Blood online
Home About Blood Authors Subscriptions Permission Advertising Public Access contact us
 

 
Advanced
Current Issue
First Edition
Future Articles
Archives
Submit to Blood
Search
American Society of Hematology
Meeting Abstracts
Email Alerts

Blood, Vol. 111, Issue 5, 2657-2666, March 1, 2008
This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

Sox18 and Sox7 play redundant roles in vascular development
Blood Cermenati et al. 111: 2657

Supplemental materials for: Cermenati et al

Files in this Data Supplement:

  • Table S1. Double knockdown of sox18 and sox7 selectively blocks trunk/tail circulation (PDF, 20.9 KB) -
    Injected embryos were scored for circulation in the trunk/tail region at 2dpf. For each injection, the number of injected embryos is given into brackets. The data are referred to a single typical experiment. “Reduced circulation” refers to a severely reduced blood flow in the trunk/tail region; “absent circulation” refers to embryos with no circulating elements in the posterior trunk/tail region. DMO1 refers to the coinjection of sox18-MO1 and sox7-MO1; DMO4 to the coinjection of sox18-MO4 and sox7-MO4. The upper part refers to single injections and coinjections of MO1s. The middle part describes single injections and coinjections of MO4s. The lower part refers to combinations of MO1s and MO4s, that work synergistically when all combined together (DMO1s+DMO4s).

  • Table S2. Circulatory phenotypes associated to coinjection of splice morpholinos (PDF, 13 KB) -
    Injected embryos were scored for circulation in the trunk/tail region at 2dpf. For each injection, the number of injected embryos is given into brackets. The data are referred to a single typical experiment. “Reduced circulation” refers to a severely reduced blood flow in the trunk/tail region; “absent circulation” refers to embryos with no circulating elements in the posterior trunk/tail region. DMO2 refers to the coinjection of sox18-MO2 and sox7-MO2.

  • Figure S1. Deduced protein sequences encoded by the zebrafish sox18 and sox7 genes and protein alignments (JPG, 329 KB) -
    The newly identified zebrafsh Sox7 and Sox18 proteins were aligned with orthologs in several other species using the ClustalW program. Multialignments were visualized with the Boxshade program. Identical amino acids in at least 80% of the input sequences are visualized in red, conserved amino acids in blue. A line is traced over the 79-aa HMG box domain. The beta-catenin binding motif identified by Sinner et al. (2004) is marked by asterisks below the aa sequence. Accession numbers of the protein sequences are given into brackets, alongside with the letter used to identify the species. (A) ClustalW protein alignment of SOX7 sequences from human (h, CAC84226), mouse (m, P40646), Xenopus (x, CAJ82258), Fugu (f, AAQ18504) and zebrafish (z, AAQ97990). (B) ClustalW protein alignment of SOX18 sequences from human (h, CAC16611), mouse (m, AAH06612), chicken (c, AAK71352), Xenopus (x, BAB60829 and BAB60830 for alpha and beta, respectively), Fugu (f, AAQ18512) and zebrafish (z, XP_694383). (C) ClustalW protein alignment of the zebrafish Sox-F proteins Sox7, Sox18, Sox17 (AAQ97990, XP_694383, NP_571362), and of the Sox-related protein Cas (AAK70405).





  • Figure S2. Temporal expression of the soxF- group genes in zebrafish embryonic and early larval development (JPG, 41.6 KB) -
    We performed Real-Time PCR analyses using cDNAs retrotranscribed from RNA samples of adult ovary and a series of developmental stages with TaqMan probes specific for sox7, sox17, and sox18. Triplicates data, expressed as Ct (threshold cycle for target amplification), were averaged and normalized to an averaged 18S rRNA endogenous control, thus obtaining ΔCt values; standard deviations were calculated. The results are represented as relative expression levels (2−ΔCt × 106 on the y axis) versus developmental stages or ovary on the x axis. The ovary RNA sample has been included to analyze maternal RNA content. RNA samples are as follows: ovary, 1-2 cell stage, 50% epiboly, tailbud, 6 somite stage, 15 somite stage, 24 hpf, 1.5 dpf, 2dpf, 3 dpf. Blue squares indicate sox7, pink triangles sox17, green circles sox18.





  • Figure S3. The single knockdown of sox18 or sox7 does not affect global morphology (JPG, 38.5 KB) -
    Low doses (250 fmol) of sox7-MO1 and sox18-MO1 were not causing gross morphological defects when injected separately. (A,B) sox7 and sox18 single morphants at 1 dpf. Images were taken at 32× magnification. (C,D) sox7 and sox18 single morphants at 2 dpf. Images were taken at 25× magnification. (E,F) sox7 and sox18 single morphants at 3 dpf. Images were taken at 20× magnification. Anterior to the left.





