|
|
 Previous Article | Table of Contents | Next Article 
Blood, 1 May 2002, Vol. 99, No. 9, pp. 3472-3475
BRIEF REPORT
High frequency of point mutations clustered within the adenosine
triphosphate-binding region of BCR/ABL in patients with
chronic myeloid leukemia or Ph-positive acute lymphoblastic
leukemia who develop imatinib (STI571)
resistance
Susan Branford,
Zbigniew Rudzki,
Sonya Walsh,
Andrew Grigg,
Chris Arthur,
Kerry Taylor,
Richard Herrmann,
Kevin P. Lynch, and
Timothy P. Hughes
From the Institute of Medical and Veterinary
Science, Adelaide; Royal Melbourne Hospital; Royal North Shore
Hospital, Sydney; Mater Hospital, Brisbane; Royal Perth Hospital;
and Novartis Pharmaceuticals Australia, Sydney, Australia.
 |
Abstract |
Point mutations were found in the adenosine triphosphate (ATP)
binding region of BCR/ABL in 12 of 18 patients with chronic myeloid
leukemia (CML) or Ph-positive acute lymphoblastic leukemia (Ph+ ALL) and imatinib resistance (defined as loss of
established hematologic response), but they were found in only 1 of 10 patients with CML with imatinib refractoriness (failure to achieve
cytogenetic response). In 10 of 10 patients for whom samples were
available, the mutation was not detected before the initiation of
imatinib therapy. Three mutations (T315I, Y253H, and F317L present in
3, 1, and 1 patients, respectively) have a predicted role in abrogating imatinib binding to BCR/ABL, whereas 3 other mutations (E255K, G250E,
and M351T, present in 4, 2, and 2 patients, respectively) do not. Thus
we confirm a high frequency of mutations clustered within the
ATP-binding region of BCR/ABL in resistant patients. Screening may
allow intervention before relapse by identifying emerging mutations
with defined impacts on imatinib binding. Certain mutations may respond
to higher doses of imatinib, whereas other mutations may mandate
switching to another therapeutic strategy.
(Blood. 2002;99:3472-3475)
© 2002 by The American Society of Hematology.
| |
Introduction |
Treatment options are limited for patients with
chronic myeloid leukemia (CML) for whom interferon- therapy has
failed or who are in the acute phase of the
disease.1 The tyrosine kinase inhibitor imatinib
mesylate (Glivic; Novartis Pharmaceuticals, Basel, Switzerland)
(formerly STI571) frequently induces significant hematologic and
cytogenetic responses in these clinical settings.2,3 Imatinib acts as a competitor for adenosine triphosphate (ATP) binding4 and selectively induces apoptosis and blocks
proliferation in BCR/ABL-expressing cells.5 A proportion
of patients are primarily refractory to imatinib, and some patients,
particularly those in the later stages of the disease, acquire clinical
resistance after achieving a response.3 In vitro studies
of resistance to imatinib indicate various mechanisms of resistance,
including overexpression of BCR/ABL because of gene
amplification6-8 or increased imatinib efflux mediated by
the multidrug resistance P-glycoprotein.9 In a recent
report,10 clinical resistance was associated with the
reactivation of BCR/ABL tyrosine kinase activity in all patients
studied. In 6 of 9 patients, this was attributed to the mutation of a
single amino acid (T315I) in the ATP-binding site of BCR/ABL.
We used a reverse transcription-polymerase chain reaction (RT-PCR)
strategy to amplify and sequence the ABL kinase domain of BCR/ABL.
Twenty-eight patients who showed resistance or cytogenetic refractoriness were selected from patients enrolled in expanded access
studies within Australia. Our aim was to determine the frequency and
timing of acquired mutations within defined clinical groups and to
establish their distribution within the BCR/ABL kinase domain.
| |
Study design |
Resistance (n = 18 patients) was defined as loss of complete
hematologic remission that had been present for at least 3 months, loss
of complete hematologic remission with transformation to accelerated or
blastic phase after a period of chronic-phase CML, or relapsed
Ph-positive acute lymphoblastic leukemia (Ph+ ALL) after
complete hematologic remission had been established. Cytogenetic
refractoriness (n = 10 patients) was defined as failure to achieve a
major cytogenetic response after at least 6 months of therapy. Three
hundred fourteen Australian patients with CML or Ph+ ALL
were enrolled in trials of imatinib as the sole therapy. Patients who
were eligible and for whom samples were available within the 3-month
period of the study were included.
Extraction of RNA from blood, RT, and direct sequencing procedures have
been described.11 A long PCR method12 was
used to amplify the ABL kinase domain of the BCR/ABL allele with
forward primer BCRF (5'- TGACCAACTCGTGTGTGAAACTC) and
reverse primer ABLKinaseR (5'-TCCACTTCGTCTGAGATACTGGATT). A
second-stage PCR used forward primer ABLkinaseF
(5'-CGCAACAAGCCCACTGTCT) and reverse primer ABLkinaseR. The
entire kinase domain was sequenced in the forward and reverse
directions; this area included 863 bases (GenBank accession
number M14752).
| |
Results and discussion |
Resistance
Twelve of 18 resistant patients had mutations in the ATP binding
region of BCR/ABL (Table 1). In 9 patients for whom samples were available, the mutation was not detected
before imatinib administration was initiated, nor was it detected in 4 patients tested at 3 to 9 months before the onset of resistance in
each patient. This might have been because it was not present or it was
below the level of detection.
Mutations were identified that have a predicted or proven role in
abrogating imatinib binding to BCR/ABL, as follows: T315I (n = 3),
Y253H (n = 1), and F317L (n = 1). The T315I mutation confers
resistance in vitro10 and is predicted to disrupt a hydrogen bond between imatinib and BCR/ABL.13 Mutations at
amino acids 253 and 317 are predicted to impair binding of imatinib to
BCR/ABL by disrupting van der Waals interactions.13
Directed mutagenesis of amino acid 253 was shown to activate c-ABL
transformation,14 and it induced resistance to imatinib by
an increased tendency to autophosphorylate.15,16 Other
mutations were also observedE255K (n = 4), G250E (n = 2), and
M351T (n = 1). On prior structural knowledge, these would not have
been predicted to disrupt binding between imatinib and the kinase
domain. In all patients, acquisition of the mutation was
closely linked to the development of resistance. It is likely that
mutations at residues adjacent to contact points also led to the
disruption of interactions between imatinib and the kinase domain.
