| |
|
|
|
|
|
|
|||
|
HEMATOPOIESIS
From the Departments of Medicine and Cellular and
Molecular Medicine, Glycobiology Research and Training Center,
University of California San Diego, La Jolla (K.G. and L.D.P.); and the
Department of Medicine, UCLA-Olive View Medical Center, Sylmar, CA
(L.D.P.).
CD33 (Siglec-3) is a marker of myeloid progenitor cells, mature
myeloid cells, and most myeloid leukemias. Although its biologic role
remains unknown, it has been demonstrated to function as a sialic
acid-specific lectin and a cell adhesion molecule. Many of the Siglecs
(including CD33) have been reported to be tyrosine phosphorylated in
the cytosolic tails under specific stimulation conditions. Here we
report that CD33 is also a serine/threonine phosphoprotein, containing
at least 2 sites of serine phosphorylation in its cytoplasmic domain,
catalyzed by protein kinase C (PKC). Phosphorylation could be augmented
by exposure to the protein kinase-activating cytokines interleukin 3, erythropoietin, or granulocyte-macrophage colony-stimulating factor, in
a cytokine-dependent cell line, TF-1. The CD33 cytoplasmic tail was
phosphorylated by PKC in vitro, in a Ca++/lipid-dependent
manner. CHOK1 cells stably expressing CD33 with cytoplasmic tails of
various length also showed phorbol myristate acetate
(PMA)-dependent phosphorylation of CD33. Inhibition of CD33
phosphorylation with pharmacologic agents resulted in an increase of
sialic acid-dependent rosette formation. Furthermore, the occupancy of
the lectin site affected its basal level of phosphorylation. Rosette
formation by COS cells expressing a form of CD33 lacking its
cytoplasmic domain was not affected by these same agents. These data
indicate that CD33 is a phosphoprotein, that its phosphorylation may be
controlled by PKC downstream of cytokine stimulation, and that its
phosphorylation is cross-regulated with its lectin activity. Notably,
although this is the first example of serine/threonine phosphorylation
in the subfamily of CD33-like Siglecs, some of the other members also
have putative target sites in their cytoplasmic tails.
(Blood. 2002;99:3188-3196) CD33 is a 67-kd glycoprotein found predominantly on
myeloid cells, including early myeloid precursors in the bone marrow
and certain subsets of mature circulating myeloid
cells.1-3 It has also been reported on dendritic cells,
cord blood-derived natural killer (NK) cells, in vitro-expanded T
cells, and some biphenotypic leukemias.4-7 Although
initially described as a marker for normal and leukemic myeloid
progenitor cells, it has received renewed interest due to its
demonstrated lectin activity for A combination of in vitro and in vivo studies has indicated that some
Siglecs have roles in cell activation and development. The
Siglec-3-related Siglec family, CD22, and MAG are clustered together
on chromosome 19q (in humans) or chromosome 7 (in mice), suggesting a
common ancestral origin.30-32 However, it is possible that
some of the gene duplications in the Siglec-3 family occurred after
separation of the ancestors of primates and rodents.26 CD22, expressed on B cells, becomes tyrosine phosphorylated in response
to IgR signaling, which results in the recruitment of several protein
tyrosine kinases and protein tyrosine phosphatase 1C.33-36
Mice with null alleles of CD22 demonstrate B-cell hyperresponsiveness and some abnormalities in immunoglobulin production.37,38
MAG has a 90-amino acid cytoplasmic domain, which is the target of both protein tyrosine kinases and serine/threonine kinases including protein kinase C (PKC).39-41 Cells expressing MAG
(including Chinese hamster ovary [CHO] cells transfected to express
MAG) down-regulate neurite outgrowth and, conversely, exhibit inhibited
growth on neurites.42 MAG null mice exhibit
microscopically detectable abnormalities in myelin sheath structure and
neurologic abnormalities in adulthood.43,44 Sialoadhesin
differs in chromosomal location and in lacking a cytoplasmic
domain.17,45 However, sialoadhesin has been clearly
demonstrated to function as an adhesion molecule in
vivo.46
The cytosolic tail of CD33 has 2 tyrosine-based putative signaling
motifs, the membrane-proximal one conforming to a canonical ITIM motif.
Indeed, tyrosine phosphorylation of CD33 has been identified using
phosphotyrosine antisera together with the pharmacologic manipulation
of cellular phosphorylation with sodium pervanadate.47-49 An association between CD33 phosphorylation, CD33 cross-linking, and
calcium flux was also demonstrated, along with the recruitment of the
protein tyrosine phosphatases SHP-1 and SHP-2, as well as an increased
rosetting ability of a CD33 with a mutated Tyr340.47 Here
we report serine/threonine phosphorylation of CD33 in several different
cell lines, including a cytokine-dependent myelocyte cell line (TF-1),
several cytokine-independent cell lines (HL-60, U937), and in COS cells
transiently or CHO cells stably transfected to express CD33 with a
CD33-encoding plasmid. These results indicate that CD33 is a
serine/threonine phosphoprotein and a connection between this
modification and its lectin activity, thereby possibly modifying the
potential function on hematopoietic cells.
