Blood, 1 May 2002, Vol. 99, No. 9, pp. 3465-3467
BRIEF REPORT
Transient response to imatinib mesylate (STI571) in a
patient with the ETV6-ABL t(9;12) translocation
Stephen G. O'Brien,
Sara
A. D. Vieira,
Samantha Connors,
Nick Bown,
James Chang,
Renaud Capdeville, and
Junia V. Melo
From the School of Clinical and Laboratory Sciences and
the School of Biochemistry and Genetics, University of Newcastle; the
Department of Haematology, Imperial College of Science, Technology and
Medicine, Hammersmith Hospital, London; the Department of Haematology,
Christie Hospital and Holt Radium Institute, Manchester, United
Kingdom; and Novartis Pharma AG, Basel, Switzerland.
 |
Abstract |
We report the transient response of a patient with the
ETV6-ABL fusion gene to imatinib mesylate (STI571). A
38-year-old man was referred with an erroneous diagnosis of
Philadelphia-positive chronic myeloid leukemia in blastic
transformation for treatment with the ABL tyrosine kinase
inhibitor, STI571. Further investigation indicated that the patient in
fact had acute myeloid leukemia; no evidence of the Philadelphia
translocation or BCR-ABL was found using
fluorescence in situ hybridization (FISH) or reverse
transcription-polymerase chain reaction. Detailed FISH analysis
identified a cryptic t(9;12) translocation, and molecular studies
confirmed the presence of the ETV6-ABL fusion transcript.
Because the patient was gravely ill at presentation, treatment was
commenced immediately with STI571 monotherapy, resulting in
considerable initial improvement. However within 10 days the patient's
condition again deteriorated, and he required conventional
chemotherapy. This case has implications for the design of future
studies using STI571 in leukemias involving ABL-encoded
fusion proteins other than BCR-ABL.
(Blood. 2002;99:3465-3467)
© 2002 by The American Society of Hematology.
| |
Introduction |
ETV6-ABL (also known as
TEL-ABL) is a rare translocation previously reported in only
5 patients
2 with acute lymphoblastic leukemia,1,2 one
with acute myeloid leukemia,3 and 2 with BCR-ABL-negative chronic myeloid leukemia
(CML).2,4 This abnormality is rarely visible
cytogenetically, and it is also rare to detect occult ETV6-ABL
translocations using fluorescence in situ hybridization (FISH) and
reverse transcription-polymerase chain reaction
(RT-PCR).1,5 In vitro studies have shown that ETV6 dysregulates the tyrosine kinase activity of
ABL by inducing oligomerization of ETV6-ABL
protein molecules through its pointed amino-terminal domain, in a
process similar to that involving the BCR dimerization
domain.3,6 At least some of the signal transduction
pathways activated by the ETV6-ABL protein are similar to
those activated by p210BCR-ABL.7,8 The
functional similarity of the BCR-ABL and ETV6-ABL oncoproteins is further supported by the fact that STI571 can inhibit
the growth of ETV6-ABL-positive cells in
vitro.9
Imatinib mesylate (STI571, Gleevec) is a 2'
phenylaminopyrimidine compound that inhibits the tyrosine kinase
activity of BCR-ABL and ABL and of the
PDGF and KIT receptor tyrosine
kinases.10,11 In vitro studies confirmed its ability to
inhibit the growth of CML cells,12,13 and the
results of phase 1 and 2 studies show STI571 to be a highly
effective agent in Philadelphia (Ph)-positive leukemias with minimal
toxicity.14
| |
Study design |
In February 2000, a 38-year-old man was referred with, in
retrospect, an erroneous diagnosis of Philadelphia-positive CML in
blast transformation for treatment with STI571. His local hematologist examined him in May 1999 for flulike illness and generalized
lymphadenopathy. He had leukocytosis with 10% blasts, and his white
blood cell (WBC) count was initially controlled with intermittent
hydroxyurea. At the time of referral to our center, the patient was
gravely ill with massive generalized lymphadenopathy, 3-cm
splenomegaly, and the following laboratory values: WBC,
77.6 × 109/L with 92% blasts; hemoglobin, 103 g/L;
platelets, 90 × 109/L. Screening investigations,
including bone marrow cytogenetic analysis, were performed. Bone marrow
was hypercellular, and 57% of the cells had the morphologic appearance
of myeloblasts; immunophenotyping was consistent with acute myeloid
leukemia or myeloid blast transformation of CML.
