|
|
Blood, Vol. 108, Issue 13, 4198-4201, December 15, 2006

HOX11L2/TLX3 is transcriptionally activated through T-cell regulatory elements downstream of BCL11B as a result of the t(5;14)(q35;q32)
Blood Su et al.
108: 4198
Supplemental materials for: Su et al, Vol 108, Issue 13, 4198-4201
Files in this Data Supplement:
- Table S1. Hematologic and immunologic data of the 8 t(5;14) patients (PDF, 25.9 KB)
- Table S2. Oligonucleotides used in this study (PDF, 17.2 KB)
- Figure S1. Alignment of chromosomal breakpoint regions with their germinal counterparts in 8 examples of t(5;14) (PDF, 16.1 KB) -
Chromosome 5 sequences are in uppercase letters, and chromosome 14 sequences are in lowercase letters. N nucleotides presumed to be added by terminal deoxynucleotidyl transferase (TdT) are underlined. Der14 could not be amplified from patient 4’s DNA. Ninety-four nucleotides from chromosome 5 were duplicated during the translocation process in patient 1. Note the absence of additional nucleotides at the breakpoints in patients 3 and 7, suggesting the translocation occurred before the expression of the TdT.
- Figure S2. DNAse1 mapping experiments in Jurkat (T-ALL), K562 (myeloid), REH, and Nalm6 (BCP-ALL) cell lines (PDF, 471 KB) -
The size of the germ-line fragments is indicated, and the fragments resulting from DNAse1 digestion are shown by arrows. Note that the HSS4 site is observed in BCP-ALL cell line (Nalm6 and REH) experiments but with a weaker intensity with respect to T-ALL cell lines (Jurkat and DND41). This is consistent with BCL11B expression that is observed in T-cell lines but not in B-cell or myeloid cell lines. Procedure: Cells (1 × 107) of each cell line, DND41, Jurkat, or Nalm6, were resuspended in 200 L nuclei isolation buffer (RBS: 10 mM Tris, pH 7.4; 5 mM MgCl2; 0.5 mM dithiothreitol; 0.3 mM sucrose; 0.4 mM phenylmethylsulfonyl fluoride; and 0.1% nonidet P-40) and swollen on ice for 10 minutes. Nuclei were collected by centrifugation at 3500 rpm for 10 minutes and were then resuspended in RBS without nonidet P-40, and digested with increasing concentrations (0-5 units) of DNAse1 (Invitrogen) for 10 minutes at 25°C. DNAse1 digestion was stopped with 20 mM EDTA, 1% SDS, 10 g/mL, for 30 minutes at 37°C. DNA was then extracted using standard protocol. DNA (10 g) was digested by EcoRV or BamHI, and was hybridized with the probes using conventional Southern blotting (SB) protocol. The probes were amplified from BAC2576L4 by PCR using the primers noted in Table S2.
- Figure S3 (PDF, 104 KB) -
(A) Mapping of the TLX3 gene transcription start site. Because the normal expression of TLX3 is very restricted, model cell lines are not easily available. We chose to roughly determine the transcription start site by RT-PCR from human cell lines. A 504-bp fragment including the transcription start site and 5′ evolutionary conserved sequences was considered the TLX3 promoter. The map is not drawn to scale. Exons are shown by boxes, and the 5′ untranslated region is indicated by a thick line (from EST BC017291). The orientation and the approximate position of the primers are indicated. Their sequences are as follows: A, ATCAGCTTCGGCATCGACCA; B, CGCGCCGTAACGGGGACCCA; C, CTCTTGGCAAAGTTTCAGTGC; D, CACAGAGCCTGTCGGGC; E, ACTCCAGGTTCGGTTCAAGA; F, GGCTTGTTGATCGCAGCCA; G, CCATGAATTAGGCCTTTATTGAAAGC; and R, ATGCGCCGGGTCACGGTGAA. All PCRs were tested on genomic DNA (data not shown). Primers TLX3-For (ggaagatctCGGGGTTGCAACTCCATTGT) and TLX3-Rev (cccaagcttGCACTGAAACTTTGCCAAGAG; corresponding to oligonucleotide C) were used to subclone the TLX3 promoter region in pGL3. Cloning sites are in lowercase letters. (B) Analyses of RT-PCR experiments starting from DND41 cDNA. (C) Summary of RT-PCR experiments. Reverse transcription was primed using oligonucleotide R, which was also used as a reverse primer in the PCR reactions. The sizes of the expected fragments are indicated. + indicates that the fragment was amplified from the indicated cDNA. – indicates that no amplification was observed. The specificity of the amplified fragments was checked by nucleotide analyses.
- Figure S4 (PDF, 97.7 KB) -
(A) Representation of the luciferase reporters used in this study. (B, right panel) An artificial H3*H4* fusion fragment was constructed by PCR and tested for cis-activation properties on SV40 and TLX3 promoter in the Jurkat T-ALL cell line. (B, left panel) H3*H4* enhances transcription from SV40 and TLX3 promoter but not from promoter-less pGL3 vector.
- Figure S5. Nucleotide sequence of H3* (top) and H4* (bottom) fragments (PDF, 13.7 KB) -
The coordinates on genome browser are indicated (http://genome.ucsc.edu).
|
|