Cell lines and reagents
Cell labeling and immunopurification of CD33
Cells were labeled with [32P]-orthophosphate by washing
twice in warmed phosphate-free The TF-1 cells were labeled with [32P]orthophosphate for 60 minutes as above after cytokine deprivation for 15 hours. Following labeling, cytokine was added, the cells incubated for an additional 10 minutes at 37°C, chilled, and CD33 immunopurified.52 DNA constructs and cell transfection The complementary DNA (cDNA) coding for CD33 (gift of Dr B. Seed, Harvard University, Cambridge, MA) was in the eukaryotic expression vector H3M.13 The truncated CD33 construct
pCD33T299 was created by polymerase chain
reaction (PCR; forward primer 5' cccaagcttctagagatcc 3'; reverse primer
5' cgggtctctgcagtcaggtgtcattgctgcc 3'), trimmed with
HindIII and PstI, and ligated into H3M.
Transfections in COS cells were performed using Lipofectamine (Gibco
BRL, La Jolla, CA).
CD33 cytoplasmic regions of various lengths were produced using the
following primers on the CD33 parent cDNA (pcDNA3.1-CD33): sense:
cccaaaatcctcatccctggc, antisense: Glutathione-S-transferase tail fusion protein production The cytoplasmic tail of CD33 (residues His285-Gln364) was produced by PCR (forward primer 5'gctggaattcaccggcggaaagcagcccggacagc3'; reverse primer 5'cgagagctcgacccaggactggagactcataagc3') sequenced and ligated into pGEX (Pharmacia, Peapack, NJ) using EcoRI and XhoI. PGEXhCD33cyto/mock transfected Escherichia coli was grown and glutathione-S-transferase (GST) fusion protein prepared as described by the manufacturer.PKC activity assay In vitro PKC activity on the CD33 cytoplasmic tail was determined in 20 mM Hepes, pH 7.4, 1 mM dithiothreitol (DTT), 5 mM MgCl2, 0.1 mM adenosine triphosphate (ATP), 1 µCi (0.037 MBq) 32P-ATP, 3 µg protein substrate in 55 µL Hepes. Then, 140 µM/3.8 µM phosphatidylserine/diacylglycerol
membranes and 0.5 mM CaCl2 were added to produce
PKC-activating conditions; equal volumes of Hepes and 0.5 mM EGTA were
added for inactivating conditions. Human purified PKC was added in a
5-µL volume, and the reaction allowed to proceed for 10 minutes at
30°C. The reaction was stopped by acetone precipitation. The sample
was analyzed by reducing SDS-PAGE. The gel was Coomassie stained,
dried, and then photographed as well as autoradiographed.
Erythrocyte rosetting assay COS cells, transfected to express CD33 as above, were lifted 24 hours after transfection, replated into 24-well cluster plates (precoated with poly-D-lysine), and allowed to expand for 48 hours. Cells were washed with serum-free MEM, pH 6.9, 4 mM
CaCl2, and then digested with 0.1 U/mL sialidase for 60 minutes at 37°C. Thereafter, the cells were washed gently in PBS, 4 mM EDTA, and twice in PBS, 5 mg/mL bovine serum albumin (PBA). Human
erythrocytes were washed 4 times in 10 mM
3-[N-Morpholino]propanesulfonic acid (MOPS), pH 7.0, 0.14 M
NaCl, 5 mM EDTA, and once in PBA. RBCs were desialylated by treatment
of a 30% vol/vol suspension in 10 mM MOPS, pH 6.7, 0.15 M NaCl, 4 mM
CaCl2 with 0.1 U/mL Vibrio cholerae sialidase
for 3 hours at 37°C. RBCs were added to yield a final concentration
of 0.2% vol/vol. The trays were incubated for 30 minutes at 4°C,
washed 4 to 6 times using PBA, and then rosettes fixed for 10 minutes
using PBS/4% formaldehyde, stained by incubation for 10 minutes using
2-amino-9-ethylcarbazole (AEC), and then returned to PBS/formaldehyde.
Rosettes were defined as COS cells containing 4 or more bound RBCs. For
antibody-blocking studies, My9 was added at 10 µg/mL during the
sialidase treatment step. For treatment of
[32P]-orthophosphate-labeled cells with kinase or
phosphatase inhibitors, transfected cells were initially treated with
sialidase, then labeled with [32P]-orthophosphate as
above. Okadaic acid, bisindolylmaleimide (BIM), or staurosporine was
included during the 60 minutes of [32P]-orthophosphate
phosphate labeling, with PMA added during the final 12 minutes of
labeling, where indicated. If the cells were to be used for rosetting,
they were first treated with sialidase, then labeled with
[32P]-orthophosphate, then rinsed with PBA and RBCs
added. Rosettes were allowed to form at 37°C.8
CD33 is a serine/threonine phosphoprotein Examination of the amino acid sequence of the cytoplasmic domain of CD33 predicted that CD33 may be a phosphoprotein. Specifically, 11 serine, 11 threonine residues, and 2 tyrosine residues are present, along with potential consensus sequences for both serine/threonine and tyrosine (ITIMs) kinases.13,58,59 This prediction was tested directly by examining immunoprecipitated CD33 from U937 cells metabolically labeled with [32P]-orthophosphate. This approach identified a cell-surface glycoprotein with a total mass of about 75 kd, which, after desialylation, shifted to about 49 kd (data not shown). By this approach, CD33 was immunoprecipitated from 2 human myeloid cell lines (HL-60 and U937) that had been metabolically labeled for 60 minutes with [32P]-orthophosphate. A single peptide of about 75 kd was identified, indicating that CD33 is a phosphoprotein. In both cell types, a 12-minute treatment with PMA resulted in an approximately 3- to 8-fold increase in [32P]-orthophosphate incorporation. DMSO stimulated phosphorylation 2- to 4-fold in HL-60 cells (Figure 1).