Because the patient was seriously ill, therapy with STI571 at 600 mg
daily by mouth was started immediately. The patient made a considerable
clinical recovery over the next 48 hours, with reduction in
lymphadenopathy, improvement in the WBC, and no tumor lysis syndrome.
At this stage the locally analyzed cytogenetic data and the historic
data from the referring hospital became available. Successive
cytogenetic analyses showed a 46, XY karyotype in May 1999, a 49, XY,+11,+12,+19 karyotype in January 2000, and a 49, XY,
add(9)(q34),+11,+12,+19, der(22)t(1;22)(q21;q11) karyotype in
February 2000. The Philadelphia translocation was not detected, nor was
the BCR-ABL mRNA fusion transcript detected by RT-PCR. FISH studies were then performed to elucidate the nature of the cytogenetic abnormalities.
Cytogenetic data suggested that the ABL gene might be
involved, though not in the context of BCR-ABL. Additional
molecular studies were therefore conducted. Total RNA extraction and
cDNA synthesis with random hexamers were performed as previously
described.15 RT-PCR amplifications of ABL,
ETV6, and ETV6-ABL transcripts were primed with
the following oligonucleotides: NIb+ (ABL sense), 5'-CACGAATTCTGGAAAGGGGTACCTATTA; Jc- (ABL
antisense), 5'-GGAGTGTTTCTCCAGACTGTTG; CA3-(ABL
antisense), 5'-TGTTGACTGGCGTGATGTAGTTGCTTGG; TelE+
(ETV6 sense), 5'- GATGACGTAGCCCAGTGGCTC; TelA+
(ETV6 sense), 5'-TCCGTGGATTTCAAACAGTCCAG; and TelC-
(ETV6 antisense), 5'-GTCAGCTCGGTCAGGCAACCCTA.
Thermocycling conditions were 35 cycles of denaturation at 96°C for
30 seconds, annealing at 60°C for 50 seconds, and extension at 72°C
for 1 minute, followed by a final 10-minute extension at 72°C.
Rapid amplification of cDNA ends (RACE-PCR) was performed on cDNA
primed with the ABL Jc- oligonucleotide using a
5'RACE kit (Gibco-BRL, Paisley, United Kingdom), according to the
manufacturer's protocol. The ABL nested 3' primers
CA3- and A2e- (5'-CGACAAGCTTTAGTTATGCTTAGAGTGTTA) were used for the first- and second-step RACE amplifications, respectively. Final PCR products were cloned into the TOPO-TA vector
(Invitrogen, NV Leek, The Netherlands), and
mini-preparations from selected clones were made. The inserts
were then PCR amplified from the plasmids with M13 standard primers,
resolved on an agarose gel, and blotted onto a nylon membrane.
Hybridization with an ABL oligonucleotide probe (A2+,
5'-TTCAGCGGCCAGTAGCATCTGACTT) internal to the second-step primer
was used to verify positive clones. Sequencing was performed by the
chain-termination method using fluorescence primers.
| |
Results and discussion |
In view of the 9q34 and 22q11 breakpoints, we used
FISH and Vysis BCR-ABL probes to investigate the possibility
of a variant Ph rearrangement. This showed no fusion signalthat is,
no evidence of cryptic Ph rearrangementbut one ABL signal
was split between 9q34 and the short (p) arms of 2 of the 3 copies of chromosome 12 (Figure 1A).
Initial hybridization with an ETV6 probe suggested that it was not involved. When probing for BCR-ABL and
ETV6-AML was carried out in a combined hybridization
procedure, 2 red-green fusion signals were observed on
the short arms of 2 of the 3 copies of chromosome
12, confirming a cryptic translocation between 9q34 and 12p1,
which would be consistent with fusion of the ETV6 and ABL genes. The revised karyotype was therefore 49, XY,+11,
t(9;12)(q34;p1?), +der(12)t(9;12), +19,
der(22)t(1;22)(q21;q11).
