|
|||||||||
|
|
|
|
|
|
|
|
|
|
|
NEOPLASIA
From the Section of Gene Function and Regulation,
Institute of Cancer Research, Chester Beatty Laboratories, London,
United Kingdom.
Transcription factor GATA-2 is implicated in the survival and
growth of multipotential progenitors. Here we report that the promyelocytic leukemia zinc finger (PLZF) protein can interact with
GATA-2 and can modify its transactivation capacity. Fanconi anemia zinc
finger (FAZF), a PLZF-homologous protein that has been variously
described as ROG (repressor of GATA), and TZFP (testis zinc finger
protein) also interact with GATA-2. The zinc finger region of GATA-2 is
required for binding to PLZF and FAZF, but distinct interfaces on the
PLZF and FAZF molecules mediate the interaction, suggesting that GATA-2
activity is controlled by these 2 homologous proteins through distinct
mechanisms. GATA-2 can also physically associate with the PLZF-RAR GATA factors comprise a family of transcriptional
regulatory proteins characterized by the ability to bind a common
conserved DNA sequence (WGATAR) by virtue of evolutionarily
conserved C4 zinc finger domains. Hematopoietically expressed GATA
factors (GATA-1, -2, and -3) have been shown to play critical, but
distinct, roles in hematopoiesis.1,2 Thus, GATA-1 is
expressed at a high level in erythroid cells, mast cells,
megakaryocytes, and eosinophils and at a low level in multipotential
progenitors. GATA-1 is functionally implicated in the maturation and
differentiation of erythroid cells and megakaryocytes. GATA-3
expression within hematopoiesis is confined to T lymphocytes and is
implicated in T-cell development and differentiation. GATA-2 is more
broadly expressed among hematopoietic cells, with particular prominence in early progenitors and in megakaryocytes and mast cells. Phenotypes of knock-out mice suggest that GATA-2 may be critically involved in the
survival and growth of multipotential progenitors.3 Forced
expression studies on factor-dependent cell lines and primary cells are
also consistent with an involvement of GATA-2 in these processes.4-6 GATA-2 has thus emerged as a key
transcription factor in the control of cell fate outcomes of
hematopoietic stem and progenitor cells.
A number of critical hematopoietic regulators, such as SCL/Tal-1, Lmo2,
and AML-1, have been implicated in leukemogenic
pathways.7,8 GATA-2 is often expressed in leukemia cells
and cell lines,9,10 but evidence linking GATA-2 with
leukemic transformation has generally been lacking. Recently, we have
provided evidence that promyelocytic leukemia protein (PML) has the
capacity to physically associate with GATA-2 and to modify its
function.11 PML was initially identified as a fusion
counterpart of retinoic acid receptor alpha (RAR Here we present evidence that GATA-2 has the capacity to physically
associate with PLZF. PLZF has a pox virus and zinc finger (POZ) domain
and 9 homologous C2H4 zinc fingers that mediate binding to the
GTACT-AGTAC motif in DNA.15 Functions of the wild-type PLZF protein are not fully understood, though it has been implicated in
apoptosis, growth suppression, differentiation,16,17 and transcriptional repression.18-21 A PLZF homologous protein
has been described and initially termed FAZF-1 by virtue of its
interaction with Fanconi anemia-related proteins.22 This
PLZF homologue has also been described as repressor of
GATA23 (ROG), reflecting its repressive interaction with
GATA-3 in T cells, and as testis zinc finger protein
(TZFP).24,25 In this report we have explored the
possibility that GATA-2 might interact with PLZF, FAZF, or PLZF-RAR Expression plasmids
Cells
