B cells in peripheral blood and various organs.
Distinct DC subsets of different immunophenotypes, such as
immature and mature DCs and plasmacytoid DCs or pDC2, are present in
the human thymus.8,10,11 Thymus pDC2 are similar to pDC2 found in lymph nodes and peripheral blood. CD123+/high pDC2
are of lymphoid origin and can develop in vitro from
CD34+CD1 The observation that CD34+ cells develop in the thymus into
pDC2 raised the question whether the thymus is a primary organ for
development of these cells as it is for T cells. This seems unlikely. A
thymus graft contains between 0.5 and 2 × 106 pDC2;
however, virtually no pDC2 could be detected in these mice outside the
thymus graft at any time point in RAG2 Recently it was shown that the human thymus contains different
subsets of immature and mature DCs. Vandenabeele10
demonstrated the presence of CD11b+ and CD11b Here we have shown the usefulness of the RAG2
We thank the staff at the Bloemenhove Kliniek (Heemstede, The Netherlands) for providing fetal tissues, E. Noteboom and Anita Pfauth for their help with cell sorting, and M. de Boer, J. Schmitz, and J. Kirberg for their gifts of antibodies and mice.
Submitted September 4, 2001; accepted November 27, 2001.
Supported by grants HD29341 and HD37597 from the National Institutes of Health (C.H.U.).
K.W. and C.H.U. contributed equally to this work.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Hergen Spits, Division of Immunology, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, Netherlands; e-mail: hspits{at}nki.nl.
1.
Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, Liu YJ.
The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand.
J Exp Med.
1997;185:1101-1111
2.
Siegal FP, Kadowaki N, Shodell M, et al.
The nature of the principal type 1 interferon-producing cells in human blood.
Science.
1999;284:1835-1837 3. Cella M, Jarrossay D, Facchetti F, et al. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med. 1999;5:919-923[CrossRef][Medline] [Order article via Infotrieve].
4.
Rissoan MC, Soumelis V, Kadowaki N, et al.
Reciprocal control of T helper cell and dendritic cell differentiation.
Science.
1999;283:1183-1186
5.
Kadowaki N, Antonenko S, Lau JY, Liu YJ.
Natural interferon alpha/beta-producing cells link innate and adaptive immunity.
J Exp Med.
2000;192:219-226 6. Cella M, Facchetti F, Lanzavecchia A, Colonna M. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol. 2000;1:305-310[CrossRef][Medline] [Order article via Infotrieve].
7.
Olweus J, BitMansour A, Warnke R, et al.
Dendritic cell ontogeny: a human dendritic cell lineage of myeloid origin.
Proc Natl Acad Sci U S A.
1997;94:12551-12556
8.
Res PC, Couwenberg F, Vyth-Dreese FA, Spits H.
Expression of pT
9.
Schmitt C, Fohrer H, Beaudet S, et al.
Identification of mature and immature human thymic dendritic cells that differentially express HLA-DR and interleukin-3 receptor in vivo.
J Leukoc Biol.
2000;68:836-844
10.
Vandenabeele S, Hochrein H, Mavaddat N, Winkel K, Shortman K.
Human thymus contains 2 distinct dendritic cell populations.
Blood.
2001;97:1733-1741
11.
Bendriss-Vermare N, Barthelemy C, Durand I, et al.
Human thymus contains IFN-
12.
Spits H, Couwenberg F, Bakker AQ, Weijer K, Uittenbogaart CH.
Id2 and Id3 inhibit development of CD34(+) stem cells into pre-dendritic cell (pre-DC)2 but not into pre-DC1: evidence for a lymphoid origin of pre-DC2.
J Exp Med.
2000;192:1775-1784
13.
Heemskerk MH, Blom B, Nolan G, et al.
Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3.
J Exp Med.
1997;186:1597-1602
14.
Jaleco AC, Stegmann AP, Heemskerk MH, et al.
Genetic modification of human B-cell development: B-cell development is inhibited by the dominant negative helix loop helix factor Id3.
Blood.
1999;94:2637-2646 15. Blom B, Heemskerk MH, Verschuren MC, et al. Disruption of alpha beta but not of gamma delta T cell development by overexpression of the helix-loop-helix protein Id3 in committed T cell progenitors. EMBO J. 1999;18:2793-2802[CrossRef][Medline] [Order article via Infotrieve].
16.
Blom B, Ho S, Antonenko S, Liu YJ.
Generation of interferon alpha-producing predendritic cell (pre-DC)2 from human CD34(+) hematopoietic stem cells.
J Exp Med.
2000;192:1785-1796 17. Blom B, Spits H, Krimpenfort P. The role of the common gamma chain of the IL-2, IL-4, IL-7 and IL-15 receptors in development of lymphocytes: constitutive expression of Bcl-2 does not rescue the developmental defects in gamma common-deficient mice. In: Smit Sibinga CT,Das PC,Löwenberg B, eds. Cytokines and Growth Factors in Blood Transfusion. London, UK: Kluwer Academic; 1997:3-12.