The 18 resistant patients could be subdivided by disease stage. Six of
8 patients who had relapses directly into blast crisis/ALL had
mutations. In 3 of these patients, the T315I mutation was present, and
it has been strongly linked to blast crisis relapse.10 Two
of 6 patients who had relapses into the accelerated phase and all 4 patients who had relapses into the chronic phase had mutations.
Cytogenetic refractoriness
Only 1 of 10 refractory patients had a mutation (Table 1). This
mutation was not detected before the administration of imatinib or 3 months after it. The mutant clone emerged at 8 months and persisted in
a mixed pattern until it became predominant at 11 months (Figure
1). This patient had additional complex
chromosomal abnormalities before imatinib therapy that were still
present at 6 months. Further disease progression was not evident during the period in which the mutation emerged.
View larger version (26K):
[in this window]
[in a new window]
| Figure 1.
Sequence analysis of 2 patients
with point mutations in the ATP binding site.
The 863-bp RT-PCR products of the ABL kinase domain of BCR/ABL were
sequenced. Arrows indicate the mutated nucleotide. (A) A point mutation
was first detected in patient 20 (Table 1) at the eighth month
of imatinib therapy. A mix of mutant and wild-type BCR/ABL was evident
from months 8 to 11. The predominant nucleotide switched from wild-type
to mutant over the course of 4 months. Sequence Navigator software
(Applied Biosystems, Foster City, CA) was unable to distinguish between
the wild-type and mutant nucleotides at months 9 and 10, as indicated
by N at the mutated site. The patient remains in accelerated phase. (B)
Patient 1 (Table 1) had a complete cytogenetic response (CCR) to
imatinib therapy but relapsed into blast crisis at 9 months. The T315I
mutation was predominant at that time but was not evident when tested
before study in chronic phase or in a previous lymphoid blast crisis
sample. The patient was refractory to treatment and has since
died.
|
|
As did Gorre et al,10 we have shown a high frequency of
mutations in patients with resistance though our mutations were diverse. This may relate to the greater diversity of patients within
the resistance category in our study. Recently, 2 groups reported ABL
kinase domain mutations at lower frequency (2 of 44 patients with
relapsed or refractory disease).17,18 Specific details
were not given to determine how the patients were classified or the
exact number of patients in each category. The median duration of
therapy, reported in only one of the studies, was 95 days18 compared with 7 months in our study. However, 10 of
the patients in our study acquired early resistance (median, 3 months),
and we found mutations in 7 of them. None of the 10 patients with refractory disease acquired mutations before 6 months. The differences in the frequency of mutation detection may be attributed to differences in the sensitivities of the techniques, differences in the time point
of analysis, or, as Gorre et al19 state, differences
between the patient populations in the studies.
We conclude that point mutations within the ATP-binding region of
BCR/ABL frequently emerge in patients with CML and Ph+ ALL
who show signs of resistant disease. These mutations are likely to
partially or totally abrogate imatinib binding to BCR/ABL. Pre-existing
mutations or polymorphisms in the BCR/ABL kinase domain, which would
explain primary refractoriness, were not detected, but we only studied
a limited number of patients. Additional incidences of imatinib
refractoriness, particularly in patients who do not demonstrate
hematologic responses, must be assessed.
Given the detection of a mixed population of mutant and wild-type
BCR/ABL in association with gradual disease progression in some
patients (Table 1), regular tests for emerging mutations in patients
judged at risk may be warranted. Once a mutation is detected,
intervention such as the cessation of imatinib and alternative therapy
can be tested. Dose escalation might be of value, depending on the
IC50 of the mutation and on whether sufficiently high
levels of imatinib could be achieved. The choice of intervention may depend on the impact of the mutation on imatinib binding and kinase activity. Finally, it is important to recognize that the development of
point mutations in the ATP-binding region of BCR/ABL kinase is one of a
range of mechanisms of drug resistance, including gene amplification
and increased expression of P-glycoprotein, that should be considered
when designing screening strategies.
| |
Acknowledgments |
We thank Bernadette Miller for invaluable technical support and the
trial coordinators and laboratory staff at Royal North Shore Hospital,
Royal Melbourne Hospital, Mater Hospital (Brisbane), and Royal Perth
Hospital for their excellent assistance. We also thank Arthur Mangos
and the Sequencing Centre staff.
| |
Footnotes |
Submitted September 19, 2001; accepted December 27, 2001.
Supported in part by grants from Novartis Pharmaceuticals Australia.
T.P.H., A.G., C.A., K.T., and R.H. served as
investigators in clinical trials with imatinib. T.P.H. is an adviser to
Novartis Pharmaceuticals on clinical issues relating to imatinib.
K.P.L. is employed by Novartis Pharmaceuticals.
The publication costs of this
article were defrayed in part by
page charge payment. Therefore,
and solely to indicate this fact,
this article is hereby marked
"advertisement"
in accordance with 18 U.S.C.
section 1734.
Reprints: Susan Branford, Division of Molecular Pathology,
Institute of Medical and Veterinary Science, South Australia, 5000, Australia; e-mail: susan.branford{at}imvs.sa.gov.au.
| |
References |
1.
Sawyers CL.
Chronic myeloid leukemia.
N Engl J Med.
1999;340:1330-1340[Free Full Text].
2.
Druker BJ, Talpaz M, Resta DJ, et al.
Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia.
N Engl J Med.
2001;344:1031-1037[Abstract/Free Full Text].
3.
Druker BJ, Sawyers CL, Kantarjian H, et al.
Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome.
N Engl J Med.
2001;344:1038-1042[Abstract/Free Full Text].
4.
Buchdunger E, Zimmerman J, Mett H, et al.
Inhibition of the Abl protein-tyrosine kinase in vitro and in vivo by a 2-phenylaminopyrimidine derivative.
Cancer Res.
1996;56:100-104[Abstract/Free Full Text].
5.
Druker BJ, Tamura S, Buchdunger E, et al.
Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells.
Nat Med.
1996;2:561-566[CrossRef][Medline]
[Order article via Infotrieve].
