|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
IMMUNOBIOLOGY
From the Departments of Radiation Biology, of Molecular
Medicine, and of Clinical Laboratory Science, Osaka University Medical
School; Third Department of Internal Medicine, Nippon Medical School,
Tokyo; Department of Medicine, Osaka Minami National Hospital; Nissay
Hospital, Nippon Life Saiseikai Foundation, Osaka; Center for Adult
Diseases, Osaka; Sakai Municipal Hospital, Osaka; Department of
Biophysics, Kyoto University; and Osaka University, Japan.
Wilms tumor gene WT1 is expressed at high
levels in hematopoietic malignancies, such as leukemias and
myelodysplastic syndromes (MDS), and in various kinds of solid tumors,
including lung cancer, and it exerts an oncogenic function in these
malignancies. IgM and IgG WT1 antibodies were measured by means of dot
blot assay in 73 patients with hematopoietic malignancies (16 acute
myeloid leukemia [AML], 11 acute lymphoid leukemia [ALL], 13 chronic myeloid leukemia [CML], and 33 MDS) and 43 healthy
volunteers. Immunoglobulin IgM, IgG, and IgM+IgG WT1 antibodies were
detected in 40 (54.8%), 40 (54.8%), and 24 (32.8%), respectively, of
the 73 patients with hematopoietic malignancies, whereas 7 (16.2%), 2 (4.7%), and none of the 43 healthy volunteers had IgM, IgG, or IgM+IgG
WT1 antibodies, respectively. Furthermore, immunoglobulin isotype class
switching of WT1 antibodies from IgM to IgG occurred in conjunction
with disease progression from refractory anemia (RA) to RA with excess of blasts (RAEB), and further to RAEB in transformation (RAEB-t) in MDS
patients. These results showed that humoral immune responses against
the WT1 protein could be elicited in patients with WT1-expressing hematopoietic malignancies, and they suggested that the helper T-cell
responses needed to induce humoral immune responses and immunoglobulin
isotype class switching from IgM to IgG were also generated in these
patients. Our findings may provide new insight into the rationale for
elicitation of cytotoxic T-cell responses against the WT1 protein in
cancer immunotherapy using the WT1 vaccine.
(Blood. 2002;99:3272-3279) Wilms tumor gene, WT1, is responsible
for the tumorigenesis of a childhood renal neoplasm, Wilms tumor, which
is thought to arise as a result of the inactivation of both alleles of
the WT1 gene.1,2 The WT1 gene has
been considered a tumor-suppressor gene on the basis of findings such
as intragenic deletions or mutations in Wilms tumor, germline mutations
in patients with leukemia predisposition syndromes, and WT1-mediated
growth suppression of Wilms tumor cells.3-7 This gene
encodes a zinc finger transcription factor involved in tissue
development, in cell proliferation and differentiation, and in
apoptosis.8 The WT1 gene product represses the
transcription of growth factor (platelet-derived growth factor The WT1 gene was originally defined as a tumor-suppressor
gene, as mentioned earlier. However, we recently proposed that the wild-type WT1 gene performs an oncogenic rather than a
tumor-suppressor function in leukemogenesis and tumorigenesis in
various types of solid tumors on the basis of the following findings:
(1) high expression of the wild-type WT1 gene in
leukemias26-31 and various types of solid tumors,
including ovarian tumors, Leydig cell tumors, mesothelioma, gastric
cancer, colon cancer, lung cancer, and breast cancer23,32-43; (2) growth inhibition of
leukemic44,45 and solid tumor cells41 by
treatment with WT1 antisense oligomers; (3) promotion of cell
growth, but blocking of cell differentiation, in the myeloid progenitor
cell line 32D46 and in normal bone marrow myeloid
cells47 as a result of constitutive WT1 gene expression caused by transfection with the wild-type WT1
gene; and (4) WT1 expression detected in most
7,12-dimethylbenzanthracene-induced erythroblastic leukemias and a
tendency for cells with high levels of WT1 expression to develop into
leukemias.48
Stimulation in vitro of HLA-A2.1-positive or -A24.2-positive peripheral
blood mononuclear cells with 9-mer WT1 peptides containing major
histocompatibility complex (MHC) class 1 binding anchor motifs elicited
WT1-specific cytotoxic T lymphocytes (CTLs).49-51 These
CTLs specifically killed WT1-expressing tumor cells in an HLA class
1-restricted manner and inhibited colony formation by transformed
CD34+ progenitor cells isolated from patients with
CML.50 Similarly, immunization in vivo of mice with a
9-mer WT1 peptide containing anchor motifs for binding to MHC class I
molecules52,53 or with WT1 plasmid DNA54
elicited WT1-specific CTLs. The immunized mice rejected challenges with
WT1-expressing tumor cells.52,54 These findings indicated
that WT1 protein is an attractive, novel tumor antigen for cancer
immunotherapy. Tumor antigens can be classified into 5 groups55,56: (1) cancer-testis antigens that are expressed
in a range of different tumor types but not in normal tissues except
testis (eg, MAGE and NY-ESO-1), (2) melanocyte differentiation antigens
expressed in melanoma and normal melanocytes (eg, gp100 and
tyrosinase); (3) antigens encoded by mutated normal gene (eg, p53
and ras); (4) self-antigens overexpressed in malignant tissues
(eg, HER-2/neu); and (5) antigens derived from oncogenic viruses (eg,
HPV and EBV). Thus, the WT1 protein was identified as a novel,
overexpressed tumor antigen, falling into the fourth category. In vitro
and in vivo evidence of cellular immune responses against the WT1
protein led to the possibility that humoral immune responses against
the WT1 protein could be elicited in patients with WT1-expressing
hematopoietic malignancies. Our study aimed to examine this
possibility, and we report here that patients with WT1-expressing
hematopoietic malignancies elicited humoral immune responses against
the WT1 protein.