Phosphoamino analyses were performed on [32P]-labeled
CD33 immunopurified from resting, PMA-stimulated, or DMSO-stimulated
cells.51 These results demonstrated exclusively
phosphoserine in all cases, with trace amounts of phosphothreonine in
PMA-stimulated HL-60 cells (Figure 2). In
no cases could phosphotyrosine be detected in HL-60 or U937 cells, even
after extended exposure. Thus, CD33 may be phosphorylated directly by
PKC or by a serine/threonine kinase that is activated downstream
following PKC activation.
Serine/threonine kinases catalyze CD33 phosphorylation The effects of stimulators of protein kinase A, as well as different inhibitors of serine/threonine kinases, were further examined to more precisely define the roles of different kinases in CD33 phosphorylation. U937 cells were labeled with [32P]-orthophosphate, and stimulated with dibutryl cAMP, PMA, or PMA in the presence of either one of 2 inhibitors of serine/threonine-specific kinases, staurosporine and BIM. Dibutryl cAMP does not lead to enhanced phosphorylation, compared to untreated cells (Figure 3A). The enhanced phosphorylation by PMA can be totally blocked by either protein kinase inhibitor (Figure 3A). Moreover, staurosporine, but not BIM, is capable of reducing the resting level of CD33 phosphorylation by approximately 80%. Dose-response curves for inhibition demonstrated approximately 50% inhibition could be achieved with either straurosporine or BIM at 10 nM and 5 nM, respectively.60 The phosphorylation of CD33 in transiently transfected COS cells was also stimulated by PMA (4-fold increase) but not by dibutryl cAMP (Figure 3B). The same pattern of stimulation and inhibition seen in HL-60 and U937 cells was also observed in CD33-COS cells (data not shown). Phosphoamino acid analyses demonstrated the exclusive presence of phosphoserine (data not shown). Thus, in both myeloid cells that naturally express CD33, and in a transfected nonmyeloid cell line, CD33 is phosphorylated as a downstream event following PKC stimulation.
CD33 is phosphorylated on 2 serine residues Phosphopeptide maps were analyzed to establish the number of potential phosphorylation sites. The examination of CD33 immunopurified from either CD33 transfected COS cells or U937 cells (both PMA stimulated) by 2-dimensional thin-layer chromatography identified 2 phosphopeptides in each sample with similar mobilities (Figure 4A,B). These results indicate the same serine residues are likely phosphorylated in human myeloid (U937) and primate uroendothelial (COS) cells.
CD33 phosphorylation by PKC in vitro Protein kinase C-dependent phosphorylation of CD33 could be demonstrated in vitro, using a purified, E coli-expressed GST-CD33 cytoplasmic tail fusion protein and purified human PKC, clearly showing that CD33 is a potential PKC target (Figure 5). Addition of lipids and Ca++ as PKC activators led to an increased phosphorylation level, whereas reduction of phosphorylation by the calcium chelator EGTA confirms the PKC mediation of labeling. GST alone was not phosphorylated under these conditions.
S307 is the putative site for phosphorylation on CD33 CD33 constructs with various tail lengths were stably expressed in CHOK1 cells to determine peptides susceptible to PKC-mediated phosphorylation. The expression level of constructs of various lengths (CD33- B, at Val294 (no cytoplasmic tail); CD33- C, at
Pro319; CD33- D, at Val332; CD33- E, at Pro350; and
CD33- F, full-length CD33) were confirmed by FACS analysis
(Figure 6A). Clones were PMA activated or
mock activated (Figure 6B), showing the presence of a PMA-dependent
phosphorylation site in construct C between Val294 and
Pro319. The Ser307 protein kinase motif residing in
construct C was predicted as the only strong PKC phosphorylation
site by PROSITE (http://www.expasy.ch/prosite). Longer
constructs ( D- F) showed a comparable increase in
phosphorylation after PMA activation (average increase of 4 tests:
B, no increase; C, × 1.35; D, × 1.70; E,
× 1.45; F, × 1.35).
CD33 phosphorylation also occurs in a myeloid cell line The above experiments were all performed with nonhematopoietic cells or hematopoietic cell lines that may overexpress serine/threonine kinases.61 Therefore, we examined CD33 phosphorylation in TF-1 cells, a human myeloid cell line that requires either EPO, IL-3, or GM-CSF for growth in culture.50,62 CD33 was phosphorylated in these cells, and the level of phosphorylation could be increased by exposure to any of the 3 cytokines (data not shown). The effect of GM-CSF was only a modest increase of approximately 25%, whereas exposure to EPO increased phosphorylation by 2.6-fold and IL-3 by 2-fold. Thus, CD33 phosphorylation also occurs in a human myeloid cell line that has retained the requirement of cytokine stimulation for long-term growth in vitro.Decreased phosphorylation results in increased erythrocyte rosetting CD33 has been identified as a sialic acid-specific lectin, a member of the family of Siglecs.10,11,12 No rosetting activity of CD33-transfected COS cells was detected toward asialo RBCs or toward native (sialylated) RBCs if CD33 was initially blocked with My9 (data not shown), confirming that CD33 has a lectin activity for sialylated glycoconjugates.8 To determine if CD33 phosphorylation may affect lectin activity, the rosetting assay was performed with CD33+COS cells treated with specific activators or inhibitors of protein kinases as used above. CD33-transfected COS cells were treated with sialidase, returned to complete culture media for treatment with protein kinase inhibitors or activators as indicated in "Materials and methods," and then the rosetting assay was performed. This demonstrated a reproducible effect of protein kinase inhibition on the number of RBC rosettes formed (Figure 7A). Staurosporine and BIM treatment increased CD33-dependent rosette formation (Figure 7A), whereas PMA treatment somewhat repressed rosetting. Okadaic acid, which inhibits the serine/threonine protein phosphatases 1 and 2A and thus may induce phosphorylation, had a similar effect.