6.
le Coutre P, Tassi E, Varella-Garcia M, et al.
Induction of resistance to the Abelson inhibitor STI571 in human leukemic cells through gene amplification.
Blood.
2000;95:1758-1766[Abstract/Free Full Text].
7.
Weisberg E, Griffin JD.
Mechanism of resistance to the ABL tyrosine kinase inhibitor STI571 in BCR/ABL-transformed hematopoietic cell lines.
Blood.
2000;95:3498-3505[Abstract/Free Full Text].
8.
Weisberg E, Griffin JD.
Mechanisms of resistance imatinib (STI571) preclinical models and in leukemia patients.
Drug Resist Update.
2001;4:22-28[CrossRef][Medline]
[Order article via Infotrieve].
9.
Mahan FX, Deininger MV, Schultheis B, Chabrol Reiffers J, Goldman JM, Melo JV.
Selection and characterization of BCR-ABL positive cell lines with differential sensitivity to the tyrosine kinase inhibitor STI571: diverse mechanisms of resistance.
Blood.
2000;96:1070-1079[Abstract/Free Full Text].
10.
Gorre ME, Mohammed M, Ellwood K, et al.
Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification.
Science.
2001;293:876-880[Abstract/Free Full Text].
11.
Branford S, Hughes TP, Rudzki Z.
Monitoring chronic myeloid leukaemia therapy by real-time quantitative PCR in blood is a reliable alternative to bone marrow cytogenetics.
Br J Haematol.
1999;107:587-599[CrossRef][Medline]
[Order article via Infotrieve].
12.
Branford S, Rudzki Z, Hughes TP.
A novel BCR-ABL transcript (e8a2) with the insertion of an inverted sequence of ABL intron 1b in a patient with Philadelphia-positive chronic myeloid leukaemia.
Br J Haematol.
2000;109:635-637[Medline]
[Order article via Infotrieve].
13.
Schindler T, Bornmann W, Pellicena P, Miller WT, Clarkson B, Kuriyan J.
Structural mechanism for STI-571 inhibition of Abelson tyrosine kinase.
Science.
2000;289:1938-1942[Abstract/Free Full Text].
14.
Allen P, Weidemann M.
An activating mutation in the ATP binding site of the ABL kinase domain.
J Biol Chem.
1996;271:19585-19591[Abstract/Free Full Text].
15.
Brasher BB, Van Etten RA.
c-Abl has high intrinsic tyrosine kinase activity that is stimulated by mutation of the Src homology 3 domain autophosphorylation at two distinct regulatory tyrosines.
J Biol Chem.
2000;275:35631-35637[Abstract/Free Full Text].
16.
Roumiantsev S, Brasher BB, Van Etten RA.
A point mutation in the ABL catalytic domain induces resistance to the tyrosine kinase inhibitor STI 571 [abstract].
Blood.
2000;96:470.
17.
Barthe C, Cony-Makhoul P, Melo J, Reiffers J, Mahon F.
Roots of clinical resistance to STI-571 cancer therapy [letter].
Science.
2001;293:2163.
18.
Hochhaus A, Kreil S, Corbin A, et al.
Roots of clinical resistance to STI-571 cancer therapy.
Science [letter].
2001;293:2163.
19.
Gorre ME, Shah N, Ellwood C, Nicoll J, Sawyers C.
Roots of clinical resistance to STI-571 cancer therapy [response].
Science.
2001;293:2163.
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
Related Letter in Blood Online:
-
Leukoencephalopathy and papovavirus infection after treatment with chemotherapy and anti-CD20 monoclonal antibody
- Paola Matteucci, Michele Magni, Massimo Di Nicola, Carmelo Carlo-Stella, Caterina Uberti, and Alessandro M. Gianni
Blood 2002 100: 1104-1105.
[Full Text]
[PDF]
This article has been cited by other articles:
|
|
|
|
 
V. G. Oehler, K. A. Guthrie, C. L. Cummings, K. Sabo, B. L. Wood, T. Gooley, T. Yang, M. T. Epping, Y. Shou, E. Pogosova-Agadjanyan, et al.
The preferentially expressed antigen in melanoma (PRAME) inhibits myeloid differentiation in normal hematopoietic and leukemic progenitor cells
Blood,
October 8, 2009;
114(15):
3299 - 3308.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. G. Oehler, K. Y. Yeung, Y. E. Choi, R. E. Bumgarner, A. E. Raftery, and J. P. Radich
The derivation of diagnostic markers of chronic myeloid leukemia progression from microarray data
Blood,
October 8, 2009;
114(15):
3292 - 3298.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Soverini, A. Gnani, S. Colarossi, F. Castagnetti, E. Abruzzese, S. Paolini, S. Merante, E. Orlandi, S. de Matteis, A. Gozzini, et al.
Philadelphia-positive patients who already harbor imatinib-resistant Bcr-Abl kinase domain mutations have a higher likelihood of developing additional mutations associated with resistance to second- or third-line tyrosine kinase inhibitors
Blood,
September 3, 2009;
114(10):
2168 - 2171.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hughes, G. Saglio, S. Branford, S. Soverini, D.-W. Kim, M. C. Muller, G. Martinelli, J. Cortes, L. Beppu, E. Gottardi, et al.
Impact of Baseline BCR-ABL Mutations on Response to Nilotinib in Patients With Chronic Myeloid Leukemia in Chronic Phase
J. Clin. Oncol.,
September 1, 2009;
27(25):
4204 - 4210.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ernst, F. X. Gruber, O. Pelz-Ackermann, J. Maier, M. Pfirrmann, M. C. Muller, I. Mikkola, K. Porkka, D. Niederwieser, A. Hochhaus, et al.