18.
Kirberg J, Berns A, von Boehmer H.
Peripheral T cell survival requires continual ligation of the T cell receptor to major histocompatibility complex-encoded molecules.
J Exp Med.
1997;186:1269-1275 19. Weston SA, Parish CR. New fluorescent dyes for lymphocyte migration studies: analysis by flow cytometry and fluorescence microscopy. J Immunol Methods. 1990;133:87-97[CrossRef][Medline] [Order article via Infotrieve]. 20. Lyons AB. Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J Immunol Methods. 2000;243:147-154[CrossRef][Medline] [Order article via Infotrieve]. 21. Heemskerk MHM, Blom B, Nolan G, et al. Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3. J Exp Med. 1997;186:1597-1602. 22. Jaleco AC, Stegmann AP, Heemskerk MH, et al. Genetic modification of human B-cell development: B-cell development is inhibited by the dominant negative helix loop helix factor Id3. Blood. 1999;94:2637-2646. 23. Kinsella TM, Nolan GP. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther. 1996;7:1405-1413[Medline] [Order article via Infotrieve].
24.
Zufferey R, Dull T, Mandel FJ, et al.
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery.
J Virol.
1998;72:9873-9880
25.
Dull T, Zufferey R, Kelly M, et al.
A third-generation lentivirus vector with a conditional packaging system.
J Virol.
1998;72:8463-8471 26. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell. 2000;101:173-185[CrossRef][Medline] [Order article via Infotrieve]. 27. Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini L. Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet. 2000;25:217-222[CrossRef][Medline] [Order article via Infotrieve].
28.
Seppen J, Barry SC, Klinkspoor JH, et al.
Apical gene transfer into quiescent human and canine polarized intestinal epithelial cells by lentivirus vectors.
J Virol.
2000;74:7642-7645
29.
Res P, Martínez Cáceres E, Jaleco AC, Noteboom E, Weijer K, Spits H.
CD34+CD38dim cells in the human thymus can differentiate into T, natural killer and dendritic cells but are distinct from stem cells.
Blood.
1996;87:5196-5206
30.
McCune JM, Namikawa R, Kaneshima H, Shultz LD, Lieberman M, Weissman IL.
The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function.
Science.
1988;241:1632-1639 31. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-scid mice. J Immunol. 1995;154:180-191[Abstract]. 32. Dick JE, Bhatia M, Gan O, Kapp U, Wang JC. Assay of human stem cells by repopulation of NOD/SCID mice. Stem Cells. 1997;1:199-203. 33. Bhatia M, Bonnet D, Murdoch B, Gan OI, Dick JE. A newly discovered class of human hematopoietic cells with SCID-repopulating activity. Nat Med. 1998;4:1038-1045[CrossRef][Medline] [Order article via Infotrieve].
34.
Dzionek A, Fuchs A, Schmidt P, et al.
BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood.
J Immunol.
2000;165:6037-6046 35. Larochelle A, Vormoor J, Hanenberg H, et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nat Med. 1996;2:1329-1337[CrossRef][Medline] [Order article via Infotrieve].
36.
Guenechea G, Gan OI, Inamitsu T, et al.
Transduction of human CD34+ CD38 37. Ardavin C, Wu L, Li CL, Shortman K. Thymic dendritic cells and T cells develop simultaneously in the thymus from a common precursor population. Nature. 1993;362:761-763[CrossRef][Medline] [Order article via Infotrieve]. 38. Wu L, Vremec D, Ardavin C, et al. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur J Immunol. 1995;25:418-425[Medline] [Order article via Infotrieve].
39.
Mazurier F, Fontanellas A, Salesse S, et al.