View larger version (54K):
[in this window]
[in a new window]
| Figure 1.
Confirmation of ETVG-ABL
t(9;12)translocation.
(A) Cytogenetic and FISH results. (i) Normal chromosome 9 with normal ABL signal (red), (ii) add(9)(q34) with
diminished ABL FISH signal, (iii) normal chromosome (12)
with normal ETV6 signal (green), and (iv, v) 2 copies of
der(12) showing yellow fusion signal in simultaneous
ETV6-ABL FISH. (B) Agarose gel electrophoresis of RT-PCR
products. Lanes: M, molecular weight marker (pEMBL18 digested with
TaqI); 1, ETV6 (TelE+  TelC-); 2, ABL (NIb+ Jc-); 3, ETV6-ABL (TelE+ Jc-); 4, ETV6-ABL (TelA+ CA3-). The larger
and stronger band on lane 3 corresponds to the type B
ETV6-ABL transcript, whereas the smaller and weaker band
represents the type A transcript. The latter can be more clearly
detected with the TelA+ primer, which is closer to the
ETV6 exon 4-ABL exon 2 junction, as shown on
lane 4.
|
|
Initial ETV6-ABL RT-PCR analysis of the random
hexamer-primed cDNA with primers TelE+ and Jc-
was negative. Although a positive ETV6-ABL control was
not available, correct amplification of ABL and
ETV6 transcripts from that cDNA suggested that the absence of ETV6-ABL message was a genuine finding, which was in
agreement with the initial FISH results. However, when the 5'RACE-PCR
method was used to identify the 5'partner of ABL, it was
revealed to be ETV6, as also revealed by the subsequently
modified FISH analysis. Repeat of the initial RT-PCR amplifications
using the ABL primer-specific cDNA template used for RACE
and alternative ETV6 primers confirmed an
ETV6-ABL fusion. The hybrid gene in this case produced 2 alternative transcripts, with the type B (ETV6 exon
5-ABL exon 2 junction) and type A (ETV6 exon
4-ABL exon 2 junction) structures,6
respectively (Figure 1B).
The patient continued to respond to STI571 monotherapy for 10 days
(Figure 2), at which point the WBC count
began to escalate again; conventional chemotherapy with fludarabine,
Ara-C, and G-CSF (FLAG) was instituted; and STI571 therapy was
discontinued. He underwent several additional courses of conventional
chemotherapy but ultimately died of relapsed disease. Although not by
design, our patient appears to be the only known person with the
t(9;12) ETV6-ABL translocation to be treated thus far with
STI571. There was an impressive but transient response to the drug,
suggesting that inhibition of ABL kinase in such patients
may be therapeutically useful but not sufficient to induce remission.
Although the mechanism of resistance in this case is unknown, the
possibility that high-dose STI571 may avert the development of
resistance in such leukemias deserves further
consideration.16
View larger version (27K):
[in this window]
[in a new window]
| Figure 2.
Clinical progress.
Significant resolution of the patient's lymphadenopathy was
seen as the WBC count initially dropped. STI571 was substituted with
FLAG chemotherapy because the WBC count failed to respond, and the
patient's clinical condition deteriorated.
|
|
This case has implications for the design of future studies in
leukemias involving the ABL gene, but not necessarily in the context of BCR-ABL. Furthermore, because STI571 is known to
also inhibit the kinase activity associated with the KIT and
PDGF receptors,10,11 it is possible that
inhibition of these pathways as well as, or instead of, inhibition
of ABL kinase may be therapeutically important.
| |
Acknowledgments |
We thank Michael Deininger (Leipzig, Germany) for help in tracking
down a valuable cDNA sample and Nick Telford (Christie Hospital,
Manchester, United Kingdom) for help with retrospective cytogenetic data.
| |
Footnotes |
Submitted April 18, 2001; accepted December 16, 2001.
Supported by the Tyneside Leukaemia Research Association (S.G.O.),
Novartis Pharma AG (S.G.O.), and Fundação para a Ciencia e
Tecnologia (Praxis XXI BD/15769/98).
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Stephen G. O'Brien, Department of Haematology,
University of Newcastle, Royal Victoria Infirmary, NE1 4LP, United
Kingdom; e-mail: s.g.o'brien{at}ncl.ac.uk
| |
References |
1.