Patients
Antibodies
Reverse transcription-polymerase chain reaction for quantitation of WT1 expression levels PBMCs were collected at the time of diagnosis, and RNA was prepared from PBMCs and converted into cDNA. Polymerase chain reaction (PCR) was performed for optimized cycles with a DNA thermal cycler as described previously.57 Expression level of the WT1 gene in K562 leukemic cells was defined as 1.0, and the WT1 expression level in the samples was shown relative to that in K562 cells.Preparation of WT1 antigens for measurement of WT1 antibodies DNA sequences corresponding to the truncated WT1 protein containing 1 to 294 (HWT3), 1 to 181 (HWT2), and 182 to 294 (HWT4) amino acid sequences were PCR amplified from plasmid vector DNA, pBluescriptII-WT1+/+, containing nonspliced, full-length WT1 cDNA, by using the following primers: 5' primers, TTGAATTCAATGGGCTCCGACGTGCGG for HWT2 and HWT3, TTGAATTCAGATCCAATGGGCCAGCAG for HWT4; 3' primers, TTGTCGACGAAGACACCGTGCGTGTG for HWT3 and HWT4, TTGTCGACCATGGGATCCTCATGCTT for HWT2. Resultant DNA fragments were cleaved at the 5' and 3' ends by EcoRI and SalI, respectively, and were cloned into the same restriction sites of plasmid vector pET-21b(+), which contains the C-terminal His-Tag sequences (Novagen, Madison, WI). Resultant plasmids were transfected into Escherichia coli XL1-blue, and the positive transformants were checked for an appropriate insert by means of restriction mapping and DNA sequencing. Plasmid DNA was then transfected into E coli BL21 (DE3) (Stratagene, La Jolla, CA) to produce the truncated recombinant WT1 protein.E coli BL21 (DE3), carrying constructs of the truncated
forms of the WT1 gene, were grown at 37°C to an A600 of
0.6 and then were incubated for 4 hours in the presence of 0.1 µM isopropyl- Dot blot assay of WT1 antibodies Truncated WT1 protein was bound on nitrocellulose membrane Optitran (Schleicher & Schuell, Dassel, Germany) at a density of 2.5 µg/cm2 by incubation for 1 hour at room temperature. The membrane was then washed with phosphate-buffered saline (PBS), blocked for 2 hours in PBS containing 1% bovine serum albumin (BSA), and loaded onto a dot-blot apparatus (Schleicher & Schuell) according to the manufacturer's recommendations. Twenty microliters sera diluted 1:500 for IgM and 1:2500 for IgG with PBS containing 1% BSA and 0.1% Tween 20 were applied to wells and incubated for 1 hour at room temperature. After it was washed with PBS, the membrane was reacted with horseradish peroxidase (HRP)-conjugated goat anti-human IgM antibody (ICN Pharmaceuticals, Cleveland, OH) for the detection of IgM isotype of the WT1 antibodies or with HRP-conjugated rabbit anti-human IgG antibody (ICN Pharmaceuticals) for the detection of IgG isotype of the WT1 antibodies, in PBS containing 1% BSA for 1 hour at room temperature. After intensive washing with PBS, the membrane was incubated with the substrate solution Renaissance (NEN Life Science Products, Boston, MA) for 1 minute and exposed to Hyperfilm MP (Amersham Pharmacia Biotech, Buckinghamshire, England). Densities of dot blots were measured as densitometric units with a computerized scanning analyzer system (Molecular Dynamics, Sunnyvale, CA), and the densitometric unit was considered equivalent to an antibody titer. Each value shown represents an average of at least 2 experiments.Statistics Cut-off values of WT1 antibody were determined at 600 and 500 densitometric units for IgM and IgG WT1 antibodies, respectively, on the basis of receiver-operating characteristic plots.58 Fisher exact test was used for the calculation of differences in detection rates of WT1 antibodies between the 2 groups. The Student t test and Welch analysis of variance were used for the calculation of differences in WT1 antibody densitometric units between 2 equal variances and between 2 unequal variances, respectively. Linear regression coefficient (r) was used for evaluation of the correlation between WT1 antibody densitometric units and either WT1 expression levels or patient ages. Fisher exact test was used for evaluation of the correlation between the presence of WT1 antibodies and the sex, clinical performance, and outcome of each patient. Statistical analysis was performed by JMP software (SAS Institute, Cary, NC).
Establishment of dot blot assay for measurement of WT1 antibodies Truncated recombinant WT1 proteins purified by metal chelate affinity chromatography were analyzed by SDS-PAGE. As shown in Figure 1B, the truncated recombinant WT1 proteins HWT3, HWT2, and HWT4 were electrophoresed to each molecular weight expected from the amino acid sequences, confirming an appropriate size of each WT1 protein.
The truncated WT1 protein HWT3, consisting of 294 amino acids of the N-terminus of the WT1 protein, was reacted with an anti-WT1 polyclonal antibody, WT180, raised against the WT1 peptide containing sequences corresponding to 180 amino acids in length and mapping near the N-terminus of the WT1 protein, or it was reacted with anti-WT1 monoclonal antibody 1B6 raised against exon 5 of the WT1 protein. As shown in Figure 1C, HWT3 reacted with the anti-WT1 antibodies, whereas HWT2 reacted with only WT180 and HWT4 reacted with only 1B6. These results confirmed the antigenicity of the truncated WT1 proteins HWT3, HWT2, and HWT4. To detect a broader range of WT1 antibodies in patient sera, the truncated WT1 protein HWT3 was used as a WT1 antigen to detect WT1 antibodies. To confirm the specificity of the dot blot assay used to measure WT1
antibodies, the inhibition assay was performed in the presence of the
truncated WT1 protein, HWT3, used as an antigen for the detection of
WT1 antibodies. As shown in Figure 2,
reactivity to the WT1 antigen
WT1 expression in patients with hematopoietic malignancies WT1 expression levels in PBMCs were quantified by means of quantitative reverse transcription (RT)-PCR (Figure 3). In 52 (92.9%) of 56 patients with hematopoietic malignancies (16 AML, 11 ALL, 13 CML, and 16 MDS), WT1 expression was detected, though the range of WT1 expression levels was broad. On the other hand, WT1 expression was not detected in any of 43 healthy volunteers. In MDS, WT1 expression levels increased in parallel with disease progression from RA to RAEB and further to RAEB-t. These results confirmed our previous reports.28,31,57
Detection of WT1 antibodies in sera from patients with hematopoietic malignancies IgM or IgG WT1 antibodies were examined by means of dot blot assay for the 73 patients with hematopoietic malignancies (16 AML, 11 ALL, 13 CML, and 33 MDS) and 43 healthy volunteers (Table 2, Figures 4 and 5). In 40 (54.8%) of 73 patients with hematopoietic malignancies, IgM WT1 antibodies were detected, whereas IgM WT1 antibodies were detected in 7 (16.2%) of the 43 healthy volunteers (Table 2, Figure 4A). Detection rates of the IgM WT1 antibodies (P = .0001) and densitometric units of IgM WT1 antibodies (P < .0001) were significantly higher in patients with hematopoietic malignancies than in healthy volunteers. When IgM WT1 antibody densitometric units in 4 types of hematopoietic malignancies were individually compared with those in healthy volunteers, the densitometric units in patients with hematopoietic malignancies, except for ALL, were significantly higher than those in healthy volunteers.