A novel immunodeficient mouse model
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  M. M. Collazo, D. Wood, K. H. T. Paraiso, E. Lund, R. W. Engelman, C.-T. Le, D. Stauch, K. Kotsch, and W. G. Kerr SHIP limits immunoregulatory capacity in the T-cell compartment Blood, March 26, 2009; 113(13): 2934 - 2944. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, J. Park, D. Foss, and I. Goldschneider Thymus-homing peripheral dendritic cells constitute two of the three major subsets of dendritic cells in the steady-state thymus J. Exp. Med., March 16, 2009; 206(3): 607 - 622. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. A. Scheeren, M. Nagasawa, K. Weijer, T. Cupedo, J. Kirberg, N. Legrand, and H. Spits T cell-independent development and induction of somatic hypermutation in human IgM+IgD+CD27+ B cells J. Exp. Med., September 1, 2008; 205(9): 2033 - 2042. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Rozemuller, E. van der Spek, L. H. Bogers-Boer, M. C. Zwart, V. Verweij, M. Emmelot, R. W. Groen, R. Spaapen, A. C. Bloem, H. M. Lokhorst, et al. A bioluminescence imaging based in vivo model for preclinical testing of novel cellular immunotherapy strategies to improve the graft-versus-myeloma effect Haematologica, July 1, 2008; 93(7): 1049 - 1057. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. de Andres, I. Cortegano, N. Serrano, B. del Rio, P. Martin, P. Gonzalo, M. A. R. Marcos, and M. L. Gaspar A Population of CD19highCD45R /lowCD21low B Lymphocytes Poised for Spontaneous Secretion of IgG and IgA Antibodies J. Immunol., October 15, 2007; 179(8): 5326 - 5334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Schmidlin, W. Dontje, F. Groot, S. J. Ligthart, A. D. Colantonio, M. E. Oud, E. J. Schilder-Tol, M. Spaargaren, H. Spits, C. H. Uittenbogaart, et al. Stimulated plasmacytoid dendritic cells impair human T-cell development Blood, December 1, 2006; 108(12): 3792 - 3800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Legrand, T. Cupedo, A. U. van Lent, M. J. Ebeli, K. Weijer, T. Hanke, and H. Spits Transient accumulation of human mature thymocytes and regulatory T cells with CD28 superagonist in "human immune system" Rag2-/-{gamma}c-/- mice Blood, July 1, 2006; 108(1): 238 - 245. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Santoni de Sio, P. Cascio, A. Zingale, M. Gasparini, and L. Naldini Proteasome activity restricts lentiviral gene transfer into hematopoietic stem cells and is down-regulated by cytokines that enhance transduction Blood, June 1, 2006; 107(11): 4257 - 4265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Dontje, R. Schotte, T. Cupedo, M. Nagasawa, F. Scheeren, R. Gimeno, H. Spits, and B. Blom Delta-like1-induced Notch1 signaling regulates the human plasmacytoid dendritic cell versus T-cell lineage decision through control of GATA-3 and Spi-B Blood, March 15, 2006; 107(6): 2446 - 2452. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Legrand, K. Weijer, and H. Spits Experimental Models to Study Development and Function of the Human Immune System In Vivo J. Immunol., February 15, 2006; 176(4): 2053 - 2058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. B. Gurney, A. D. Colantonio, B. Blom, H. Spits, and C. H. Uittenbogaart Endogenous IFN-{alpha} Production by Plasmacytoid Dendritic Cells Exerts an Antiviral Effect on Thymic HIV-1 Infection J. Immunol., December 15, 2004; 173(12): 7269 - 7276. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Gimeno, K. Weijer, A. Voordouw, C. H. Uittenbogaart, N. Legrand, N. L. Alves, E. Wijnands, B. Blom, and H. Spits Monitoring the effect of gene silencing by RNA interference in human CD34+ cells injected into newborn RAG2-/- {gamma}c-/- mice: functional inactivation of p53 in developing T cells Blood, December 15, 2004; 104(13): 3886 - 3893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schotte, M. Nagasawa, K. Weijer, H. Spits, and B. Blom The ETS Transcription Factor Spi-B Is Required for Human Plasmacytoid Dendritic Cell Development J. Exp. Med., December 6, 2004; 200(11): 1503 - 1509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Brilot, V. Geenen, D. Hober, and C. A. Stoddart Coxsackievirus B4 Infection of Human Fetal Thymus Cells J. Virol., September 15, 2004; 78(18): 9854 - 9861. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. C. V. Verra, A. Jorritsma, K. Weijer, J. J. Ruizendaal, A. Voordouw, P. Weder, E. Hooijberg, T. N. M. Schumacher, J. B. A. G. Haanen, H. Spits, et al. Human Telomerase Reverse Transcriptase-Transduced Human Cytotoxic T Cells Suppress the Growth of Human Melanoma in Immunodeficient Mice Cancer Res., March 15, 2004; 64(6): 2153 - 2161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Palucka, J. Gatlin, J. P. Blanck, M. W. Melkus, S. Clayton, H. Ueno, E. T. Kraus, P. Cravens, L. Bennett, A. Padgett-Thomas, et al. Human dendritic cell subsets in NOD/SCID mice engrafted with CD34+ hematopoietic progenitors Blood, November 1, 2003; 102(9): 3302 - 3310. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. van Rijn, E. R. Simonetti, A. Hagenbeek, M. C. H. Hogenes, R. A. de Weger, M. R. Canninga-van Dijk, K. Weijer, H. Spits, G. Storm, L. van Bloois, et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- {gamma}c-/- double-mutant mice Blood, October 1, 2003; 102(7): 2522 - 2531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schotte, M.-C. Rissoan, N. Bendriss-Vermare, J.-M. Bridon, T. Duhen, K. Weijer, F. Briere, and H. Spits The transcription factor Spi-B is expressed in plasmacytoid DC precursors and inhibits T-, B-, and NK-cell development Blood, February 1, 2003; 101(3): 1015 - 1023. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
5,
), myeloid CD11c(+), and mature interdigitating dendritic cells.
J Clin Invest.
2001;107:835-844
RAG2 x common cytokine receptor gamma chain double mutants