CD33 without a cytoplasmic tail has an enhanced ability to form rosettes As an alternative approach to these questions, a CD33 construct was designed containing a stop codon after Thr299 to yield a truncated cytoplasmic domain. This construct could not be labeled with [32P]-orthophosphate (data not shown). COS cells transfected with this construct (pCD33T299 ) rosetted RBCs, although
consistently a higher number of rosettes were seen.
Significantly, pretreatment of these cells with either inhibitors
or activators of protein kinases did not change the level
of rosettes seen (Figure 7B).
Ligand binding reduces the basal level of CD33 phosphorylation We next examined if either sialidase treatment alone, or sialidase treatment followed by binding to RBCs, would affect CD33 phosphorylation. Sialidase treatment itself affected phosphorylation by only ± 10% (data not shown). Next, the effect of occupancy of the lectin site on CD33 by sialylated ligands on its phosphorylation was examined. For these experiments, CD33-transfected COS cells were labeled with [32P]-orthophosphate, treated with sialidase, and then incubated with either native or desialylated RBCs (to control for any effects secondary to exposure of cells to the suspension of RBCs). These studies demonstrated that binding RBCs reduced the steady-state level of CD33 phosphorylation observed in non-PMA-stimulated cells by about 70% (Figure 8, lane 1 versus lane 3). The enhanced levels of phosphorylation seen after PMA stimulation were not affected by the presence of either native or asialo RBCs (Figure 8).
Intracellular protein phosphorylation represents one of the more critical and dynamic mechanisms by which cellular functions are regulated, underscoring the interest in establishing the phosphorylation patterns of proteins. An analysis of the cytoplasmic domain of CD33 reveals several potential sites of serine/threonine phosphorylation. Of the 11 serine residues, 4 are found in close proximity to basic amino acid residues and agree approximately with established PKC acceptor sequences (Ser305, Ser307, Ser314, and Ser342)59; however, PROSITE analysis identified S307 as the strongest PKC acceptor site. In all cell lines examined, phosphorylated CD33 was identified by a radiochemical approach. Phosphoamino acid analysis identified predominantly phosphoserine, with lesser amounts of phosphothreonine and no phosphotyrosine. The application of different pharmacologic agents known to specifically modify serine/threonine phosphorylation indicates PKC is involved either directly or indirectly in these events. The PKC activator PMA resulted in 3- to 8-fold increase in protein phosphorylation, whereas dibutryl cAMP, which stimulates guanosine-dependent kinases, was without any measurable effect. BIM, a highly specific inhibitor of PKC, totally abrogated the PMA-dependent increase in protein phosphorylation, as did staurosporine, which is more widely active against several serine/threonine kinases including the calmodulin-dependent kinases, myosin light-chain kinase, and protein kinases A and G. These observations demonstrate that PKC is involved in CD33 phosphorylation, either by directly acting on CD33 or as an upstream mediator of another kinase. In contrast, the basal level of phosphorylation seen in resting cells was inhibited by staurosporine but not BIM, indicating that other kinases may be involved as well. As one possibility, the kinase that acts directly on CD33 may be under the control of PKC, such that PKC activators increase phosphorylation yet basal levels of phosphorylation are not decreased by PKC inhibition. Alternatively, 2 or more kinases may act independently on CD33. Several investigators have established the presence of thyosine phosphorylation in CD33 isolated from several myeloid cell lines by using treatment of cells with sodium pervanadate, followed by immunochemical phosphoamino acid analysis using antiphosphotyrosine antibodies. Thus, the tyrosine phosphorylation reported by others presumably occurs only under specific stimulation conditions. Using an alternative approach of radiochemical labeling with [32P]-orthophosphate followed by immunopurification and phosphoamino acid analysis, we demonstrated exclusively the presence of phosphoserine, with smaller amounts of phosphothreonine. These contrasting results indicate the possibility of parallel phosphorylation pathways involved with CD33 function. Because no phosphotyrosine could be identified radiochemically in our hands, the 2 different modifications may be mutually inhibitory or could occur on different populations of CD33, or in cells in different points of the cell cycle. Significantly, however, both techniques of protein phosphorylation analysis leave unanswered the important question of what percentage of the total CD33 population may be modified at any point in time. The in vivo physiologic function of CD33 remains largely unknown. All members of the CD33-like subfamily (Siglec 5-10) carry ITIM motifs; however, neither Ser307 nor Ser342 is strictly conserved within this family. Siglec 5, 7, 8, 9, and 10 possess serine residues that align at or close to the position of CD33 Ser307 and possess a good PKC consensus. Although Ser342 is also found in Siglec 5, 8, 9 and 10, a good PKC motif is generally missing. Therefore, we predict Ser307 as one of the PKC phosphorylation sites. Other members of the Siglec family include CD22, MAG, and sialoadhesin. CD22 plays a role in B-cell responsiveness,63,64 MAG a role in neurite outgrowth,65-67 and sialoadhesin in macrophage adhesion.68-71 A relationship between CD33 cross-linking, CD33 tyrosine phosphorylation, and calcium flux was also demonstrated.48 Our data indicate a relationship between phosphorylation of CD33 and its ability to function as a lectin in these in vitro assays. Taylor et al47 demonstrated an increase in RBC rosette formation when Tyr340 was mutated. This inside-out signaling phenomenon is very similar to the effect of serine phosphorylation in CD33. A decrease in CD33 phosphorylation leads to a higher rosetting activity, implying an affinity modification of the lectin domain by phosphorylation of the cytoplasmic region due to an as yet unknown mechanism. If additional data indicate CD33 may function as an adhesion molecule in vivo, the phosphorylation state of the cell expressing CD33 may play a regulatory role in this regard. Vitale et al reported that CD33 inhibits the proliferation of normal or leukemic myeloid cells, suggesting a regulatory role in normal myelopoiesis, and that engagement of CD33 induces apoptosis of leukemic cells.72,73 The abundance of serine residues in the cytoplasmic tail of CD33 makes
site-specific phosphorylation analysis challenging. The 2-dimensional
peptide maps indicate more than one site of phosphorylation.