IgG WT1 antibodies were also examined in the same patients who were examined for IgM WT1 antibodies (Table 2, Figure 4B). In 40 (54.8%) of the 73 patients with hematopoietic malignancies, IgG WT1 antibodies were detected, but they were detected in only 2 (4.7%) of the 43 healthy volunteers. Detection rates of the IgG WT1 antibodies (P = .0001) and densitometric units of IgG WT1 antibodies (P < .0001) were significantly higher in patients with hematopoietic malignancies than in healthy volunteers. When the IgG WT1 antibody densitometric units were analyzed according to the disease types of hematopoietic malignancies, the densitometric units were significantly higher in patients with 3 types of hematopoietic malignancies (AML, CML, and MDS, but not ALL) than in healthy volunteers. Production of WT1 antibodies of IgM and IgG isotypes showed a striking contrast between patients with hematopoietic malignancies and healthy volunteers. Twenty-four (32.8%) of the 73 patients produced WT1 antibodies of IgM and IgG isotypes, whereas none of the 43 healthy volunteers did so simultaneously. Noteworthy is that 4 patients (2 AML, 2 MDS) with the highest densitometric units of IgG WT1 antibodies simultaneously had IgM WT1 antibodies and that 6 (37.5%) of 16 AML patients, 4 (30.7%) of 13 CML patients, and 14 (42.4%) of 33 MDS patients simultaneously produced IgM and IgG WT1 antibodies, whereas none of 11 ALL patients simultaneously produced both isotypes of WT1 antibodies. No correlation was found between the WT1 antibody densitometric units and either WT1 expression level or patient age or between the presence of WT1 antibodies and patient sex, clinical performance, and outcome (complete remission rate and survival) (data not shown). Disappearance of WT1 antibodies in continuous complete remission of leukemia WT1 antibodies were measured at time of diagnosis and in continuous complete remission (CCR) in 4 leukemia patients (Table 3). In all these patients, relatively high densitometric units of WT1 antibodies detected at the time of diagnosis became undetectable in CCR. Patients maintained CCR for 3.1 to 5.5 years, had normal levels of serum IgM, IgG, and IgA, and were not treated with immunosuppressive drugs at the time of examination. These findings indicated that the patients had recovered from immunosuppression caused by intensive chemotherapy or allogeneic bone marrow transplantation (allo-BMT). They also suggested the possibility of correlation between leukemic tumor burden and production of WT1 antibodies.
Immunoglobulin isotype class switching of WT1 antibodies from IgM to IgG in conjunction with disease progression of myelodysplastic syndromes IgM and IgG WT1 antibodies were measured in sera from 33 patients with MDS (12 RA, 11 RAEB, and 10 RAEB-t) (Figure 5). In RA, IgM WT1 antibodies were detected in 9 of 12 patients, and in 4 of the 9 patients with the IgM WT1 antibodies, the densitometric units were comparatively high. In contrast, IgG WT1 antibodies were not detectable in 7 of 12 RA patients. As for RAEB, IgM and IgG WT1 antibodies were detected in 9 and 9, respectively, of the 11 patients. IgM WT1 antibody densitometric units were lower than those in RA patients, but IgG WT1 antibody densitometric units were higher. The picture for RAEB-t was strikingly different from that in RA. Three of 10 patients had low densitometric units of IgM WT1 antibodies, whereas 9 of 10 patients produced high densitometric units of IgG WT1 antibodies. These findings indicated that immunoglobulin isotype class switching of WT1 antibodies from IgM to IgG occurred in conjunction with the disease progression of MDS from RA to RAEB-t by way of RAEB.