Antibodies Mouse monoclonal anti-PLZF antibody was a generous gift from A. Zelent. Anti-Flag antibody M2, biotinylated M2, streptavidin-agarose beads, and protein G-agarose beads were purchased from Sigma (St Louis, MO). Anti-GATA-2 polyclonal antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).Protein interaction assays in cells Using a standard calcium phosphate coprecipitation method, 293T cells (1 × 106) grown in 10-cm diameter dishes were transfected with the indicated expression plasmids. The total amount of plasmids was equalized by the addition of corresponding empty vectors. Forty-eight hours later, nuclear extracts were prepared as described elsewhere27 and were immunoprecipitated with biotinylated anti-Flag antibody M2 in combination with streptavidin-agarose beads or anti-PLZF antibody in combination with protein G-agarose beads in the binding buffer (20 mM HEPES KCl, pH 7.9, 140 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5 mg bovine serum albumin/mL, 5% protease inhibitor cocktail [Sigma], and 0.1% NP-40). After 5 washes with the binding buffer, immune complexes were analyzed by Western blotting using the indicated antibodies.DNA binding assays Nuclear extracts from the 293T cells transfected with the indicated expression plasmids or KG1 cells were incubated with 40 pmol biotinylated double-strand oligonucleotide probes containing the recognition sites for GATA-2 (TATTTTTATCTGATAGGAAGT) in combination with streptavidin-agarose beads in the binding buffer described above, essentially as described in the literature.28,29 After 5 washes with the binding buffer, proteins captured by the probe were analyzed by Western blotting using the indicated antibodies. Biotinylated double-strand oligonucleotide probe mutated in a core recognition sequence from GATA to TTTA was used as a control.Protein interaction assays in solution Fragments of cDNA encoding GATA-2 and PLZF were produced using convenient restriction enzymes and polymerase chain reaction methods and then were cloned into the glutathione S-transferase (GST) fusion vector pGEX5x-1 (Pharmacia, Uppsala, Sweden). Bacterially expressed GST fusion proteins were purified according to the manufacturer's instructions. Nuclear extracts of 293T cells transfected with an expression plasmid for Flag-GATA-2 or Flag-PLZF were incubated with the indicated GST fusion proteins bound to the resin in the binding buffer (50 mM Tris HCl, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 5 mg bovine serum albumin/mL, 5% protease inhibitor cocktail, and 0.1% NP-40) as described previously.11 The resin was washed 5 times with the binding buffer, and the bound protein was analyzed by Western blotting with anti-Flag antibody M2.Transactivation assays A luciferase reporter plasmid in which 2 copies of back-to-back double GATA sites in the mouse CD34 promoter were placed upstream of the -globin minimal promoter-driving luciferase gene (designated CD34 × 2/Luc) has been described.11 A luciferase
reporter plasmid in which a murine GATA-1 promoter (positions  798 to
574) containing a double GATA site30 was arrayed
upstream of the -globin minimal promoter (designated GATA-1/Luc) was
a gift from M. Yamamoto (Tsukuba University, Tsukuba, Japan).
Mutant reporters in which core recognition sequences were changed from
GATA to TTTA (designated mutant CD34 × 2/Luc and mutant GATA-1/Luc)
were described previously.11 Luciferase reporter assays
were conducted as described11 with pRL-CMV-renilla
luciferase plasmids (Promega) monitoring transfection efficiencies.
ATRA (Sigma) or trichostatin A (TSA; Sigma) was added to the culture
medium 24 hours after transfection where indicated, and luciferase
activities were measured after another 24 hours. Relative luciferase
activities reflect duplicate values from a representation of no fewer
than 2 independent experiments.
Interaction of GATA-2 and PLZF To examine whether GATA-2 could interact with PLZF in living cells, we conducted co-immunoprecipitation experiments using the 293T transient transfection system. 293T cells were cotransfected with expression plasmids for PLZF and Flag-tagged GATA-2 or an empty vector. Two days after transfection, nuclear extracts were prepared and subjected to immunoprecipitation using anti-Flag antibody. Immunoprecipitated materials were fractionated by polyacrylamide gel electrophoresis and subsequently analyzed by Western blotting using an anti-PLZF or anti-Flag antibody (Figure 1A). Results show that PLZF coprecipitated with GATA-2 in this system, suggesting that these 2 proteins can complex in vivo.