PKC-dependent phosphorylation patterns of truncated CD33 constructs
were analyzed because increases in phosphorylation were seen with
increasing tail length. The first increase was seen between the
The physiologic significance of phosphorylation events observed in transformed tumor cells grown in culture with native function(s) is more difficult to address. Here we identified further that CD33 phosphorylation occurred under cytokine control in a cell line (TF-1) that required cytokines for long-term growth. Cytokine stimulation of these cells triggers multiple kinase cascades, including tyrosine and serine/threonine kinases. Further, PMA-dependent phosphorylation of CD33 was also seen with primary human CD34+CD33+ progenitor cells, harvested by leukophoresis following cytokine mobilization, indicating that this modification is not unique to transformed cell lines (data not shown). The paucity of material available here prevented more detailed biochemical analysis of the phosphorylation seen here. The effect of manipulation of CD33 phosphorylation on RBC rosetting,
though modest, was reproducible and consistent. Although increasing
phosphorylation with PMA had only a marginal effect, decreasing its
phosphorylation with kinase inhibitors reproducibly increased rosette
formation. Conversely, occupancy of the lectin site with RBCs reduced
CD33 phosphorylation. Thus, phosphorylation and lectin site occupancy
appear to be antagonistic events. The failure of kinase inhibitors or
activators to affect rosetting by pCD33T299 Of note, other Siglecs are also phosphoproteins. CD22 is rapidly tyrosine phosphorylated following B-cell antigen receptor triggering, and tyrosine phosphorylation is followed by the recruitment of specific cytosolic phosphatases to the membrane surface. MAG is both tyrosine and serine/threonine phosphorylated, possibly directly by PKC.39,74 For CD33, a relationship between the occupancy of the lectin site on the extracellular domain with intracellular phosphorylation events has been reported.47 We now show that another phosphorylation event independent of ITIMs also reduces the lectin activity of CD33, and occupancy of the CD33 lectin domain reduces basal levels of CD33 serine phosphorylation. Because CD33 interacts with sialylated structures on the same cell, the molecule could signal a change in sialylation to the cytoplasm. Another mechanism would be an inside-out signal regulated by the phosphorylation state of the cell (mediated by PKC and other kinases), possibly resulting in changes of structural features such as clustering, orientation, or dimerization. At present, the natural biologic function of CD33 is not known. The RBC rosetting assay represents an in vitro assay of its lectin activity and RBCs are functioning as a surrogate ligand. The expression of CD33 on both immature myeloid cells as well as specific populations of mature, circulating immune effector cells (monocytes and dendritic cells) suggests a role beyond myeloblast development. The data presented here demonstrate its involvement in "kinase cascades" that follow cytokine stimulation and a relationship between its phosphorylation and lectin activity. Future experiments will seek to establish both the specific kinase(s) responsible for its phosphorylation and the biochemical mechanism(s) relating them.
The technical assistance of Jeannette Moyer for some of the work presented is gratefully acknowledged. Drs J. Hardwick and B. Sefton assisted with the phosphoamino acid and phosphopeptide studies, and Dr P. Law kindly provided the human peripheral blood progenitor cells. We thank Drs Jeff Esko, Ajit Varki, and Els Brinkman-Van der Linden for their helpful discussions and for carefully proofreading this manuscript.
Submitted July 9, 2001; accepted December 17, 2001.
Supported by a grant from the V Foundation, Cary, NC, Deutsche Forschungsgemeinschaft grant GR1748 (to K.G.), and Program Project Grant POIHL57345.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Kay Grobe, Glycobiology Research and Training Center, 9500 Gilman Dr, La Jolla, CA 92093; e-mail: kgrobe{at}ucsd.edu.
1.
Andrews RG, Torok-Storb B, Bernstein ID.
Myeloid-associated differentiation antigens on stem cells and their progeny identified by monoclonal antibodies.
Blood.
1983;62:124-132 2. Griffin JD, Linch D, Sabbath K, Larcom P, Schlossman SF. A monoclonal antibody reactive with normal and leukemic human myeloid progenitor cells. Leuk Res. 1984;8:521-534[CrossRef][Medline] [Order article via Infotrieve]. 3. Koller U, Peschel C. Cluster report: CD33. In: Knapp W,Dörken B,Gilks W, eds. Leucocyte Typing IV. New York, NY: Oxford University Press; 1989:812-813. 4. Davey FR, Mick R, Nelson DA, et al. Morphologic and cytochemical characterization of adult lymphoid leukemias which express myeloid antigen. Leukemia. 1988;2:420-426[Medline] [Order article via Infotrieve]. 5. Thomas R, Davis LS, Lipsky PE. Comparative accessory cell function of human peripheral blood dendritic cells and monocytes. J Immunol. 1993;151:6840-6852[Abstract]. 6. Handgretinger R, Schafer HJ, Baur F, et al. Expression of an early myelopoietic antigen (CD33) on a subset of human umbilical cord blood-derived natural killer cells. Immunol Lett. 1993;37:223-228[CrossRef][Medline] [Order article via Infotrieve].