A co-operative evaluation of different methods of detecting BCR-ABL kinase domain mutations in patients with chronic myeloid leukemia on second-line dasatinib or nilotinib therapy after failure of imatinib
Haematologica,
September 1, 2009;
94(9):
1227 - 1235.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. H. Mak, W. D. Schober, W. Chen, M. Konopleva, J. Cortes, H. M. Kantarjian, M. Andreeff, and B. Z. Carter
Triptolide induces cell death independent of cellular responses to imatinib in blast crisis chronic myelogenous leukemia cells including quiescent CD34+ primitive progenitor cells
Mol. Cancer Ther.,
September 1, 2009;
8(9):
2509 - 2516.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. E. Varley, D. G. Mutch, T. B. Edmonston, P. J. Goodfellow, and R. D. Mitra
Intra-tumor heterogeneity of MLH1 promoter methylation revealed by deep single molecule bisulfite sequencing
Nucleic Acids Res.,
August 1, 2009;
37(14):
4603 - 4612.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Versele, W. Talloen, C. Rockx, T. Geerts, B. Janssen, T. Lavrijssen, P. King, H. W.H. Gohlmann, M. Page, and T. Perera
Response prediction to a multitargeted kinase inhibitor in cancer cell lines and xenograft tumors using high-content tyrosine peptide arrays with a kinetic readout
Mol. Cancer Ther.,
July 1, 2009;
8(7):
1846 - 1855.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Eley, F. R. Luo, S. Agrawal, A. Sanil, J. Manning, T. Li, A. Blackwood-Chirchir, and R. Bertz
Phase I Study of the Effect of Gastric Acid pH Modulators on the Bioavailability of Oral Dasatinib in Healthy Subjects
J. Clin. Pharmacol.,
June 1, 2009;
49(6):
700 - 709.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. E. Iacob, T. Pene-Dumitrescu, J. Zhang, N. S. Gray, T. E. Smithgall, and J. R. Engen
Conformational disturbance in Abl kinase upon mutation and deregulation
PNAS,
February 3, 2009;
106(5):
1386 - 1391.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Ding, Y. Su, L. Pang, Q. Lu, Z. Wang, S. Zhang, S. Zheng, J. Mao, and Y. Zhu
Inhibition of apoptosis by downregulation of hBex1, a novel mechanism, contributes to the chemoresistance of Bcr/Abl+ leukemic cells
Carcinogenesis,
January 1, 2009;
30(1):
35 - 42.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. Jones, S. Kamel-Reid, D. Bahler, H. Dong, K. Elenitoba-Johnson, R. Press, N. Quigley, P. Rothberg, D. Sabath, D. Viswanatha, et al.
Laboratory Practice Guidelines for Detecting and Reporting BCR-ABL Drug Resistance Mutations in Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia: A Report of the Association for Molecular Pathology
J. Mol. Diagn.,
January 1, 2009;
11(1):
4 - 11.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T.-S. Lee, W. Ma, X. Zhang, F. Giles, J. Cortes, H. Kantarjian, and M. Albitar
BCR-ABL alternative splicing as a common mechanism for imatinib resistance: evidence from molecular dynamics simulations
Mol. Cancer Ther.,
December 1, 2008;
7(12):
3834 - 3841.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. P. Hughes, S. Branford, D. L. White, J. Reynolds, R. Koelmeyer, J. F. Seymour, K. Taylor, C. Arthur, A. Schwarer, J. Morton, et al.
Impact of early dose intensity on cytogenetic and molecular responses in chronic- phase CML patients receiving 600 mg/day of imatinib as initial therapy
Blood,
November 15, 2008;
112(10):
3965 - 3973.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Porkka, P. Koskenvesa, T. Lundan, J. Rimpilainen, S. Mustjoki, R. Smykla, R. Wild, R. Luo, M. Arnan, B. Brethon, et al.
Dasatinib crosses the blood-brain barrier and is an efficient therapy for central nervous system Philadelphia chromosome-positive leukemia
Blood,
August 15, 2008;
112(4):
1005 - 1012.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J S Khorashad, N Thelwell, D Milojkovic, D Marin, J A Watson, J M Goldman, J F Apperley, L Foroni, and A G Reid
A new rapid and sensitive assay for detecting the T315I BCR-ABL kinase domain mutation in chronic myeloid leukaemia
J. Clin. Pathol.,
July 1, 2008;
61(7):
863 - 865.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Katsoulas, Z. Rachid, J. P. McNamee, C. Williams, and B. J. Jean-Claude
Combi-targeting concept: an optimized single-molecule dual-targeting model for the treatment of chronic myelogenous leukemia
Mol. Cancer Ther.,
May 1, 2008;
7(5):
1033 - 1043.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Kumar, E. T. Petri, B. Halmos, and T. J. Boggon
Structure and Clinical Relevance of the Epidermal Growth Factor Receptor in Human Cancer
J. Clin. Oncol.,
April 1, 2008;
26(10):
1742 - 1751.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Laudadio, M. W.N. Deininger, M. J. Mauro, B. J. Druker, and R. D. Press
An Intron-Derived Insertion/Truncation Mutation in the BCR-ABL Kinase Domain in Chronic Myeloid Leukemia Patients Undergoing Kinase Inhibitor Therapy
J. Mol. Diagn.,
March 1, 2008;
10(2):
177 - 180.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Mayerhofer, K. V. Gleixner, J. Mayerhofer, G. Hoermann, E. Jaeger, K. J. Aichberger, R. G. Ott, K. Greish, H. Nakamura, S. Derdak, et al.
Targeting of heat shock protein 32 (Hsp32)/heme oxygenase-1 (HO-1) in leukemic cells in chronic myeloid leukemia: a novel approach to overcome resistance against imatinib
Blood,
February 15, 2008;
111(4):
2200 - 2210.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Kantarjian, C. Schiffer, D. Jones, and J. Cortes
Monitoring the response and course of chronic myeloid leukemia in the modern era of BCR-ABL tyrosine kinase inhibitors: practical advice on the use and interpretation of monitoring methods
Blood,
February 15, 2008;
111(4):
1774 - 1780.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Baccarani, F. Pane, and G. Saglio
Monitoring treatment of chronic myeloid leukemia
Haematologica,
February 1, 2008;
93(2):
161 - 169.