We reported here humoral immune responses against WT1 protein in patients with leukemia or MDS. WT1 antibodies were detected in 57 (78.1%) of 73 patients with hematopoietic malignancies but in only 9 (20.9%) of 43 healthy volunteers whose titers were significantly lower than those of the patients. Concerning the production of the IgG isotype of WT1 antibodies, 40 (54.8%) of the 73 patients produced IgG WT1 antibodies, but only 2 (4.7%) of the 43 healthy volunteers did. A striking contrast between patients and healthy volunteers was found in the simultaneous production of IgM and IgG WT1 antibodies, which was detected in 24 (32.8%) of the 73 patients but in none of the volunteers. In other words, production of the IgG isotype of WT1 antibodies was frequent in patients with hematopoietic malignancies but rare in healthy volunteers, and the simultaneous production of IgM and IgG WT1 antibodies was limited to the patients. This suggests that strong and persistent stimulation by the WT1 antigen, which usually occurs in patients with a large amount of leukemic cells, is needed to generate immunoglobulin isotype class switching from IgM to IgG WT1 antibodies. Thus, detection of the IgG isotype of WT1 antibodies, especially of the simultaneous presence of the IgM and IgG isotypes, may indicate morbidity and suggests the presence of WT1-expressing leukemia cells. In 4 of 6 RA patients who were examined for WT1 expression, WT1 expression levels in PBMCs were below detection limits, whereas IgM WT1 antibodies were detected in 5 of the 6 RA patients. This suggests that weak but persistent stimulation by a small amount of WT1-expressing leukemia cells, which existed in bone marrow of the RA patients, elicited IgM humoral immune responses. A recent study found that WT1 antibodies were directed against the N-terminus portion of the WT1 protein in 3 of 18 patients with AML, whereas no WT1 antibodies were detected in the 2 normal control sera tested.53 These results and our data presented here showed that the WT1 protein could give rise to humoral immune responses. We previously reported that in vivo immunization of C57BL/6 mice (MHC class 1, H-2Db) with the 9-mer WT1 peptide Db126, which has anchor motifs needed for binding to H-2Db molecules and in fact has relatively high levels of binding affinity to the molecules, elicited CTLs against the WT1 protein, resulting in the rejection of challenges from WT1-expressing tumor cells.52 We also reported that an intramuscular injection of the plasmid DNA containing full-sized WT1 cDNA into C57BL/6 mice generated CTLs against the WT1 protein and that the immunized mice rejected WT1-expressing tumor cell challenges.54 Recently, Gaiger et al53 reported that immunization of C57BL/6 mice with the WT1 peptides containing motifs for binding to either MHC class I or class II elicited WT1-specific CTLs or WT1-specific helper T cell and WT1 antibody responses, respectively. Furthermore, we49 and others50,51 reported that in vitro stimulation with 9-mer WT1 peptides of human PBMCs from HLA-A2.1-positive49,50 or HLA-A24.2-positive donors51 generated CTLs against the WT1 peptides and that these CTLs lysed WT1-expressing tumor cells in an HLA-restricted manner and inhibited colony formation by transformed CD34+ progenitor cells from patients with CML.50 Thus, the previous results and our data presented here demonstrated that the WT1 protein has great potential for eliciting humoral and cellular immune responses. Of patients with hematopoietic malignancies, 54.8% had IgG WT1 antibodies. Because immunoglobulin isotype class switching from IgM to IgG generally requires T-cell help, T-cell immune responses against WT1 protein should have occurred in the patients with IgG WT1 antibodies. In MDS, disease generally progresses from RA to RAEB and further to RAEB-t toward overt leukemia. Our study clearly demonstrates that immunoglobulin isotype class switching of WT1 antibodies from IgM to IgG occurs in conjunction with the disease progression of MDS. A previous study of ours57 and the results presented here showed a significant increase in WT1 expression levels in parallel with the disease progression from RA to RAEB and further to RAEB-t. Therefore, it is likely that the persistent or strong antigenic stimulation by the WT1 protein in patients with RAEB-t, compared to that in patients with RA, promoted immunoglobulin isotype class switching of WT1 antibodies from IgM to IgG. Our current findings strongly indicate that T-cell immune responses against the WT1 protein to help immunoglobulin isotype class switching of WT1 antibodies occur in patients with leukemia and MDS. This also suggests that T-cell immune responses such as CTL induction may occur in these patients as well, thus providing a new rationale for immunotherapy for leukemia and MDS patients by vaccination with the WT1 protein or peptides. NY-ESO-1, a member of the cancer-testis family of antigens, is expressed in a subset of a broad range of different human tumor types.59 Humoral and cellular immune responses against NY-ESO-1 protein were simultaneously assayed in patients with NY-ESO-1-expressing tumors.60 CD8+ T-cell responses to HLA-A2-restricted NY-ESO-1 peptides were detected in 10 of 11 patients with the NY-ESO-1 antibody, but not in patients lacking the antibody or with NY-ESO-1-negative tumors. These findings indicate a clear correlation between humoral and cellular immune responses. Therefore, it seems to be a reasonable assumption that WT1 antibody-positive patients with hematopoietic malignancies simultaneously elicit CD8+ T-cell immune responses against the WT1 protein. Measurement of WT1 antibodies thus may be useful for the evaluation of patients with hematopoietic malignancies who are candidates for CD8+ T cell-mediated immunotherapy targeting the WT1 protein. Tolerance to self-peptides has been well documented. It can be induced by the deletion of self-reactive T cells in the thymus61 and by the deletion or exhaustion of such cells in the periphery.62 Self-reactive T cells that have escaped the deletion are functionally anergized or silenced by the down-regulation of coreceptor molecules.63,64 In classical immunology, therefore, a self-protein, WT1, is thought to become tolerant. Increasing evidence, however, prompted us to accept that a large quantity of antigenic determinants of the self-proteins did not induce self-tolerance and thus that a substantial number of self-reactive clones existed in healthy persons and have the potential to elicit immune responses directed against tumors. Anatomic seclusion of potentially self-reactive T-cell clones65 or simple ignorance of target cells by the T-cell clones66-68 can induce tolerance to self-proteins. If the self-proteins are not expressed at sufficient levels at the time and place of tolerance induction, they probably can break tolerance when they are expressed at relatively high levels. Because the WT1 protein is highly expressed in leukemias and MDS, the WT1 self-protein may be able to break immune tolerance to it. In 4 patients with acute leukemia whose IgM and IgG antibody densitometric units were measured at the time of diagnosis and in CCR, the WT1 antibody densitometric