7.
Nakamura Y, Noma M, Kidokoro M, et al.
Expression of CD33 antigen on normal human activated T lymphocytes.
Blood.
1994;83:1442-1443
8.
Freeman SD, Kelm S, Barber EK, Crocker PR.
Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules.
Blood.
1995;85:2005-2012
9.
Brinkmann-Van der Linden ECM, Varki A.
New aspects of siglec binding specificities, including the significance of fucosylation and of the sialylTn epitope. Sialic acid-binding immunoglobulin superfamily lectins.
J Biol Chem.
2000;275:8625-8632 10. Crocker PR, Clark EA, Filbin M, et al. Siglecs: a family of sialic-acid binding lectins. Glycobiology. 1998;8:v.
11.
Powell LD, Varki A.
I-type lectins.
J Biol Chem.
1995;270:14243-14246 12. Crocker PR, Kelm S, Hartnell A, et al. Sialoadhesin and related cellular recognition molecules of the immunoglobulin superfamily. Biochem Soc Trans. 1996;24:150-156[Medline] [Order article via Infotrieve]. 13. Simmons D, Seed B. Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 1988;141:2797-2800[Abstract]. 14. Stamenkovic I, Seed B. The B-cell antigen CD22 mediates monocyte and erythrocyte adhesion. Nature. 1990;345:74-77[CrossRef][Medline] [Order article via Infotrieve].
15.
Wilson GL, Fox CH, Fauci AS, Kehrl JH.
cDNA cloning of the B cell membrane protein CD22: a mediator of B-B cell interactions.
J Exp Med.
1991;173:137-146
16.
Powell LD, Varki A.
The oligosaccharide binding specificities of CD22 beta, a sialic acid-specific lectin of B cells.
J Biol Chem.
1994;269:10628-10636 17. Crocker PR, Mucklow S, Bouckson V, et al. Sialoadhesin, a macrophage sialic acid binding receptor for haemopoietic cells with 17 immunoglobulin-like domains. EMBO J. 1994;13:4490-4503[Medline] [Order article via Infotrieve]. 18. Kelm S, Pelz A, Schauer R, et al. Sialoadhesin, myelin-associated glycoprotein and CD22 define a new family of sialic acid-dependent adhesion molecules of the immunoglobulin superfamily. Curr Biol. 1994;4:965-972[CrossRef][Medline] [Order article via Infotrieve].
19.
Tsuji S.
Molecular cloning and functional analysis of sialyltransferases.
J Biochem.
1996;120:1-13 20. Kikly KK, Bochner BS, Freeman SD, et al. Identification of SAF-2, a novel siglec expressed on eosinophils, mast cells, and basophils. J Allergy Clin Immunol. 2000;105:1093-1100[CrossRef][Medline] [Order article via Infotrieve]. 21. Foussias G, Yousef GM, Diamandis EP. Identification and molecular characterization of a novel member of the siglec family (SIGLEC9). Genomics. 2000;67:171-178[CrossRef][Medline] [Order article via Infotrieve].
22.
Floyd H, Ni J, Cornish AL, et al.
Siglec-8. A novel eosinophil-specific member of the immunoglobulin superfamily.
J Biol Chem.
2000;275:861-866
23.
Cornish AL, Freeman S, Forbes G, et al.
Characterization of siglec-5, a novel glycoprotein expressed on myeloid cells related to CD33.
Blood.
1998;92:2123-2132
24.
Angata T, Varki A.
Siglec-7: a sialic acid-binding lectin of the immunoglobulin superfamily.
Glycobiology.
2000;10:431-438
25.
Patel N, Brinkman-Van der Linden EC, Altmann SW, et al.
OB-BP1/siglec-6. A leptin- and sialic acid-binding protein of the immunoglobulin superfamily.
J Biol Chem.
1999;274:22729-22738
26.
Angata T, Varki A.
Cloning, characterization, and phylogenetic analysis of siglec-9, a new member of the CD33-related group of siglecs. Evidence for co-evolution with sialic acid synthesis pathways.
J Biol Chem.
2000;275:22127-22135 27. Munday J, Kerr S, Ni J, et al. Identification, characterization and leucocyte expression of siglec-10, a novel human sialic acid-binding receptor. Biochem J. 2001;355:489-497[CrossRef][Medline] [Order article via Infotrieve]. 28. Varki A, Marth J. Oligosaccharides in vertebrate development. Sem Dev Biol. 1995;6:127-138.
29.
Kitagawa H, Paulson JC.
Differential expression of five sialyltransferase genes in human tissues.
J Biol Chem.
1994;269:17872-17878 30. Barton DE, Arquint M, Roder J, Dunn R, Francke U. The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1987;1:107-112[CrossRef][Medline] [Order article via Infotrieve].
31.
Peiper SC, Ashmun RA, Look AT.
Molecular cloning, expression, and chromosomal localization of a human gene encoding the CD33 myeloid differentiation antigen.
Blood.
1988;72:314-321 32. Law CL, Torres RM, Sundberg HA, et al. Organization of the murine CD22 locus. Mapping to chromosome 7 and characterization of two alleles. J Immunol. 1993;151:175-187[Abstract].
33.
Schulte RJ, Campbell MA, Fischer WH, Sefton BM.
Tyrosine phosphorylation of CD22 during B cell activation.
Science.
1992;258:1001-1004
34.