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Ernst, P. Erben, M. C. Muller, P. Paschka, T. Schenk, J. Hoffmann, S. Kreil, P. La Rosee, R. Hehlmann, and A. Hochhaus
Dynamics of BCR-ABL mutated clones prior to hematologic or cytogenetic resistance to imatinib
Haematologica,
February 1, 2008;
93(2):
186 - 192.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. D. Press, C. Galderisi, R. Yang, C. Rempfer, S. G. Willis, M. J. Mauro, B. J. Druker, and M. W.N. Deininger
A Half-Log Increase in BCR-ABL RNA Predicts a Higher Risk of Relapse in Patients with Chronic Myeloid Leukemia with an Imatinib-Induced Complete Cytogenetic Response
Clin. Cancer Res.,
October 15, 2007;
13(20):
6136 - 6143.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. E. Nicolini, S. Hayette, S. Corm, E. Bachy, D. Bories, M. Tulliez, F. Guilhot, L. Legros, F. Maloisel, J.-J. Kiladjian, et al.
Clinical outcome of 27 imatinib mesylate-resistant chronic myelogenous leukemia patients harboring a T315I BCR-ABL mutation
Haematologica,
September 1, 2007;
92(9):
1238 - 1241.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. S. Winn-Deen, B. Helton, R. Van Atta, W. Wong, J. Peralta, J. Wang, G. J. Tsongalis, D. Belloni, D. Chan, J. R. Eshleman, et al.
Development of an Integrated Assay for Detection of BCR-ABL RNA
Clin. Chem.,
September 1, 2007;
53(9):
1593 - 1600.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Godin-Heymann, I. Bryant, M. N. Rivera, L. Ulkus, D. W. Bell, D. J. Riese II, J. Settleman, and D. A. Haber
Oncogenic Activity of Epidermal Growth Factor Receptor Kinase Mutant Alleles Is Enhanced by the T790M Drug Resistance Mutation
Cancer Res.,
August 1, 2007;
67(15):
7319 - 7326.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Peng, J. Brain, Y. Hu, A. Goodrich, L. Kong, D. Grayzel, R. Pak, M. Read, and S. Li
Inhibition of heat shock protein 90 prolongs survival of mice with BCR-ABL-T315I-induced leukemia and suppresses leukemic stem cells
Blood,
July 15, 2007;
110(2):
678 - 685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Pfeifer, B. Wassmann, A. Pavlova, L. Wunderle, J. Oldenburg, A. Binckebanck, T. Lange, A. Hochhaus, S. Wystub, P. Bruck, et al.
Kinase domain mutations of BCR-ABL frequently precede imatinib-based therapy and give rise to relapse in patients with de novo Philadelphia-positive acute lymphoblastic leukemia (Ph+ ALL)
Blood,
July 15, 2007;
110(2):
727 - 734.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Ray, S. W. Cowan-Jacob, P. W. Manley, J. Mestan, and J. D. Griffin
Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by a random mutagenesis study
Blood,
June 1, 2007;
109(11):
5011 - 5015.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. K. Nguyen, M. Rahmani, H. Harada, P. Dent, and S. Grant
MEK1/2 inhibitors sensitize Bcr/Abl+ human leukemia cells to the dual Abl/Src inhibitor BMS-354/825
Blood,
May 1, 2007;
109(9):
4006 - 4015.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. A. Bartholomeusz, M. Talpaz, V. Kapuria, L. Y. Kong, S. Wang, Z. Estrov, W. Priebe, J. Wu, and N. J. Donato
Activation of a novel Bcr/Abl destruction pathway by WP1130 induces apoptosis of chronic myelogenous leukemia cells
Blood,
April 15, 2007;
109(8):
3470 - 3478.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Soverini, S. Colarossi, A. Gnani, F. Castagnetti, G. Rosti, C. Bosi, S. Paolini, M. Rondoni, P. P. Piccaluga, F. Palandri, et al.
Resistance to dasatinib in Philadelphia-positive leukemia patients and the presence or the selection of mutations at residues 315 and 317 in the BCR-ABL kinase domain
Haematologica,
March 1, 2007;
92(3):
401 - 404.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Wang, D. Cai, C. Brendel, C. Barett, P. Erben, P. W. Manley, A. Hochhaus, A. Neubauer, and A. Burchert
Adaptive secretion of granulocyte-macrophage colony-stimulating factor (GM-CSF) mediates imatinib and nilotinib resistance in BCR/ABL+ progenitors via JAK-2/STAT-5 pathway activation
Blood,
March 1, 2007;
109(5):
2147 - 2155.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. M. Kantarjian, F. Giles, A. Quintas-Cardama, and J. Cortes
Important Therapeutic Targets in Chronic Myelogenous Leukemia
Clin. Cancer Res.,
February 15, 2007;
13(4):
1089 - 1097.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. G. Oehler, T. Gooley, D. S. Snyder, L. Johnston, A. Lin, C. C. Cummings, S. Chu, R. Bhatia, S. J. Forman, R. S. Negrin, et al.
The effects of imatinib mesylate treatment before allogeneic transplantation for chronic myeloid leukemia
Blood,
February 15, 2007;
109(4):
1782 - 1789.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. M. Kantarjian, M. Talpaz, F. Giles, S. O'Brien, and J. Cortes
New Insights into the Pathophysiology of Chronic Myeloid Leukemia and Imatinib Resistance
Ann Intern Med,
December 19, 2006;
145(12):
913 - 923.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Soverini, S. Colarossi, A. Gnani, G. Rosti, F. Castagnetti, A. Poerio, I. Iacobucci, M. Amabile, E. Abruzzese, E. Orlandi, et al.
Contribution of ABL Kinase Domain Mutations to Imatinib Resistance in Different Subsets of Philadelphia-Positive Patients: By the GIMEMA Working Party on Chronic Myeloid Leukemia
Clin. Cancer Res.,
December 15, 2006;
12(24):
7374 - 7379.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
G. Amicarelli, D. Adlerstein, E. Shehi, F. Wang, and G. M. Makrigiorgos
Genotype-Specific Signal Generation Based on Digestion of 3-Way DNA Junctions: Application to KRAS Variation Detection
Clin. Chem.,
October 1, 2006;
52(10):
1855 - 1863.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. A. Bradeen, C. A. Eide, T. O'Hare, K. J. Johnson, S. G. Willis, F. Y. Lee, B. J. Druker, and M. W. Deininger
Comparison of imatinib mesylate, dasatinib (BMS-354825), and nilotinib (AMN107) in an N-ethyl-N-nitrosourea (ENU)-based mutagenesis screen: high efficacy of drug combinations
Blood,
October 1, 2006;
108(7):
2332 - 2338.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Baccarani, G. Saglio, J. Goldman, A. Hochhaus, B. Simonsson, F. Appelbaum, J. Apperley, F. Cervantes, J. Cortes, M. Deininger, et al.