units were reduced below the cutoff values in CCR. These findings suggest a relationship between the tumor burden of WT1-expressing leukemia cells and the production of WT1 antibodies. It is likely that a large amount of WT1-expressing leukemic cells at the time of diagnosis promoted the production of WT1 antibodies, but stimulation to produce WT1 antibodies was reduced or discontinued by the reduction in or disappearance of leukemic cells after CCR had been achieved. Therefore, measurement of WT1 antibodies may be useful to determine whether patients have residual leukemic cells that will stimulate the production of the WT1 antibodies. In this context, it should be noted that p53 antibodies are detectable at high frequencies in patients with various types of cancer, including lung cancer,69 and that in a lung cancer patient with high levels of p53 antibodies, a drop in these was observed during treatment.70 This drop was associated with the patient's clinical and radiologic response to treatment. This observation shows the same clinical significance as our finding of a relationship between WT1 antibodies and leukemic tumor burden. This may indicate the possibility of extending the clinical application of our findings to the early diagnosis of leukemia relapse. A proportion of patients with MDS eventually progresses to overt leukemia, so that early prediction of leukemic transformation is one of the most important aspects of effective treatments of this disease. However, until recently, it remained difficult to predict leukemic transformation at molecular levels. We recently demonstrated that leukemic transformation of MDS could be predicted by means of quantitation of WT1 expression levels in PBMCs.57 This represented the first success in prediction of leukemic transformation of MDS at molecular levels. In the study reported here, we showed immunoglobulin isotype class switching from IgM to IgG of WT1 antibodies in conjunction with disease progression to leukemic transformation in MDS. Therefore, monitoring of IgM and IgG WT1 antibody titers may be useful for the early prediction of leukemic transformation in MDS. A correlation has been established between the tumor burden of leukemic cells and the production of WT1 antibodies. This suggests the possibility that the onset of leukemia can be diagnosed earlier by measuring WT1 antibodies, especially of the IgG isotype. Similarly, it is suggested that p53 and Her-2/neu antibodies may be useful for the early detection of cancer,71,72 given that p53 antibodies are produced as a result of the accumulation of the p53 protein caused by point mutations and given that Her-2/neu antibodies resulted from the overexpression of Her-2/neu protein in cancer cells. Further studies to address this issue should be of interest and importance. No correlation between the existence of WT1 antibodies at the times of diagnosis and prognosis could be established in this study because the patients were differently treated with chemotherapy alone or allo-BMT, though most were treated with allo-BMT, and because the observation period was still short. As for the association between p53 antibodies and prognosis in breast cancer, 2 studies found an association between p53 antibodies and short survival time, one study did not find any association, and another study found an association with good survival.69 Thus, the relationship between the existence of antibodies against WT1 or p53 protein and prognosis remains a matter of conjecture. It is unknown why antibodies against the WT1 protein were detected in healthy volunteers, but possible explanations may be that the volunteers were in an autoimmune state or had humoral immune responses against latent WT1-expressing cancers, including hematopoietic malignancies. Follow-up of healthy volunteers with WT1 antibodies should be interesting and important.
We thank Tsuyomi Yajima, Aya Ofukata, and Mariko Yamamoto for preparation of the manuscript and Machiko Mishima for skillful technical assistance.
Submitted May 9, 2001; accepted December 18, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Haruo Sugiyama, Department of Clinical Laboratory Science, Osaka University Medical School,1-7, Yamada-Oka, Suita City, Osaka 565-0871, Japan; e-mail: sugiyama{at}sahs.med.osaka-u.ac.jp.
1. Call KM, Glaser T, Ito CY, et al. Isolation and characterization of a zinc finger polypeptide gene at the human chromosome 11 Wilms' tumor locus. Cell. 1990;60:509-520[CrossRef][Medline] [Order article via Infotrieve]. 2. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns GA. Homozygous deletion in Wilms tumours of a zinc-finger gene identified by chromosome jumping. Nature. 1990;343:774-778[CrossRef][Medline] [Order article via Infotrieve]. 3. Coppes MJ, Campbell CE, Williams BR. The role of WT1 in Wilms tumorigenesis. FASEB J. 1993;7:886-895[Abstract]. 4. Rauscher FJ III. The WT1 Wilms tumor gene product: a developmentally regulated transcription factor in the kidney that functions as a tumor suppressor. FASEB J. 1993;7:896-903[Abstract].
5.
Haber DA, Park S, Maheswaran S, et al.
WT1-mediated growth suppression of Wilms tumor cells expressing a WT1 splicing variant.
Science.
1993;262:2057-2059 6. Algar EM, Kenney MT, Simms LA, Smith SI, Kida Y, Smith PJ. Homozygous intragenic deletion in the WT1 gene in a sporadic Wilms' tumour associated with high levels of expression of a truncated transcript. Hum Mutat. 1995;5:221-227[CrossRef][Medline] [Order article via Infotrieve]. 7. Little M, Wells C. A clinical overview of WT1 gene mutations. Hum Mutat. 1997;9:209-225[CrossRef][Medline] [Order article via Infotrieve]. 8. Menke AL, Van der Eb AJ, Jochemsen AG. The Wilms' tumor 1 gene: oncogene or tumor suppressor gene. Int Rev Cytol. 1998;181:151-212[Medline] [Order article via Infotrieve].
9.
Gashler AL, Bonthron DT, Madden SL, Rauscher FJ III, Collins T, Sukhatme VP.
Human platelet-derived growth factor A chain is transcriptionally repressed by the Wilms tumor suppressor WT1.
Proc Natl Acad Sci U S A.
1992;89:10984-10988
10.
Harrington MA, Konicek B, Song A, Xia XL, Fredericks WJ, Rauscher FJ III.
Inhibition of colony-stimulating factor-1 promoter activity by the product of the Wilms' tumor locus.
J Biol Chem.
1993;268:21271-21275
11.
Drummond IA, Madden SL, Rohwer-Nutter P, Bell GI, Sukhatme VP, Rauscher FJ III.
Repression of the insulin-like growth factor II gene by the Wilms tumor suppressor WT1.
Science.
1992;257:674-678
12.
Werner H, Re GG, Drummond IA, et al.
Increased expression of the insulin-like growth factor I receptor gene, IGF1R, in Wilms tumor is correlated with modulation of IGF1R promoter activity by the WT1 Wilms tumor gene product.
Proc Natl Acad Sci U S A.
1993;90:5828-5832 13. Englert C, Hou X, Maheswaran S, et al. WT1 suppresses synthesis of the epidermal growth factor receptor and induces apoptosis. EMBO J. 1995;14:4662-4675[Medline] [Order article via Infotrieve]. 14. Goodyer P, Dehbi M, Torban E, Bruening W, Pelletier J. Repression of the retinoic acid receptor-alpha gene by the Wilms' tumor suppressor gene product, wt1. Oncogene. 1995;10:1125-1129[Medline] [Order article via Infotrieve].
15.
McCann S, Sullivan J, Guerra J, Arcinas M, Boxer LM.