Lankester AC, van Schijndel GM, van Lier RA.
Hematopoietic cell phosphatase is recruited to CD22 following B cell antigen receptor ligation.
J Biol Chem.
1995;270:20305-20308 35. Campbell M-A, Klinman NR. Phosphotyrosine-dependent association between CD22 and protein tyrosine phosphatase 1C. Eur J Immunol. 1995;25:1573-1579[Medline] [Order article via Infotrieve].
36.
Law CL, Sidorenko SP, Chandran KA, et al.
CD22 associates with protein tyrosine phosphatase 1C, Syk, and phospholipase C-gamma(1) upon B cell activation.
J Exp Med.
1996;183:547-560 37. Otipoby KL, Andersson KB, Draves KE, et al. CD22 regulates thymus-independent responses and the lifespan of B cells. Nature. 1996;384:634-637[CrossRef][Medline] [Order article via Infotrieve].
38.
O'Keefe TL, Williams GT, Davies SL, Neuberger MS.
Hyperresponsive B cells in CD22-deficient mice.
Science.
1996;274:798-801 39. Afar DE, Salzer JL, Roder J, Braun PE, Bell JC. Differential phosphorylation of myelin-associated glycoprotein isoforms in cell culture. J Neurochem. 1990;55:1418-1426[CrossRef][Medline] [Order article via Infotrieve]. 40. Agrawal HC, Noronha AB, Agrawal D, Quarles RH. The myelin-associated glycoprotein is phosphorylated in the peripheral nervous system. Biochem Biophys Res Commun. 1990;169:953-958[CrossRef][Medline] [Order article via Infotrieve]. 41. Kirchhoff F, Hofer HW, Schachner M. Myelin-associated glycoprotein is phosphorylated by protein kinase C. J Neurosci Res. 1993;36:368-381[CrossRef][Medline] [Order article via Infotrieve]. 42. Mukhopadhyay G, Doherty P, Walsh FS, Crocker PR, Filbin MT. A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 1994;13:757-767[CrossRef][Medline] [Order article via Infotrieve]. 43. Ng WP, Cartel N, Li C, Roder J, Lozano A. Myelin from MAG-deficient mice is a strong inhibitor of neurite outgrowth. Neuroreport. 1996;7:861-864[Medline] [Order article via Infotrieve]. 44. Li C, Tropak MB, Gerlai R, et al. Myelination in the absence of myelin-associated glycoprotein. Nature. 1994;369:747-750[CrossRef][Medline] [Order article via Infotrieve]. 45. Mucklow S, Hartnell A, Mattei MG, Gordon S, Crocker PR. Sialoadhesin (Sn) maps to mouse chromosome 2 and human chromosome 20 and is not linked to the other members of the sialoadhesin family, CD22, MAG, and CD33. Genomics. 1995;28:344-346[CrossRef][Medline] [Order article via Infotrieve]. 46. Crocker PR, Morris L, Gordon S. Novel cell surface adhesion receptors involved in interactions between stromal macrophages and haematopoietic cells. J Cell Sci Suppl. 1988;9:185-206[Medline] [Order article via Infotrieve].
47.
Taylor VC, Buckley CD, Douglas M, Cody AJ, Simmons DL, Freeman SD.
The myeloid-specific sialic acid-binding receptor, CD33, associates with the protein-tyrosine phosphatases, SHP-1 and SHP-2.
J Biol Chem.
1999;274:11505-11512 48. Ulyanova T, Blasioli J, Woodford-Thomas TA, Thomas ML. The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 1999;29:3440-3449[CrossRef][Medline] [Order article via Infotrieve].
49.
Paul SP, Taylor LS, Stansbury EK, McVicar DW.
Myeloid specific human CD33 is an inhibitory receptor with differential ITIM function in recruiting the phosphatases SHP-1 and SHP-2.
Blood.
2000;96:483-490
50.
Rinaudo MS, Su K, Falk LA, Halder S, Mufson RA.
Human interleukin-3 receptor modulates bcl-2 mRNA and protein levels through protein kinase C in TF-1 cells.
Blood.
1995;86:80-88 51. Sefton BM. Post-translational modification: phosphorylation and phosphatases. In: Coligan JE,Dunn BM,Ploegh HL,Speicher DW,Wingfield PT, eds. Current Protocols in Protein Science. New York, NY: Wiley; 1995:13.01-13.5.8. 52. Powell LD, Bause E, Legler G, Molyneux RJ, Hart GW. Influence of asparagine-linked oligosaccharides on tumor cell recognition in the mixed lymphocyte reaction. J Immunol. 1985;135:714-724[Abstract]. 53. Freeze HH. Endoglycosidase and glycoamidase release of N-linked oligosaccharides. In: Ausubel FM,Brent R,Kingston RE,Moore DD,Seidman JG,Smith JA,Struhl K, eds. Current Protocols in Molecular Biology. New York, NY: Wiley; 1994:17.13.1-17.13.16.
54.
Adler V, Polotskaya A, Wagner F, Kraft AS.
Affinity-purified c-Jun amino-terminal protein kinase requires serine/threonine phosphorylation for activity.
J Biol Chem.
1992;267:17001-17005 55. Evans SW, Rennick D, Farrar WL. Identification of a signal-transduction pathway shared by haematopoietic growth factors with diverse biological specificity. Biochem J. 1987;244:683-691[Medline] [Order article via Infotrieve]. 56. Yamamoto M, Nishimura J, Ideguchi H, Ibayashi H. Specific phosphorylation of 22-kD proteins by various inducers for granuloid differentiation in myeloid leukemic cells. Leuk Res. 1988;12:71-80[CrossRef][Medline] [Order article via Infotrieve].