Evolving concepts in the management of chronic myeloid leukemia: recommendations from an expert panel on behalf of the European LeukemiaNet
Blood,
September 15, 2006;
108(6):
1809 - 1820.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. von Bubnoff, P. W. Manley, J. Mestan, J. Sanger, C. Peschel, and J. Duyster
Bcr-Abl resistance screening predicts a limited spectrum of point mutations to be associated with clinical resistance to the Abl kinase inhibitor nilotinib (AMN107)
Blood,
August 15, 2006;
108(4):
1328 - 1333.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. J. Griswold, M. MacPartlin, T. Bumm, V. L. Goss, T. O'Hare, K. A. Lee, A. S. Corbin, E. P. Stoffregen, C. Smith, K. Johnson, et al.
Kinase domain mutants of bcr-abl exhibit altered transformation potency, kinase activity, and substrate utilization, irrespective of sensitivity to imatinib.
Mol. Cell. Biol.,
August 1, 2006;
26(16):
6082 - 6093.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hughes, M. Deininger, A. Hochhaus, S. Branford, J. Radich, J. Kaeda, M. Baccarani, J. Cortes, N. C. P. Cross, B. J. Druker, et al.
Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results
Blood,
July 1, 2006;
108(1):
28 - 37.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. P. Shah, F. Y. Lee, R. Luo, Y. Jiang, M. Donker, and C. Akin
Dasatinib (BMS-354825) inhibits KITD816V, an imatinib-resistant activating mutation that triggers neoplastic growth in most patients with systemic mastocytosis
Blood,
July 1, 2006;
108(1):
286 - 291.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Koptyra, R. Falinski, M. O. Nowicki, T. Stoklosa, I. Majsterek, M. Nieborowska-Skorska, J. Blasiak, and T. Skorski
BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance
Blood,
July 1, 2006;
108(1):
319 - 327.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Talpaz, N. P. Shah, H. Kantarjian, N. Donato, J. Nicoll, R. Paquette, J. Cortes, S. O'Brien, C. Nicaise, E. Bleickardt, et al.
Dasatinib in imatinib-resistant Philadelphia chromosome-positive leukemias.
N. Engl. J. Med.,
June 15, 2006;
354(24):
2531 - 2541.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Copland, A. Hamilton, L. J. Elrick, J. W. Baird, E. K. Allan, N. Jordanides, M. Barow, J. C. Mountford, and T. L. Holyoake
Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction
Blood,
June 1, 2006;
107(11):
4532 - 4539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Z. Carter, D. H. Mak, W. D. Schober, M. Cabreira-Hansen, M. Beran, T. McQueen, W. Chen, and M. Andreeff
Regulation of survivin expression through Bcr-Abl/MAPK cascade: targeting survivin overcomes imatinib resistance and increases imatinib sensitivity in imatinib-responsive CML cells
Blood,
February 15, 2006;
107(4):
1555 - 1563.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. Hughes
ABL Kinase Inhibitor Therapy for CML: Baseline Assessments and Response Monitoring
Hematology,
January 1, 2006;
2006(1):
211 - 218.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. J. Mauro
Defining and Managing Imatinib Resistance
Hematology,
January 1, 2006;
2006(1):
219 - 225.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Golemovic, S. Verstovsek, F. Giles, J. Cortes, T. Manshouri, P. W. Manley, J. Mestan, M. Dugan, L. Alland, J. D. Griffin, et al.
AMN107, a Novel Aminopyrimidine Inhibitor of Bcr-Abl, Has In vitro Activity against Imatinib-Resistant Chronic Myeloid Leukemia
Clin. Cancer Res.,
July 1, 2005;
11(13):
4941 - 4947.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Soverini, G. Martinelli, G. Rosti, S. Bassi, M. Amabile, A. Poerio, B. Giannini, E. Trabacchi, F. Castagnetti, N. Testoni, et al.
ABL Mutations in Late Chronic Phase Chronic Myeloid Leukemia Patients With Up-Front Cytogenetic Resistance to Imatinib Are Associated With a Greater Likelihood of Progression to Blast Crisis and Shorter Survival: A Study by the GIMEMA Working Party on Chronic Myeloid Leukemia
J. Clin. Oncol.,
June 20, 2005;
23(18):
4100 - 4109.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. C. Wolff, D. R. Veach, W. P. Tong, W. G. Bornmann, B. Clarkson, and R. L. Ilaria Jr
PD166326, a novel tyrosine kinase inhibitor, has greater antileukemic activity than imatinib mesylate in a murine model of chronic myeloid leukemia
Blood,
May 15, 2005;
105(10):
3995 - 4003.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P.-H. Tseng, H.-P. Lin, J. Zhu, K.-F. Chen, E. M. Hade, D. C. Young, J. C. Byrd, M. Grever, K. Johnson, B. J. Druker, et al.
Synergistic interactions between imatinib mesylate and the novel phosphoinositide-dependent kinase-1 inhibitor OSU-03012 in overcoming imatinib mesylate resistance
Blood,
May 15, 2005;
105(10):
4021 - 4027.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Bagrintseva, S. Geisenhof, R. Kern, S. Eichenlaub, C. Reindl, J. W. Ellwart, W. Hiddemann, and K. Spiekermann
FLT3-ITD-TKD dual mutants associated with AML confer resistance to FLT3 PTK inhibitors and cytotoxic agents by overexpression of Bcl-x(L)
Blood,
May 1, 2005;
105(9):
3679 - 3685.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Deininger, E. Buchdunger, and B. J. Druker
The development of imatinib as a therapeutic agent for chronic myeloid leukemia
Blood,
April 1, 2005;
105(7):
2640 - 2653.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Tefferi, G. W. Dewald, M. L. Litzow, J. Cortes, M. J. Mauro, M. Talpaz, and H. M. Kantarjian
Chronic Myeloid Leukemia: Current Application of Cytogenetics and Molecular Testing for Diagnosis and Treatment
Mayo Clin. Proc.,
March 1, 2005;
80(3):
390 - 402.