Repression of the c-myb gene by WT1 protein in T and B cell lines.
J Biol Chem.
1995;270:23785-23789
16.
Hewitt SM, Hamada S, McDonnell TJ, Rauscher FJ III, Saunders GF.
Regulation of the protooncogenes bcl-2 and c-myc by the Wilms' tumor suppressor gene WT1.
Cancer Res.
1995;55:5386-5389 17. Li RS, Law GL, Seifert RA, Romaniuk PJ, Morris DR. Ornithine decarboxylase is a transcriptional target of tumor suppressor WT1. Exp Cell Res. 1999;247:257-266[CrossRef][Medline] [Order article via Infotrieve]. 18. Zhang X, Xing G, Saunders GF. Proto-oncogene N-myc promoter is down regulated by the Wilms' tumor suppressor gene WT1. Anticancer Res. 1999;19:1641-1648[Medline] [Order article via Infotrieve].
19.
Guan LS, Rauchman M, Wang ZY.
Induction of Rb-associated protein (RbAp46) by Wilms' tumor suppressor WT1 mediates growth inhibition.
J Biol Chem.
1998;273:27047-27050
20.
Kim J, Prawitt D, Bardeesy N, et al.
The Wilms' tumor suppressor gene (wt1) product regulates Dax-1 gene expression during gonadal differentiation.
Mol Cell Biol.
1999;19:2289-2299 21. Mayo MW, Wang CY, Drouin SS, et al. WT1 modulates apoptosis by transcriptionally upregulating the bcl-2 proto-oncogene. EMBO J. 1999;18:3990-4003[CrossRef][Medline] [Order article via Infotrieve].
22.
Buckler AJ, Pelletier J, Haber DA, Glaser T, Housman DE.
Isolation, characterization, and expression of the murine Wilms' tumor gene (WT1) during kidney development.
Mol Cell Biol.
1991;11:1707-1712 23. Park S, Schalling M, Bernard A, et al. The Wilms tumour gene WT1 is expressed in murine mesoderm-derived tissues and mutated in a human mesothelioma. Nat Genet. 1993;4:415-420[CrossRef][Medline] [Order article via Infotrieve]. 24. Davies R, Moore A, Schedl A, et al. Multiple roles for the Wilms' tumor suppressor, WT1. Cancer Res. 1999;59:1747S-1750Sdiscussion 1751S. 25. Moore AW, McInnes L, Kreidberg J, Hastie ND, Schedl A. YAC complementation shows a requirement for WT1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 1999;126:1845-1857[Abstract]. 26. Miwa H, Beran M, Saunders GF. Expression of the Wilms' tumor gene (WT1) in human leukemias. Leukemia. 1992;6:405-409[Medline] [Order article via Infotrieve]. 27. Miyagi T, Ahuja H, Kubota T, Kubonishi I, Koeffler HP, Miyoshi I. Expression of the candidate Wilm's tumor gene, WT1, in human leukemia cells. Leukemia. 1993;7:970-977[Medline] [Order article via Infotrieve].
28.
Inoue K, Sugiyama H, Ogawa H, et al.
WT1 as a new prognostic factor and a new marker for the detection of minimal residual disease in acute leukemia.
Blood.
1994;84:3071-3079 29. Brieger J, Weidmann E, Fenchel K, Mitrou PS, Hoelzer D, Bergmann L. The expression of the Wilms' tumor gene in acute myelocytic leukemias as a possible marker for leukemic blast cells. Leukemia. 1994;8:2138-2143[Medline] [Order article via Infotrieve]. 30. Menssen HD, Renkl HJ, Rodeck U, et al. Presence of Wilms' tumor gene (wt1) transcripts and the WT1 nuclear protein in the majority of human acute leukemias. Leukemia. 1995;9:1060-1067[Medline] [Order article via Infotrieve].
31.
Inoue K, Ogawa H, Sonoda Y, et al.
Aberrant overexpression of the Wilms tumor gene (WT1) in human leukemia.
Blood.
1997;89:1405-1412 32. Bruening W, Gros P, Sato T, et al. Analysis of the 11p13 Wilms' tumor suppressor gene (WT1) in ovarian tumors. Cancer Invest. 1993;11:393-399[Medline] [Order article via Infotrieve]. 33. Viel A, Giannini F, Capozzi E, et al. Molecular mechanisms possibly affecting WT1 function in human ovarian tumors. Int J Cancer. 1994;57:515-521[Medline] [Order article via Infotrieve].
34.
Walker C, Rutten F, Yuan X, Pass H, Mew DM, Everitt J.
Wilms' tumor suppressor gene expression in rat and human mesothelioma.
Cancer Res.
1994;54:3101-3106 35. Rodeck U, Bossler A, Kari C, et al. Expression of the wt1 Wilms' tumor gene by normal and malignant human melanocytes. Int J Cancer. 1994;59:78-82[Medline] [Order article via Infotrieve].
36.
Ladanyi M, Gerald W.
Fusion of the EWS and WT1 genes in the desmoplastic small round cell tumor.
Cancer Res.
1994;54:2837-2840 37. Amin KM, Litzky LA, Smythe WR, et al. Wilms' tumor 1 susceptibility (WT1) gene products are selectively expressed in malignant mesothelioma. Am J Pathol. 1995;146:344-356[Abstract]. 38. Langerak AW, Williamson KA, Miyagawa K, Hagemeijer A, Versnel MA, Hastie ND. Expression of the Wilms' tumor gene WT1 in human malignant mesothelioma cell lines and relationship to platelet-derived growth factor A and insulin-like growth factor 2 expression. Genes Chromosomes Cancer. 1995;12:87-96[Medline] [Order article via Infotrieve].
39.
Silberstein GB, Van Horn K, Strickland P, Roberts CT Jr, Daniel CW.
Altered expression of the WT1 Wilms tumor suppressor gene in human breast cancer.
Proc Natl Acad Sci U S A.