Janssen JW, Ridge SA, Papadopoulos P, et al.
The fusion of TEL and ABL in human acute lymphoblastic leukaemia is a rare event.
Br J Haematol.
1995;90:222-224[Medline]
[Order article via Infotrieve].
2.
van Limbergen H, Beverloo H, van Drunen E, et al.
Molecular cytogenetic and clinical findings in ETV6/ABL1-positive leukemia.
Genes Chromosomes Cancer.
2001;30:274-282[CrossRef][Medline]
[Order article via Infotrieve].
3.
Golub TR, Goga A, Barker GF, et al.
Oligomerization of the ABL tyrosine kinase by the Ets protein TEL in human leukemia.
Mol Cell Biol.
1996;16:4107-4116[Abstract].
4.
Andreasson P, Johansson B, Carlsson M, et al.
BCR/ABL-negative chronic myeloid leukemia with ETV6/ABL fusion.
Genes Chromosomes Cancer.
1997;20:299-304[CrossRef][Medline]
[Order article via Infotrieve].
5.
Nilsson T, Andreasson P, Hoglund M, et al.
ETV6/ABL fusion is rare in Ph-negative chronic myeloid disorders [letter].
Leukemia.
1998;12:1167-1168[CrossRef][Medline]
[Order article via Infotrieve].
6.
Hannemann JR, Healy LE, Ridge SA, Wiedemann LM.
The second ETV6 allele is not necessarily deleted in acute leukemias with an ETV6/ ABL fusion.
Genes Chromosomes Cancer.
1998;21:256-259[CrossRef][Medline]
[Order article via Infotrieve].
7.
Okuda K, Golub TR, Gilliland DG, Griffin JD.
p210BCR/ABL, p190BCR/ABL, and TEL/ABL activate similar signal transduction pathways in hematopoietic cell lines.
Oncogene.
1996;13:1147-1152[Medline]
[Order article via Infotrieve].
8.
Voss J, Posern G, Hannemann JR, et al.
The leukaemic oncoproteins Bcr-Abl and Tel-Abl (ETV6/Abl) have altered substrate preferences and activate similar intracellular signalling pathways.
Oncogene.
2000;19:1684-1690[CrossRef][Medline]
[Order article via Infotrieve].
9.
Carroll M, Ohno-Jones S, Tamura S, et al.
CGP 57148, a tyrosine kinase inhibitor, inhibits the growth of cells expressing BCR-ABL, TEL-ABL, and TEL-PDGFR fusion proteins.
Blood.
1997;90:4947-4952[Abstract/Free Full Text].
10.
Buchdunger E, Zimmerman J, Mett H, et al.
Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative.
Cancer Res.
1996;56:100-104[Abstract/Free Full Text].
11.
Heinrich MC, Griffith DJ, Druker BJ, Wait CL, Ott KA, Zigler AJ.
Inhibition of c-kit receptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor.
Blood.
2000;96:925-932[Abstract/Free Full Text].
12.
Druker BJ, Tamura S, Buchdunger E, et al.
Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells.
Nat Med.
1996;2:561-566[CrossRef][Medline]
[Order article via Infotrieve].
13.
Deininger MW, Goldman JM, Lydon N, Melo JV.
The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells.
Blood.
1997;90:3691-3698[Abstract/Free Full Text].
14.
Druker BJ, Talpaz M, Resta D, et al.
Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia.
N Engl J Med.
2001;344:1031-1037[Abstract/Free Full Text].
15.
Cross NC, Melo JV, Feng L, Goldman JM.
An optimized multiplex polymerase chain reaction (PCR) for detection of BCR-ABL fusion mRNAs in haematological disorders.
Leukemia.
1994;8:186-189[Medline]
[Order article via Infotrieve].
16.
Mahon FX, Deininger MW, Schultheis B, et al.
Selection and characterization of BCR-ABL-positive cell lines with differential sensitivity to the tyrosine kinase inhibitor STI571: diverse mechanisms of resistance.
Blood.
2000;96:1070-1079[Abstract/Free Full Text].
Top
Abstract
Introduction