[Abstract]
[PDF]
|
|
|
|
|
|
|
L. J. Elrick, H. G. Jorgensen, J. C. Mountford, and T. L. Holyoake
Punish the parent not the progeny
Blood,
March 1, 2005;
105(5):
1862 - 1866.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. von Bubnoff, D. R. Veach, H. van der Kuip, W. E. Aulitzky, J. Sanger, P. Seipel, W. G. Bornmann, C. Peschel, B. Clarkson, and J. Duyster
A cell-based screen for resistance of Bcr-Abl-positive leukemia identifies the mutation pattern for PD166326, an alternative Abl kinase inhibitor
Blood,
February 15, 2005;
105(4):
1652 - 1659.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L.C. AMLER, A.D. GODDARD, and K.J. HILLAN
Predicting Clinical Benefit in Non-Small-Cell Lung Cancer Patients Treated with Epidermal Growth Factor Tyrosine Kinase Inhibitors
Cold Spring Harb Symp Quant Biol,
January 1, 2005;
70(0):
483 - 488.
[Abstract]
[PDF]
|
|
|
|
|
|
|
N. P. Shah
Loss of Response to Imatinib: Mechanisms and Management
Hematology,
January 1, 2005;
2005(1):
183 - 187.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Wissing, K. Godl, D. Brehmer, S. Blencke, M. Weber, P. Habenberger, M. Stein-Gerlach, A. Missio, M. Cotten, S. Muller, et al.
Chemical Proteomic Analysis Reveals Alternative Modes of Action for Pyrido[2,3-d]pyrimidine Kinase Inhibitors
Mol. Cell. Proteomics,
December 1, 2004;
3(12):
1181 - 1193.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Branford, Z. Rudzki, I. Parkinson, A. Grigg, K. Taylor, J. F. Seymour, S. Durrant, P. Browett, A. P. Schwarer, C. Arthur, et al.
Real-time quantitative PCR analysis can be used as a primary screen to identify patients with CML treated with imatinib who have BCR-ABL kinase domain mutations
Blood,
November 1, 2004;
104(9):
2926 - 2932.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
T. O'Hare, R. Pollock, E. P. Stoffregen, J. A. Keats, O. M. Abdullah, E. M. Moseson, V. M. Rivera, H. Tang, C. A. Metcalf III, R. S. Bohacek, et al.
Inhibition of wild-type and mutant Bcr-Abl by AP23464, a potent ATP-based oncogenic protein kinase inhibitor: implications for CML
Blood,
October 15, 2004;
104(8):
2532 - 2539.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. L. Corless, J. A. Fletcher, and M. C. Heinrich
Biology of Gastrointestinal Stromal Tumors
J. Clin. Oncol.,
September 15, 2004;
22(18):
3813 - 3825.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. P. Radich
Targeting ALL leukemia
Blood,
September 1, 2004;
104(5):
1235 - 1236.
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Harata, Y. Soda, K. Tani, J. Ooi, T. Takizawa, M. Chen, Y. Bai, K. Izawa, S. Kobayashi, A. Tomonari, et al.
CD19-targeting liposomes containing imatinib efficiently kill Philadelphia chromosome-positive acute lymphoblastic leukemia cells
Blood,
September 1, 2004;
104(5):
1442 - 1449.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. P. Shah, C. Tran, F. Y. Lee, P. Chen, D. Norris, and C. L. Sawyers
Overriding Imatinib Resistance with a Novel ABL Kinase Inhibitor
Science,
July 16, 2004;
305(5682):
399 - 401.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
Y. Soda, K. Tani, Y. Bai, M. Saiki, M. Chen, K. Izawa, S. Kobayashi, S. Takahashi, K. Uchimaru, T. Kuwabara, et al.
A novel maxizyme vector targeting a bcr-abl fusion gene induced specific cell death in Philadelphia chromosome-positive acute lymphoblastic leukemia
Blood,
July 15, 2004;
104(2):
356 - 363.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. A.E. Irving, S. O'Brien, A. L. Lennard, L. Minto, F. Lin, and A. G. Hall
Use of Denaturing HPLC for Detection of Mutations in the BCR-ABL Kinase Domain in Patients Resistant to Imatinib
Clin. Chem.,
July 1, 2004;
50(7):
1233 - 1237.
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Soverini, G. Martinelli, M. Amabile, A. Poerio, M. Bianchini, G. Rosti, F. Pane, G. Saglio, and M. Baccarani
Denaturing-HPLC-Based Assay for Detection of ABL Mutations in Chronic Myeloid Leukemia Patients Resistant to Imatinib
Clin. Chem.,
July 1, 2004;
50(7):
1205 - 1213.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. M. Stone
Optimizing Treatment of Chronic Myeloid Leukemia: A Rational Approach
Oncologist,
June 1, 2004;
9(3):
259 - 270.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
K. Bagrintseva, R. Schwab, T. M. Kohl, S. Schnittger, S. Eichenlaub, J. W. Ellwart, W. Hiddemann, and K. Spiekermann
Mutations in the tyrosine kinase domain of FLT3 define a new molecular mechanism of acquired drug resistance to PTK inhibitors in FLT3-ITD-transformed hematopoietic cells
Blood,
March 15, 2004;
103(6):
2266 - 2275.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. J. Donato, J. Y. Wu, J. Stapley, H. Lin, R. Arlinghaus, B. Aggarwal, S. Shishodin, M. Albitar, K. Hayes, H. Kantarjian, et al.
Imatinib Mesylate Resistance Through BCR-ABL Independence in Chronic Myelogenous Leukemia
Cancer Res.,
January 15, 2004;
64(2):
672 - 677.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. O'Brien, A. Tefferi, and P. Valent
Chronic Myelogenous Leukemia and Myeloproliferative Disease
Hematology,
January 1, 2004;
2004(1):
146 - 162.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Gardembas, P. Rousselot, M. Tulliez, M. Vigier, A. Buzyn, F. Rigal-Huguet, L. Legros, M. Michallet, C. Berthou, N. Cheron, et al.