1997;94:8132-8137 40. Campbell CE, Kuriyan NP, Rackley RR, et al. Constitutive expression of the Wilms tumor suppressor gene (WT1) in renal cell carcinoma. Int J Cancer. 1998;78:182-188[CrossRef][Medline] [Order article via Infotrieve]. 41. Oji Y, Ogawa H, Tamaki H, et al. Expression of the Wilms' tumor gene WT1 in solid tumors and its involvement in tumor cell growth. Jpn J Cancer Res. 1999;90:194-204[CrossRef][Medline] [Order article via Infotrieve]. 42. Harada Y, Nonomura N, Nishimura K, et al. WT1 gene expression in human testicular germ-cell tumors. Mol Urol. 1999;3:357-364[Medline] [Order article via Infotrieve]. 43. Menssen HD, Bertelmann E, Bartelt S, et al. Wilms' tumor gene (WT1) expression in lung cancer, colon cancer and glioblastoma cell lines compared to freshly isolated tumor specimens. J Cancer Res Clin Oncol. 2000;126:226-232[CrossRef][Medline] [Order article via Infotrieve].
44.
Yamagami T, Sugiyama H, Inoue K, et al.
Growth inhibition of human leukemic cells by WT1 (Wilms tumor gene) antisense oligodeoxynucleotides: implications for the involvement of WT1 in leukemogenesis.
Blood.
1996;87:2878-2884 45. Algar EM, Khromykh T, Smith SI, Blackburn DM, Bryson GJ, Smith PJ. A WT1 antisense oligonucleotide inhibits proliferation and induces apoptosis in myeloid leukaemia cell lines. Oncogene. 1996;12:1005-1014[Medline] [Order article via Infotrieve].
46.
Inoue K, Tamaki H, Ogawa H, et al.
Wilms' tumor gene (WT1) competes with differentiation-inducing signal in hematopoietic progenitor cells.
Blood.
1998;91:2969-2976 47. Tsuboi A, Oka Y, Ogawa H, et al. Constitutive expression of the Wilms' tumor gene WT1 inhibits the differentiation of myeloid progenitor cells but promotes their proliferation in response to granulocyte-colony stimulating factor (G-CSF). Leuk Res. 1999;23:499-505[CrossRef][Medline] [Order article via Infotrieve]. 48. Osaka M, Koami K, Sugiyama T. WT1 contributes to leukemogenesis: expression patterns in 7,12-dimethylbenzanthracene (DMBA)-induced leukemia. Int J Cancer. 1997;72:696-699[CrossRef][Medline] [Order article via Infotrieve]. 49. Oka Y, Elisseeva OA, Tsuboi A, et al. Human cytotoxic T-lymphocyte responses specific for peptides of the wild-type Wilms' tumor gene (WT1) product. Immunogenetics. 2000;51:99-107[CrossRef][Medline] [Order article via Infotrieve].
50.
Gao L, Bellantuono I, Elsasser A, et al.
Selective elimination of leukemic CD34(+) progenitor cells by cytotoxic T lymphocytes specific for WT1.
Blood.
2000;95:2198-2203
51.
Ohminami H, Yasukawa M, Fujita S.
HLA class I-restricted lysis of leukemia cells by a CD8(+) cytotoxic T-lymphocyte clone specific for WT1 peptide.
Blood.
2000;95:286-293
52.
Oka Y, Udaka K, Tsuboi A, et al.
Cancer immunotherapy targeting Wilms' tumor gene WT1 product.
J Immunol.
2000;164:1873-1880
53.
Gaiger A, Reese V, Disis ML, Cheever MA.
Immunity to WT1 in the animal model and in patients with acute myeloid leukemia.
Blood.
2000;96:1480-1489 54. Tsuboi A, Oka Y, Ogawa H, et al. Cytotoxic T-lymphocyte responses elicited to Wilms' tumor gene WT1 product by DNA vaccination. J Clin Immunol. 2000;20:195-202[CrossRef][Medline] [Order article via Infotrieve]. 55. Urban JL, Schreiber H. Tumor antigens. Annu Rev Immunol. 1992;10:617-644[CrossRef][Medline] [Order article via Infotrieve]. 56. Van den Eynde BJ, van der Bruggen P. T cell defined tumor antigens. Curr Opin Immunol. 1997;9:684-693[CrossRef][Medline] [Order article via Infotrieve]. 57. Tamaki H, Ogawa H, Ohyashiki K, et al. The Wilms' tumor gene WT1 is a good marker for diagnosis of disease progression of myelodysplastic syndromes. Leukemia. 1999;13:393-399[CrossRef][Medline] [Order article via Infotrieve].
58.
Zweig MH, Campbell G.
Receiver-operating characteristic (ROC) plots: a fundamental evaluation tool in clinical medicine.
Clin Chem.
1993;39:561-577
59.
Chen YT, Scanlan MJ, Sahin U, et al.
A testicular antigen aberrantly expressed in human cancers detected by autologous antibody screening.
Proc Natl Acad Sci U S A.
1997;94:1914-1918
60.
Jager E, Nagata Y, Gnjatic S, et al.
Monitoring CD8 T cell responses to NY-ESO-1: correlation of humoral and cellular immune responses.
Proc Natl Acad Sci U S A.
2000;97:4760-4765 61. Kappler JW, Roehm N, Marrack P. T cell tolerance by clonal elimination in the thymus. Cell. 1987;49:273-280[CrossRef][Medline] [Order article via Infotrieve]. 62. Webb S, Morris C, Sprent J. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell. 1990;63:1249-1256[CrossRef][Medline] [Order article via Infotrieve]. 63. Burkly LC, Lo D, Kanagawa O, Brinster RL, Flavell RA. T-cell tolerance by clonal anergy in transgenic mice with nonlymphoid expression of MHC class II I-E. Nature. 1989;342:564-566[CrossRef][Medline] [Order article via Infotrieve]. 64. Schonrich G, Kalinke U, Momburg F, et al. Down-regulation of T cell receptors on self-reactive T cells as a novel mechanism for extrathymic tolerance induction. Cell. 1991;65:293-304[CrossRef][Medline] [Order article via Infotrieve]. 65. Mackay CR. Homing of naive, memory and effector lymphocytes. Curr Opin Immunol. 1993;5:423-427[CrossRef][Medline] [Order article via Infotrieve]. 66. Ohashi PS, Oehen S, Buerki K, et al. Ablation of "tolerance" and induction of diabetes by virus infection in viral antigen transgenic mice. Cell. 1991;65:305-317[CrossRef][Medline] [Order article via Infotrieve]. 67. Oldstone MB, Nerenberg M, Southern P, Price J, Lewicki H. Virus infection triggers insulin-dependent diabetes mellitus in a transgenic model: role of anti-self (virus) immune response. Cell. 1991;65:319-331[CrossRef][Medline] [Order article via Infotrieve]. 68. Heath WR, Karamalis F, Donoghue J, Miller JF. Autoimmunity caused by ignorant CD8+ T cells is transient and depends on avidity. J Immunol. 1995;155:2339-2349[Abstract].
