|
|
Blood, Vol. 109, Issue 4, 1503-1506, February 15, 2007
Pf4-Cre transgenic mice allow the generation of lineage-restricted gene knockouts for studying megakaryocyte and platelet function in vivo
Blood Tiedt et al.
109: 1503
Supplemental materials for: Tiedt et al, Vol 109, Issue 4, 1503-1506
Files in this Data Supplement:
- Document 1. Information concerning additional genes on the BAC transgene (PDF, 11.3 KB)
- Table S1. Summary of transgenic founders (PDF, 9.36 KB) -
Oocyte microinjections yielded 19 live mice, of which 6 tested positive for the Pf4-Cre transgene (32%). Copy numbers were determined by real-time PCR using the Cre recombinase specific primers TGGATGCCACCTCTGATG (forward) and CTGCACACAGACAGGAGC (reverse) and the HPRT primers CGTTTCTGAGCCATTGCTGA (forward) and TGAGGTAAGCCCAACGCTCT (reverse) as a single-copy gene control. Cre mRNA expression was tested by RT-PCR using the primers GACAGGCAGGCCTTCTCTGAA and CTTCTCCACACCAGCTGTGGA. Excision of the loxP-flanked stop cassette in the ROSA26-lacZ reporter strain was assessed by X-Gal staining of tissue sections. Restricted indicates lacZ staining was observed only in megakaryocytes; ectopic, strains showing additional lacZ-positive cells.
- Table S2. Blood counts (PDF, 19 KB) -
Blood was obtained from 12-week-old mice with the indicated genotypes by tail vein incision, anticoagulated with EDTA, and analyzed in an Advia 120 automated hematology analyzer (Bayer, Leverkusen, Germany). Hb indicates hemoglobin; Hct, hematocrit; WBCs, white blood cells; PLTs, platelets; MPV, mean platelet volume; RETs, reticulocytes; NEUs, neutrophils; LYMs, lymphocytes; MONs, monocytes; EOSs, eosinophils; BASs, basophils; SD, standard deviation.
- Figure S1. Generation of the Pf4-Cre transgenic mice (JPG, 62.2 KB)
-
(A) Map summarizing the strategy of transgene construction (not to scale). The BAC clone containing the mouse Pf4 gene was isolated by screening a filter library derived from the inbred strain 129Sv (Incyte Genomics, Wilmington, DE) using a Pf4 promoter-specific probe generated by the primers TACAGCATACCTTTTGCTAA and GTCAAGAGGGTGCCACTGGA. The targeting construct containing 54 nucleotides of the proximal Pf4 promotor, the full-length codon-improved Cre recombinase cDNA (Cre), the bovine growth hormone polyadenylation signal (GH), an ampicillin resistance cassette (Amp) flanked by frt sites (arrow heads) and 54 nucleotides of the first intron of Pf4 was generated by PCR using the primers CATTTCCTCAAGGTAGAACTTTATCTTTGGGTCCAGTGGCACCCTCCTGACATGGTGCCCAAGAAGAAGAGGAAAGTC and CACCTGAGGCTCCTGAACTGTCTTCCTGTCCCTAGCATCCCTTCACCCAATCTCACTTGATGAGTTTGGACAAACCACAACTAGAATCCA. The plasmid phCre.myc.nuc.FRT.AMP.FRT served as a template in which sequences encoding a bipartite nuclear localization signal (nuc) and a myc tag were appended to the 3′-end of the Cre cDNA (kindly provided by Dr. Erich Greiner and Dr. Günther Schütz). The sequence of the phCre.myc.nuc.FRT.AMP.FRT plasmid is available on request. After DpnI digestion to remove contaminating vector DNA, this PCR fragment was integrated into the BAC by homologous recombination in Escherichia coli, replacing exon 1 of Pf4. The ampicillin cassette was subsequently removed by transient expression of Flp recombinase.1 Briefly, transient expression of Flp recombinase was achieved by transformation with an expression plasmid containing a temperature-sensitive replication origin and a temperature-inducible promoter. Clones were selected on chloramphenicol at 30°C and then shifted to 37°C, leading to Flp expression and at the same time loss of the plasmid. Sizes of fragments after digestion with the restriction endonuclease EcoRV are indicated. (B) Southern blot analysis of modified Pf4 BAC DNA. The parental Pf4 BAC clone (parental), a cloning intermediate containing the Amp gene (intermediate), and the final transgenic construct after excision of the Amp cassette by Flp recombinase (Tg-construct) were digested with NotI (N) or EcoRV (RV), and a Southern blot was probed with 32P-labeled Pf4 cDNA.
- Figure S2. Isolation of megakaryocytes (JPG, 96.2 KB)
-
(A) Bone marrow fractionation with rat anti-CD41 antibodies (BD Pharmingen, Franklin Lakes, NJ) and Dynabeads conjugated to anti–rat IgG antibodies (Invitrogen, Carlsbad, CA). May-Grünwald-Giemsa staining (left) and acetylcholine esterase staining (right) of CD41− and CD41+ bone marrow cells after separation was used to determine purity. Megakaryocytes are enriched in the CD41+ fraction. However, occasional clusters of unidentified cells are frequently copurified (not shown). Alternatively, megakaryocytes were isolated with FITC anti–mouse CD41 antibody (BD Pharmingen) and anti-FITC Microbeads (Miltenyi, Bergisch Gladbach, Germany). Also with this method, contaminating nonmegakaryocytic cells could not be entirely excluded (not shown). (B) Megakaryocytes after CD41+/Gr1− FACS sort and TPO culture. Briefly, mice were intravenously injected with 2 mg/day of TPO (Genentech, South San Francisco, CA) for 3 consecutive days. Bone marrow was collected in CATCH buffer and lineage-depleted with the MagCellect Mouse Hematopoietic Cell Lineage Depletion Kit (R&D Systems, Minneapolis, MN). CD41+/Gr1− cells were then isolated on a FACSVantage cell sorter (Becton Dickinson) and cultured for 2 days in RPMI containing recombinant TPO. May-Grünwald-Giemsa staining (left) and acetylcholine esterase staining (right) are shown.
REFERENCE
1. Zhang Y, Buchholz F, Muyrers JP, Stewart AF. A new logic for DNA engineering using recombination in Escherichia coli. Nat Genet. 1998;20:123-128.
|
|