We next asked whether GATA-2 could complex with PLZF in hematopoietic cells. For these experiments we made use of the human leukemia cell line KG1, which is thought to represent the lymphomyeloid stem cell compartment and which expresses PLZF31 and GATA-2.10 KG1 nuclear extracts were immunoprecipitated using an anti-PLZF antibody, and the immunoprecipitated materials were analyzed by Western blotting with anti-PLZF or anti-GATA-2 antibodies. Results shown in Figure 1B reveal that within native hematopoietic cells, the endogenous GATA-2 and PLZF proteins can complex together. We next tested whether GATA-2 could recruit PLZF to a GATA recognition sequence in DNA in hematopoietic cells (Figure 1C). KG1 cell nuclear extract was incubated with a biotinylated double-strand DNA oligonucleotide containing a GATA recognition motif, and then the oligonucleotide was captured using streptavidin-agarose beads. The proteins, which coprecipitated with the oligonucleotide, were analyzed by Western blotting using anti-GATA-2 and anti-PLZF antibodies. Results showed that the oligonucleotides that contained GATA motifs captured GATA-2 in the nuclear extracts and that PLZF was also contained in the DNA-protein complex. In control experiments, biotinylated mutant oligonucleotides in which GATA motifs were mutated to TTTA captured neither GATA-2 nor PLZF, indicating that the capture of PLZF by these oligonucleotides was stringently GATA site-dependent. PLZF inhibits transactivation capacity of GATA-2 We next asked whether the association of PLZF with GATA-2 had any functional consequences for GATA-2 activity. Because PLZF has been shown to complex with corepressors of transcription (such as mSin3A and HDAC1),18-21,32,33 we examined the effects of PLZF on the ability of GATA-2 to potentiate the transcriptional activity of a GATA-dependent luciferase reporter. Two copies of the back-to-back double GATA motifs in the mouse CD34 promoter have been successfully used as a reporter of GATA-2 activity when arrayed upstream of-globin minimal promoter driving
luciferase.11 Although PLZF somewhat inhibited activity
from this reporter in 293T cells, even in the absence of GATA-2
expression, the inhibitory effects of PLZF on this reporter were
considerably more evident on GATA-2-dependent activity from the
reporter than on its GATA-2-independent basal activity (Figure
2). These results, coupled with the
observation that endogenous GATA-2 can recruit endogenous PLZF to a
GATA motif in DNA, suggest that PLZF may function as a negative
regulator for GATA-2, inhibiting its transactivation capacity.
Mapping the sites of interaction between GATA-2 and PLZF We next determined the region in GATA-2 that was required for its interaction with PLZF using GST pull-down experiments. Various portions of GATA-2 were fused to GST, produced in bacteria, and tested for binding to Flag-tagged PLZF expressed in 293T cells (Figure 3A). Zinc fingers of GATA-2 were found to bind PLZF, with either N- or C-finger alone sufficient to retain PLZF. The amino-terminal portion (aa 1 to 193) did not display any affinity for PLZF. Preparations of the most carboxyl portion of GATA-2 (aa 390-475) fused to GST were consistently highly degraded and thus unsuitable for analysis in this assay (data not shown).11
Similar pull-down experiments were conducted to determine the region within PLZF involved in binding to GATA-2 (Figure 3B). These experiments showed that POZ domain or zinc finger domain alone was sufficient to retain GATA-2. We conclude that the interaction of GATA-2 and PLZF involves the zinc finger regions of GATA-2 and POZ domain and zinc finger domains of PLZF. Interaction of GATA-2 and FAZF FAZF displays a strong homology to the PLZF protein in the DNA-binding zinc finger region22 and has a POZ domain and 3 zinc fingers, and it is identical to the recently identified molecule, ROG.23 The amino acid sequence of FAZF is 36% and 71% homologous to POZ and to the last 3 zinc fingers (fingers 7-9), respectively, of PLZF (Figure 4A). The zinc finger domain of FAZF has been shown to have an ability to bind GATA-3.23 We therefore tested the binding activity of FAZF and its zinc finger domain to GATA-2 by co-immunoprecipitation experiments using the 293T transient transfection system (Figure 4B). Results showed that FAZF, like PLZF, has an ability to bind GATA-2 and that the interaction was mediated through the zinc fingers of FAZF. Although the last 3 zinc fingers (fingers 7-9) of PLZF are highly homologous to the zinc fingers of FAZF, the terminal zinc fingers 7-9 of PLZF did not bind GATA-2 (Figure 4B). Thus it appears that though PLZF and FAZF can bind GATA-2 by its zinc fingers, they do so through different regions on the PLZF-FAZF moieties. These results suggest that GATA-2 activity is regulated by these 2 homologous proteins through distinct interaction mechanisms.