Results of a prospective phase 2 study combining imatinib mesylate and cytarabine for the treatment of Philadelphia-positive patients with chronic myelogenous leukemia in chronic phase
Blood,
December 15, 2003;
102(13):
4298 - 4305.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
P. T. Ferrao, M. J. Frost, S.-P. Siah, and L. K. Ashman
Overexpression of P-glycoprotein in K562 cells does not confer resistance to the growth inhibitory effects of imatinib (STI571) in vitro
Blood,
December 15, 2003;
102(13):
4499 - 4503.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. C. Heinrich, C. L. Corless, G. D. Demetri, C. D. Blanke, M. von Mehren, H. Joensuu, L. S. McGreevey, C.-J. Chen, A. D. Van den Abbeele, B. J. Druker, et al.
Kinase Mutations and Imatinib Response in Patients With Metastatic Gastrointestinal Stromal Tumor
J. Clin. Oncol.,
December 1, 2003;
21(23):
4342 - 4349.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. J. Druker
Imatinib As a Paradigm of Targeted Therapies
J. Clin. Oncol.,
December 1, 2003;
21(90230):
239s - 245.
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Nimmanapalli, P. Bali, E. O'Bryan, L. Fuino, F. Guo, J. Wu, P. Houghton, and K. Bhalla
Arsenic Trioxide Inhibits Translation of mRNA of bcr-abl, Resulting in Attenuation of Bcr-Abl Levels and Apoptosis of Human Leukemia Cells
Cancer Res.,
November 15, 2003;
63(22):
7950 - 7958.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. M. Goldman and J. V. Melo
Chronic Myeloid Leukemia -- Advances in Biology and New Approaches to Treatment
N. Engl. J. Med.,
October 9, 2003;
349(15):
1451 - 1464.
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. von Bubnoff, D. R. Veach, W. T. Miller, W. Li, J. Sanger, C. Peschel, W. G. Bornmann, B. Clarkson, and J. Duyster
Inhibition of Wild-Type and Mutant Bcr-Abl by Pyrido-Pyrimidine-Type Small Molecule Kinase Inhibitors
Cancer Res.,
October 1, 2003;
63(19):
6395 - 6404.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
W.-K. Hofmann, M. Komor, B. Wassmann, L. C. Jones, H. Gschaidmeier, D. Hoelzer, H. P. Koeffler, and O. G. Ottmann
Presence of the BCR-ABL mutation Glu255Lys prior to STI571 (imatinib) treatment in patients with Ph+ acute lymphoblastic leukemia
Blood,
July 15, 2003;
102(2):
659 - 661.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Branford, Z. Rudzki, S. Walsh, I. Parkinson, A. Grigg, J. Szer, K. Taylor, R. Herrmann, J. F. Seymour, C. Arthur, et al.
Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis
Blood,
July 1, 2003;
102(1):
276 - 283.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. H. Griffin, J. Leung, R. J. Bruner, M. A. Caligiuri, and R. Briesewitz
Discovery of a fusion kinase in EOL-1 cells and idiopathic hypereosinophilic syndrome
PNAS,
June 24, 2003;
100(13):
7830 - 7835.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. S. Corbin, P. L. Rosee, E. P. Stoffregen, B. J. Druker, and M. W. Deininger
Several Bcr-Abl kinase domain mutants associated with imatinib mesylate resistance remain sensitive to imatinib
Blood,
June 1, 2003;
101(11):
4611 - 4614.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Kurzrock, H. M. Kantarjian, B. J. Druker, and M. Talpaz
Philadelphia Chromosome-Positive Leukemias: From Basic Mechanisms to Molecular Therapeutics
Ann Intern Med,
May 20, 2003;
138(10):
819 - 830.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Wong, J. McLaughlin, D. Cheng, and O. N. Witte
Cell context-specific effects of the BCR-ABL oncogene monitored in hematopoietic progenitors
Blood,
May 15, 2003;
101(10):
4088 - 4097.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. L. Nashed, K. W. Rao, and M. L. Gulley
Clinical Applications of BCR-ABL Molecular Testing in Acute Leukemia
J. Mol. Diagn.,
May 1, 2003;
5(2):
63 - 72.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Nimmanapalli, L. Fuino, C. Stobaugh, V. Richon, and K. Bhalla
Cotreatment with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) enhances imatinib-induced apoptosis of Bcr-Abl-positive human acute leukemia cells
Blood,
April 15, 2003;
101(8):
3236 - 3239.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F.-X. Mahon, F. Belloc, V. Lagarde, C. Chollet, F. Moreau-Gaudry, J. Reiffers, J. M. Goldman, and J. V. Melo
MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models
Blood,
March 15, 2003;
101(6):
2368 - 2373.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
A. Nakajima, T. Tauchi, M. Sumi, W. R. Bishop, and K. Ohyashiki
Efficacy of SCH66336, a Farnesyl Transferase Inhibitor, in Conjunction with Imatinib against BCR-ABL-positive Cells
Mol. Cancer Ther.,
March 1, 2003;
2(3):
219 - 224.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
L. Tatton, G. M. Morley, R. Chopra, and A. Khwaja
The Src-selective Kinase Inhibitor PP1 Also Inhibits Kit and Bcr-Abl Tyrosine Kinases
J. Biol. Chem.,
February 7, 2003;
278(7):
4847 - 4853.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
C. Gambacorti-Passerini, M. Zucchetti, D. Russo, R. Frapolli, M. Verga, S. Bungaro, L. Tornaghi, F. Rossi, P. Pioltelli, E. Pogliani, et al.
{alpha}1 Acid Glycoprotein Binds to Imatinib (STI571) and Substantially Alters Its Pharmacokinetics in Chronic Myeloid Leukemia Patients
Clin. Cancer Res.,
February 1, 2003;
9(2):
625 - 632.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. J. Donato, J. Y. Wu, J. Stapley, G. Gallick, H. Lin, R. Arlinghaus, and M. Talpaz
BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571
Blood,
January 15, 2003;
101(2):
690 - 698.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. M. Kantarjian, M. Talpaz, S. O'Brien, F. Giles, G. Garcia-Manero, S. Faderl, D. Thomas, J. Shan, M. B. Rios, and J. Cortes
Dose escalation of imatinib mesylate can overcome resistance to standard-dose therapy in patients with chronic myelogenous leukemia
Blood,
January 15, 2003;
101(2):
473 - 475.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
Top
Abstract
Introduction