69.
Soussi T.
p53 Antibodies in the sera of patients with various types of cancer: a review.
Cancer Res.
2000;60:1777-1788 70. Lubin R, Zalcman G, Bouchet L, et al. Serum p53 antibodies as early markers of lung cancer. Nat Med. 1995;1:701-702[CrossRef][Medline] [Order article via Infotrieve]. 71. Trivers GE, De Benedetti VM, Cawley HL, et al. Anti-p53 antibodies in sera from patients with chronic obstructive pulmonary disease can predate a diagnosis of cancer. Clin Cancer Res. 1996;2:1767-1775[Abstract].
72.
Disis ML, Pupa SM, Gralow JR, Dittadi R, Menard S, Cheever MA.
High-titer HER-2/neu protein-specific antibody can be detected in patients with early-stage breast cancer.
J Clin Oncol.
1997;15:3363-3367
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  T. Osada, C. Y. Woo, M. McKinney, X. Y. Yang, G. Lei, H. G. LaBreche, Z. C. Hartman, D. Niedzwiecki, N. Chao, A. Amalfitano, et al. Induction of Wilms' Tumor Protein (WT1)-Specific Antitumor Immunity Using a Truncated WT1-Expressing Adenovirus Vaccine Clin. Cancer Res., April 15, 2009; 15(8): 2789 - 2796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Greiner, L. Bullinger, B.-a. Guinn, H. Dohner, and M. Schmitt Leukemia-Associated Antigens Are Critical for the Proliferation of Acute Myeloid Leukemia Cells Clin. Cancer Res., November 15, 2008; 14(22): 7161 - 7166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Chaise, S. L. Buchan, J. Rice, J. Marquet, H. Rouard, M. Kuentz, G. E. Vittes, V. Molinier-Frenkel, J.-P. Farcet, H. J. Stauss, et al. DNA vaccination induces WT1-specific T-cell responses with potential clinical relevance Blood, October 1, 2008; 112(7): 2956 - 2964. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Friedrichs, S. Siegel, M. Kloess, A. Barsoum, J. Coggin Jr., J. Rohrer, I. Jakob, M. Tiemann, K. Heidorn, C. Schulte, et al. Humoral Immune Responses against the Immature Laminin Receptor Protein Show Prognostic Significance in Patients with Chronic Lymphocytic Leukemia J. Immunol., May 1, 2008; 180(9): 6374 - 6384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Asemissen, U. Keilholz, S. Tenzer, M. Muller, S. Walter, S. Stevanovic, H. Schild, A. Letsch, E. Thiel, H.-G. Rammensee, et al. Identification of a Highly Immunogenic HLA-A*01-Binding T Cell Epitope of WT1 Clin. Cancer Res., December 15, 2006; 12(24): 7476 - 7482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Doubrovina, M. M. Doubrovin, S. Lee, J.-H. Shieh, G. Heller, E. Pamer, and R. J. O'Reilly In vitro Stimulation with WT1 Peptide-Loaded Epstein-Barr Virus-Positive B Cells Elicits High Frequencies of WT1 Peptide-Specific T Cells with In vitro and In vivo Tumoricidal Activity Clin. Cancer Res., November 1, 2004; 10(21): 7207 - 7219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Oka, A. Tsuboi, T. Taguchi, T. Osaki, T. Kyo, H. Nakajima, O. A. Elisseeva, Y. Oji, M. Kawakami, K. Ikegame, et al. Induction of WT1 (Wilms' tumor gene)-specific cytotoxic T lymphocytes by WT1 peptide vaccine and the resultant cancer regression PNAS, September 21, 2004; 101(38): 13885 - 13890. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bellucci, C. J. Wu, S. Chiaretti, E. Weller, F. E. Davies, E. P. Alyea, G. Dranoff, K. C. Anderson, N. C. Munshi, and J. Ritz Complete response to donor lymphocyte infusion in multiple myeloma is associated with antibody responses to highly expressed antigens Blood, January 15, 2004; 103(2): 656 - 663. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Rezvani, M. Grube, J. M. Brenchley, G. Sconocchia, H. Fujiwara, D. A. Price, E. Gostick, K. Yamada, J. Melenhorst, R. Childs, et al. Functional leukemia-associated antigen-specific memory CD8+ T cells exist in healthy individuals and in patients with chronic myelogenous leukemia before and after stem cell transplantation Blood, October 15, 2003; 102(8): 2892 - 2900. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Cilloni, E. Gottardi, F. Messa, M. Fava, P. Scaravaglio, M. Bertini, M. Girotto, C. Marinone, D. Ferrero, A. Gallamini, et al. Significant Correlation Between the Degree of WT1 Expression and the International Prognostic Scoring System Score in Patients With Myelodysplastic Syndromes J. Clin. Oncol., May 15, 2003; 21(10): 1988 - 1995. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
chain,
20°C until use.
-D-thiogalactoside to induce the truncated WT1
protein. Bacteria were harvested by centrifugation for 10 minutes at
6000g, resuspended in 4 mL (for 200 mL culture) buffer A
(100 mM NaH2PO4; 10 mM Tris-HCl, pH 8.0) and
stored at 
of patient serum containing a high titer
of IgG WT1 antibodies and of anti-WT1 polyclonal antibody WT180