Interaction of GATA-2 and PLZF-RAR 
chimera,14 raising the possibility that PLZF-RAR may
have the potential to associate with GATA-2; GATA-2 is the predominant
GATA factor expressed in early myeloid progenitor
cells9,10,34 that represent the cellular target for
transformation in APL.
We examined this possibility by co-immunoprecipitation experiments
using 293T cells transfected with expression plasmids for Flag-GATA-2
and PLZF-RAR
Importantly, PLZF-RAR We next conducted reporter-based transactivation analysis in 293T cells
to examine whether the expression of PLZF-RAR
In this report, we have presented evidence that transcription factor GATA-2 can physically associate with PLZF in vitro and in hematopoietic cells in vivo. This interaction resulted in decreased functional activity of GATA-2, as judged by transactivation assays. The mechanisms whereby PLZF modulates GATA factor-dependent transactivation are, however, unclear from the current study. PLZF has been shown to complex with transcriptional corepressors, including N-CoR (nuclear corepressor) and HDAC1 (histone deacetylase 1).18-21,32,33 Our experiments (Figure 1C) showed that PLZF could associate with GATA-2 bound to a GATA motif in DNA, indicating that GATA-2 could fall under the control of PLZF together with its attendant corepressors. Experiments directed at mapping the region of GATA-2 involved in its interaction with PLZF identified the zinc finger region of GATA-2 as playing a critical role. Reciprocal mapping experiments performed with PLZF identified the POZ domain and the zinc fingers of PLZF as critical determinants for its interaction with GATA-2. The zinc finger region of the GATA factors, in addition to its role in DNA binding, has been implicated as a protein-protein interaction domain. GATA factors have been shown to associate with other regulatory proteins (such as Sp1,35 Lmo2,36 CBP,37 other GATAs,38 and PML 11) by virtue of their C4C4 zinc finger regions. Because the zinc finger region has been highly evolutionarily conserved throughout the GATA family,39 it is not surprising that GATA-1 and GATA-3 also have the potential to bind PLZF (data not shown), though PLZF expression within the hematopoietic system is largely confined to immature cells,14,40 in which GATA-2 is thought to be the predominant GATA factor.10,34 Recently ROG was identified as a binding partner of GATA-3.23 ROG has a POZ domain and 3 zinc fingers, and it inhibits GATA-3 activity. ROG is identical to FAZF22 and TZFP.24,25 The zinc fingers of FAZF have been identified as critical for its interaction with GATA-3. In line with this, we presented evidence that FAZF could associate with GATA-2 through the zinc fingers of FAZF (Figure 4B). Although the zinc fingers of FAZF were highly homologous to the last 3 zinc fingers (fingers 7-9) of PLZF (71% at the amino acid level), zinc fingers 7 to 9 of PLZF did not retain the capacity to bind GATA-2 (Figure 4A-B). Interestingly, Guidez et al41 have reported that key lysines in the last 3 zinc fingers of PLZF can be acetylated and that this acetylation alters the functional properties of PLZF.41 These residues are not present in the terminal zinc fingers of FAFZ, and this may provide a mechanistic explanation for the differences in binding activities observed. Nevertheless, taken together, our findings suggest that GATA-2 activity is controlled by these 2 homologous proteins (PLZF and FAZF) by distinct interaction mechanisms. It is interesting to speculate on what the biologic consequences of the interaction of GATA-2 with PLZF and FAZF might be. GATA-2 has been implicated in the growth and survival of hematopoietic progenitor cells. Knockout experiments support GATA-2 functioning as a positive regulator of these processes.3 Forced-expression experiments have revealed positive and negative effects on progenitor cell proliferation and differentiation.4-6 These different results may reflect differences in cell context. They may also, in part, be attributable to the nature of the GATA-2 moieties involved