|
|
Blood, Vol. 109, Issue 5, 2202-2204, March 1, 2007
Novel activating JAK2 mutation in a patient with Down syndrome and B-cell precursor acute lymphoblastic leukemia
Blood Malinge et al.
109: 2202
Supplemental materials for: Malinge et al, Vol 109, Issue 5, 2202-2204
Files in this Data Supplement:
- Figure S1. Loss of heterozygosity within the JAK2 locus at the diagnosis stage (JPG, 46.6 KB)
-
Sequencing data from single nucleotide polymorphism (SNP) analyses show a loss of heterozygosity in the JAK2 locus at diagnosis. Two SNPs were analyzed using standard PCR amplification from the patient’s genomic DNA at diagnosis (Dg) and at complete remission (CR) followed by direct sequence analyses. SNPs were rs10429491, located in JAK2 exon 4 and amplified using Ex4F, AACATGATAATGAAACTTACGATGAG, and Ex4R, TCTCTACTCACACTTATGTGTAAG, and rs2230724 located in exon 17 and amplified using Ex17F, TTTAGTCCAGAGAATGTTATTTGC, and Ex17R, TTTAGAAACGCTCTTAAGTTTTTCC.
- Figure S2. Inhibitory effect of the JAK inhibitor I on EPO-independent Ba/F3–EPO-R cells expressing the JAK2ΔIREED mutant (JPG, 31.1 KB)
-
Cells were incubated in the presence of increasing concentrations of JAK inhibitor I (Merck Biosciences, VWR International S.A.S., Fontenay sous Bois, France) or DMSO alone. Cell proliferation was assessed at indicated times using CellTiter 96 Proliferation assay (Promega, Madison, WI) or using a Vi-cell counter (Beckman-Coulter, Fullerton, CA). As a control, the Ba/F3 cell line stably transfected by the TEL-ABL fusion oncoprotein was used.
|
|
