|
|
Blood, Vol. 108, Issue 4, 1377-1380, August 15, 2006
Acquisition of the V617F mutation of JAK2 is a late genetic event in a subset of patients with myeloproliferative disorders
Blood Kralovics et al.
108: 1377
Supplemental materials for: Kralovics et al
Files in this Data Supplement:
- Table S1. Primer sequences (PDF, 17.3 KB) -
6FAM, 5′-6-carboxyfluorescein; HEX, hexafluorescein; lower case sequences represent 5′ non-homologous overhangs. Thirty PCR cycles with denaturing at 94°C for 30 seconds, annealing at the temperatures shown above for 30 seconds, and extension at 72°C for 30 seconds were applied.
- Document 1. Detection of the JAK2-V617F mutation by single nucleotide primer extension (PDF, 10.1 KB) -
The SNaPshot Multiplex Kit (Applied Biosystems, Carlsbad, CA) was applied for the detection of the JAK2-V617F mutation by single-nucleotide primer extension following the manufacturer’s protocol. Primers 1391 GGACAACAGTCAAACAACAATTCTTT and 1392 ACTGACACCTAGCTGTGATC were used for amplification of the JAK2 genomic fragment containing the mutation and primers CGTACGAAGAGAAGTAGGAG and CCCATGCCAACTGTTTAGCA were used to amplify JAK2 from platelet cDNA. The primer AAGCATTTGGTTTTAAATTATGGAGTATGT was used for the SNaPshot primer extension reactions.
- Figure S1. Detection of the V617F mutation of JAK2 in MPD by single nucleotide primer extension (PDF, 74.4 KB) -
A. Schematic outline of the SNaPshot assay. B. Detection of the JAK-V617F allele (T) and the wild type JAK2 (G) by the SNaPshot assay. The reactions were performed using homozygous wild type (G) and homozygous mutant (T) genomic DNA dilution ratios with increasing proportion of the mutant DNA. C. Determination of the JAK-V617F and wild type JAK2 allelic ratio in MPD patients by the SNaPshot assay.
- Figure S2 (PDF, 62.2 KB) -
Allele-specific RT-PCR analysis of IDS or MPP1 gene expression was performed on RNA isolated from purified T cells. The chromatograms for the individual patients are shown.
|
|