given that some of the studies made use of GATA-2/ER (estrogen receptor) fusion molecules, which may not retain all the properties of the native GATA-2 molecule. PLZF has also been shown to be involved in growth control, by which it functions as a negative regulator of the cell cycle.16,17 PLZF knockout has apparently normal hematopoiesis, though the cycling activity of blood progenitors has not to our knowledge been closely examined.42 FAZF is also expressed within hematopoietic progenitors (A. Zelent, unpublished observations, January 1998) and has been shown to be a negative regulator of GATA-3 activity in T cells.23 Its function within hematopoietic progenitors is not as yet understood. Although it is difficult at this stage to speculate on the biologic consequences of the association of GATA-2 with PLZF or FAZF, it seems likely that PLZF and FAZF will function to repress GATA-2 activity. The observation that PLZF and FAZF use distinct regions to interact with GATA-2 raises the possibility that their interactions may be differentially regulated, providing additional points for control. Expectations as to whether the repressive effects of PLZF or FAZF on GATA-2 will manifest as pro- or antiproliferative signals depends on one's view of GATA-2 activities on these processes. In truth, thinking of GATA-2 simply as a pro- or antiproliferative activity is probably inadequate. The function of any given transcription factor is the sum of the activity of the entire network of genes whose activity it is involved in regulating in that particular cell context or cell state. Similarly, depending on the local transcriptional context, individual factors may function positively or negatively with respect to the transcription of particular genes. The interaction of PLZF-RAR
We thank A. Zelent for useful suggestions and Janine Harris for secretarial assistance.
Submitted August 16, 2001; accepted December 27, 2001.
The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked "advertisement" in accordance with 18 U.S.C. section 1734.
Reprints: Tariq Enver, Section of Gene Function and Regulation, Institute of Cancer Research, Chester Beatty Laboratories, 237 Fulham Rd, London SW3 6JB, United Kingdom; e-mail: tariq{at}icr.ac.uk.
1.
Orkin SH.
GATA-binding transcription factors in hematopoietic cells.
Blood.
1992;80:575-581
2.
Shivdasani RA, Orkin SH.
The transcriptional control of hematopoiesis.
Blood.
1996;87:4025-4039 3. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371:221-226[CrossRef][Medline] [Order article via Infotrieve].
4.
Briegel K, Lim KC, Plank C, Beug H, Engel JD, Zenke M.
Ectopic expression of a conditional GATA-2/estrogen receptor chimera arrests erythroid differentiation in a hormone-dependent manner.
Genes Dev.
1993;7:1097-1109
5.
Heyworth C, Gale K, Dexter M, May G, Enver T.
A GATA-2/estrogen receptor chimera functions as a ligand-dependent negative regulator of self-renewal.
Genes Dev.
1999;13:1847-1860
6.
Persons DA, Allay JA, Allay ER, et al.
Enforced expression of the GATA-2 transcription factor blocks normal hematopoiesis.
Blood.
1999;93:488-499 7. Lutterbach B, Hiebert SW. Role of the transcription factor AML-1 in acute leukemia and hematopoietic differentiation. Gene. 2000;245:223-235[CrossRef][Medline] [Order article via Infotrieve].
8.
Begley CG, Green AR.
The SCL gene: from case report to critical hematopoietic regulator.
Blood.
1999;93:2760-2770 9. Minegishi N, Morita S, Minegishi M, et al. Expression of GATA transcription factors in myelogenous and lymphoblastic leukemia cells. Int J Hematol. 1997;65:239-249[CrossRef][Medline] [Order article via Infotrieve].
10.
Nagai T, Harigae H, Ishihara H, et al.
Transcription factor GATA-2 is expressed in erythroid, early myeloid, and CD34+ human leukemia-derived cell lines.
Blood.
1994;84:1074-1084
11.
Tsuzuki S, Towatari M, Saito H, Enver T.
Potentiation of GATA-2 activity through interactions with the promyelocytic leukemia protein (PML) and the t(15;17)-generated PML-retinoic acid receptor alpha oncoprotein.
Mol Cell Biol.