57.
Feuerstein N, Cooper HL.
Rapid protein phosphorylation induced by phorbol ester in HL-60 cells. Unique alkali-stable phosphorylation of a 17,000-dalton protein detected by two-dimensional gel electrophoresis.
J Biol Chem.
1983;258:10786-10793 58. Pearson RB, Kemp BE. Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Methods Enzymol. 1991;200:62-81[Medline] [Order article via Infotrieve].
59.
Nishikawa K, Toker A, Johannes F-J, Songyang Z, Cantley LC.
Determination of the specific substrate sequence motifs of protein kinase C isozymes.
J Biol Chem.
1997;272:952-960
60.
Toullec D, Pianetti P, Coste H, et al.
The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C.
J Biol Chem.
1991;266:15771-15781 61. Okuda K, Matulonis U, Salgia R, Kanakura Y, Druker B, Griffin JD. Factor independence of human myeloid leukemia cell lines is associated with increased phosphorylation of the proto-oncogene Raf-1. Exp Hematol. 1994;22:1111-1117[Medline] [Order article via Infotrieve]. 62. Kitamura T, Tange T, Terasawa T, et al. Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or erythropoietin. J Cell Physiol. 1989;140:323-334[CrossRef][Medline] [Order article via Infotrieve].
63.
Sato S, Jansen PJ, Tedder TF.
CD19 and CD22 expression reciprocally regulates tyrosine phosphorylation of Vav protein during B lymphocyte signaling.
Proc Natl Acad Sci. U S A.
1997;94:13158-13162 64. Nadler MJ, McLean PA, Neel BG, Wortis HH. B cell antigen receptor-evoked calcium influx is enhanced in CD22-deficient B cell lines. J Immunol. 1997;159:4233-4243[Abstract]. 65. McKerracher L, David S, Jackson DL, Kottis V, Dunn RJ, Braun PE. Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth. Neuron. 1994;13:805-811[CrossRef][Medline] [Order article via Infotrieve].
66.
Yang LJ, Zeller CB, Shaper NL, et al.
Gangliosides are neuronal ligands for myelin-associated glycoprotein.
Proc Natl Acad Sci U S A.
1996;93:814-818 67. De Bellard ME, Filbin MT. Myelin-associated glycoprotein, MAG, selectively binds several neuronal proteins. J Neurosci Res. 1999;56:213-218[CrossRef][Medline] [Order article via Infotrieve].
68.
Barnes YC, Skelton TP, Stamenkovic I, Sgroi DC.
Sialylation of the sialic acid binding lectin sialoadhesin regulates its ability to mediate cell adhesion.
Blood.
1999;93:1245-1252
69.
Muerkoster S, Rocha M, Crocker PR, Schirrmacher V, Umansky V.
Sialoadhesin-positive host macrophages play an essential role in graft-versus-leukemia reactivity in mice.
Blood.
1999;93:4375-4386 70. Nath D, Hartnell A, Happerfield L, et al. Macrophage-tumour cell interactions: identification of MUC1 on breast cancer cells as a potential counter-receptor for the macrophage-restricted receptor, sialoadhesin. Immunology. 1999;98:213-219[CrossRef][Medline] [Order article via Infotrieve].
71.
van den Berg TK, Nath D, Ziltener HJ, et al.
Cutting edge: CD43 functions as a T cell counterreceptor for the macrophage adhesion receptor sialoadhesin (Siglec-1).
J Immunol.
2001;166:3637-3640
72.
Vitale C, Romagnani C, Falco M, et al.
Engagement of p75/AIRM1 or CD33 inhibits the proliferation of normal or leukemic myeloid cells.
Proc Natl Acad Sci U S A.
1999;96:15091-15096
73.
Vitale C, Romagnani C, Puccetti A, et al.
Surface expression and function of p75/AIRM-1 or CD33 in acute myeloid leukemias: engagement of CD33 induces apoptosis of leukemic cells.
Proc Natl Acad Sci U S A.
2001;98:5764-5769 74. Trudel S, Paquet MR, Grinstein S. Mechanism of vanadate-induced activation of tyrosine phosphorylation and of the respiratory burst in HL60 cells. Role of reduced oxygen metabolites. Biochem J. 1991;276:611-619.
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
T. Hernandez-Caselles, M. Martinez-Esparza, A. B. Perez-Oliva, A. M. Quintanilla-Cecconi, A. Garcia-Alonso, D. M. R. Alvarez-Lopez, and P. Garcia-Penarrubia A study of CD33 (SIGLEC-3) antigen expression and function on activated human T and NK cells: two isoforms of CD33 are generated by alternative splicing J. Leukoc. Biol., January 1, 2006; 79(1): 46 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Varki and T. Angata Siglecs--the major subfamily of I-type lectins Glycobiology, January 1, 2006; 16(1): 1R - 27R. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Garnache-Ottou, L. Chaperot, S. Biichle, C. Ferrand, J.-P. Remy-Martin, E. Deconinck, P. D. de Tailly, B. Bulabois, J. Poulet, E. Kuhlein, et al. Expression of the myeloid-associated marker CD33 is not an exclusive factor for leukemic plasmacytoid dendritic cells Blood, February 1, 2005; 105(3): 1256 - 1264. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Sonnenburg, T. K. Altheide, and A. Varki A uniquely human consequence of domain-specific functional adaptation in a sialic acid-binding receptor Glycobiology, April 1, 2004; 14(4): 339 - 346. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||