2000;20:6276-6286 12. de The H, Lavau C, Marchio A, Chomienne C, Degos L, Dejean A. The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR. Cell. 1991;66:675-684[CrossRef][Medline] [Order article via Infotrieve]. 13. Kakizuka A, Miller WH Jr, Umesono K, et al. Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell. 1991;66:663-674[CrossRef][Medline] [Order article via Infotrieve]. 14. Chen Z, Brand NJ, Chen A, et al. Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia. EMBO J. 1993;12:1161-1167[Medline] [Order article via Infotrieve]. 15. Sitterlin D, Tiollais P, Transy C. The RAR alpha-PLZF chimera associated with acute promyelocytic leukemia has retained a sequence-specific DNA-binding domain. Oncogene. 1997;14:1067-1074[CrossRef][Medline] [Order article via Infotrieve].
16.
Shaknovich R, Yeyati PL, Ivins S, et al.
The promyelocytic leukemia zinc finger protein affects myeloid cell growth, differentiation, and apoptosis.
Mol Cell Biol.
1998;18:5533-5545 17. Yeyati PL, Shaknovich R, Boterashvili S, et al. Leukemia translocation protein PLZF inhibits cell growth and expression of cyclin A. Oncogene. 1999;18:925-934[CrossRef][Medline] [Order article via Infotrieve].
18.
Hong SH, David G, Wong CW, Dejean A, Privalsky ML.
SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha (RAR
19.
Guidez F, Ivins S, Zhu J, Soderstrom M, Waxman S, Zelent A.
Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to PML- and PLZF-RAR 20. Lin RJ, Nagy L, Inoue S, Shao W, Miller WH Jr, Evans RM. Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature. 1998;391:811-814[CrossRef][Medline] [Order article via Infotrieve]. 21. Grignani F, De Matteis S, Nervi C, et al. Fusion proteins of the retinoic acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia. Nature. 1998;391:815-818[CrossRef][Medline] [Order article via Infotrieve].
22.
Hoatlin ME, Zhi Y, Ball H, et al.
A novel BTB/POZ transcriptional repressor protein interacts with the Fanconi anemia group C protein and PLZF.
Blood.
1999;94:3737-3747 23. Miaw SC, Choi A, Yu E, Kishikawa H, Ho IC. ROG, repressor of GATA, regulates the expression of cytokine genes. Immunity. 2000;12:323-333[CrossRef][Medline] [Order article via Infotrieve]. 24. Lin W, Lai CH, Tang CJ, Huang CJ, Tang TK. Identification and gene structure of a novel human PLZF-related transcription factor gene, TZFP. Biochem Biophys Res Commun. 1999;264:789-795[CrossRef][Medline] [Order article via Infotrieve].
25.
Tang CJ, Chuang CK, Hu HM, Tang TK.
The zinc finger domain of Tzfp binds to the tbs motif located at the upstream flanking region of the Aie1 (aurora-C) kinase gene.
J Biol Chem.
2001;276:19631-19639
26.
Dorfman DM, Wilson DB, Bruns GA, Orkin SH.
Human transcription factor GATA-2: evidence for regulation of preproendothelin-1 gene expression in endothelial cells.
J Biol Chem.
1992;267:1279-1285
27.
Dignam JD, Lebovitz RM, Roeder RG.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
1983;11:1475-1489
28.
Igarashi K, Hoshino H, Muto A, et al.
Multivalent DNA binding complex generated by small Maf and Bach1 as a possible biochemical basis for beta-globin locus control region complex.
J Biol Chem.
1998;273:11783-11790
29.
Liu Y, Asch H, Kulesz-Martin MF.
Functional quantification of DNA-binding proteins p53 and estrogen receptor in cells and tumor tissues by DNA affinity immunoblotting.
Cancer Res.
2001;61:5402-5406
30.
Tsai SF, Strauss E, Orkin SH.
Functional analysis and in vivo footprinting implicate the erythroid transcription factor GATA-1 as a positive regulator of its own promoter.
Genes Dev.
1991;5:919-931 31. Ruthardt M, Orleth A, Tomassoni L, et al. The acute promyelocytic leukaemia specific PML and PLZF proteins localize to adjacent and functionally distinct nuclear bodies. Oncogene. 1998;16:1945-1953[CrossRef][Medline] [Order article via Infotrieve]. 32. He LZ, Guidez F, Tribioli C, et al. Distinct interactions of PML-RARalpha and PLZF-RARalpha with co-repressors determine differential responses to RA in APL. Nat Genet. 1998;18:126-135[CrossRef][Medline] [Order article via Infotrieve]. 33. David G, Alland L, Hong SH, Wong CW, DePinho RA, Dejean A. Histone deacetylase associated with mSin3A mediates repression by the acute promyelocytic leukemia-associated PLZF protein. Oncogene. 1998;16:2549-2556[CrossRef][Medline] [Order article via Infotrieve].
34.
Mouthon MA, Bernard O, Mitjavila MT, Romeo PH, Vainchenker W, Mathieu-Mahul D.
Expression of tal-1 and GATA-binding proteins during human hematopoiesis.
Blood.
1993;81:647-655 35. Merika M, Orkin SH. Functional synergy and physical interactions of the erythroid transcription factor GATA-1 with the Kruppel family proteins Sp1 and EKLF. Mol Cell Biol. 1995;15:2437-2447[Abstract].
36.
Osada H, Grutz G, Axelson H, Forster A, Rabbitts TH.
Association of erythroid transcription factors: complexes involving the LIM protein RBTN2 and the zinc-finger protein GATA1.
Proc Natl Acad Sci U S A.
1995;92:9585-9589
37.
Blobel GA, Nakajima T, Eckner R, Montminy M, Orkin SH.
CREB-binding protein cooperates with transcription factor GATA-1 and is required for erythroid differentiation.
Proc Natl Acad Sci U S A.
1998;95:2061-2066 38. Crossley M, Merika M, Orkin SH. Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains. Mol Cell Biol. 1995;15:2448-2456[Abstract].
39.
Zon LI, Mather C, Burgess S, Bolce ME, Harland RM, Orkin SH.
Expression of GATA-binding proteins during embryonic development in Xenopus laevis.
Proc Natl Acad Sci U S A.
1991;88:10642-10646
40.
Reid A, Gould A, Brand N, et al.
Leukemia translocation gene, PLZF, is expressed with a speckled nuclear pattern in early hematopoietic progenitors.
Blood.
1995;86:4544-4552 41. Guidez F, Ivins S, Owen G, Hawe N, Zelent A. Acetylation and deacetylation of the promyelocytic leukemia zinc finger protein (PLZF) regulate its ability to function as a transcriptional repressor [abstract]. Blood. 2000;96:453. 42. Barna M, Hawe N, Niswander L, Pandolfi PP. Plzf regulates limb and axial skeletal patterning. Nat Genet. 2000;25:166-172[CrossRef][Medline] [Order article via Infotrieve].
43.
Melnick A, Licht JD.
Deconstructing a disease: RAR
© 2002 by The American Society of Hematology.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
 |
|
  K. Kitajima, M. Tanaka, J. Zheng, H. Yen, A. Sato, D. Sugiyama, H. Umehara, E. Sakai, and T. Nakano Redirecting differentiation of hematopoietic progenitors by a transcription factor, GATA-2 Blood, March 1, 2006; 107(5): 1857 - 1863. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Piazza, J. A. Costoya, T. Merghoub, R. M. Hobbs, and P. P. Pandolfi Disruption of PLZP in Mice Leads to Increased T-Lymphocyte Proliferation, Cytokine Production, and Altered Hematopoietic Stem Cell Homeostasis Mol. Cell. Biol., December 1, 2004; 24(23): 10456 - 10469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tsuzuki, K. Kitajima, T. Nakano, A. Glasow, A. Zelent, and T. Enver Cross Talk between Retinoic Acid Signaling and Transcription Factor GATA-2 Mol. Cell. Biol., August 1, 2004; 24(15): 6824 - 6836. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|||||||
 |
 |
 |
 |
 |
 |
 |
 |
||
| Copyright © 2002 by American Society of Hematology Online ISSN: 1528-0020 | |||||||||
Top
Abstract
Introduction