  • Figure S4. sox18-MO2 and sox7-MO2 specifically target sox18 and sox7 transcripts (JPG, 35.8 KB) -
    Injection of high doses of either sox18-MO2 or sox7-MO2 specifically blocks splicing of the targeted pre-mRNAs. PCR reactions were performed in parallel with primers for sox18, sox7 and β-actin, as an internal control, on cDNAs retrotranscribed from total RNA extracted from 24hpf std-MO injected embryos (lane1), sox18-MO2 injected embryos (lane2), sox7-MO2 injected embryos (lane3). All MOs were injected at 1.5pmol/embryo. Coinjection of sox18-MO2 and sox7-MO2, each at 750 fmol/embryo, reduces the level of both mature mRNAs (compare amplified bands in lanes 4 and 5). To perform RT-PCR 1 µg of total RNA was retrotranscribed (Superscript II, Invitrogen) and 1/10 of the reaction volume was used for each PCR. Primers: sox18-5′: TTTATGGTGTGGGCAAAAGATG; sox18-3′: TCTCGGAAGTGTCCCAGAGG; sox7-5′: TGGCGGCTCTGATAAGTGCG; sox7-3′: CACATATGGCCTCTTTTGCGG; β-act-5′: TGTTTTCCCCTCCATTGTTGG; β-act-3′: TTCTCCTTGATGTCACGGAC. PCR conditions: initial denaturation 96°C 2min, each cycle: denaturation 96°C 30s, annealing 56°C 30s, extension 72°C 30s; final extension 72°C 5min. Lanes 1, 2, 3: β-actin 20 cycles, sox18 and sox7 35 cycles, respectively; lanes 4, 5: 25 cycles for all PCRs.





  • Figure S5. Some endothelial and non-endothelial markers with a role in vascular development or hematopoiesis are not affected in the double morphants (JPG, 67.3 KB) -
    Hybridization signals in control embryos (A-G) are indistinguishable from those in double morphants (A′-G′) (21/24 A′, 19/19 B′, 12/18 C′, 18/18 D′, 16/16 E′, 15/18 F′, 10/13 G′, respectively). (A,A′) 8-10 somites, scl. (B,B′) 8-10 somites, gata2. (C,C′) 22 somites, flt1. (D, D′) 22 hpf, gata1, marking presumptive blood cells. (E, E′) 22 hpf, ang1, marking the hypochord. (F, F′) 24 hpf, vegf, expressed in the somites. (G, G′) 24 hpf, notch3, expressed in the DA (black arrows); a strong expression in CNS is also visible. Dorsal (A,B) or lateral views (C-G) are shown, anterior to the left, of whole embryos (40×) or trunk/tail regions (63×).





  • Figure S6. The phenotypes associated with the double knockdown of sox18 and sox7 are specific and point to a functional redundancy (JPG, 75.9 KB) -
    We used two additional morpholinos (sox18-MO4, sox7-MO4), targeting non-overlapping sequences in the 5′UTR of the sox18 and sox7 mRNAs, to perform an independent double knockdown of the two genes and confirm the specificity of the effects shown with the original MOs. Moreover, the new MOs were also used at a double dose in single injections (500 fmol), to compare their effects to those obtained with their coinjection at a lower dose (250 fmoles of each MO). Knockdown experiments were performed both in tg(flk1:EGFP) and in wt backgrounds. (A-D) fluorescent images of tg(flk1:EGFP) larvae at 3 dpf, injected with 1 pmol std-MO (A), 250 fmol of sox18-MO4 and of sox7-MO4 (B), 500 fmol of sox18-MO4 (C), 500 fmol of sox7-MO4 (D). In the double morphants, the intensity of the EGFP signal is clearly reduced, most notably in the region of the PCV (white arrowhead) and CV (white arrow). Single MOs, even at a higher dose, do not cause a comparable alteration in the expression of the transgene. (E-H) 24 hpf embryos hybridized with the panendothelial marker cdh5. Embryos were injected with 1 pmol std-MO (E), 250 fmol of sox18-MO4 and of sox7-MO4 (F), 500 fmol of sox18-MO4 (G), 500 fmol of sox7-MO4 (H). Images shown correspond to the trunk/tail region at 63× magnification, lateral views, anterior to the left. (I-L) 29 hpf embryos hybridized with vsg1, which is predominantly expressed in venous endothelial cells at this stage. Embryos were injected with 1 pmol std-MO (I), 250 fmol of sox18-MO4 and of sox7-MO4 (J), 500 fmol of sox18-MO4 (K), 500 fmol of sox7-MO4 (L). Images shown correspond to the trunk/tail region at 63× magnification, lateral views, anterior to the left. (M, N) 26 hpf, flk1. Control embryos were injected with 1 pmol std-MO (M), double morphants with 250 fmol of sox18-MO4 and of sox7-MO4 (N). Lateral views, anterior to the left, 40× magnification. The double knockdown of sox18 and sox7 with MOs-4 causes a moderate to severe reduction in the expression of the tested markers, which are instead substantially unaltered even with double doses of the two MOs-4 injected separately. Phenotypes shown in the panels correspond to the following number of embryos: (E) 17/17; (F) 12/15; (G) 17/17; (H) 17/17; (I) 15/16; (J) 14/15; (K) 17/17; (L) 15/17; (M) 14/14; (N) 12/15.





  • Figure S7. The absence of blood flow doesn’t lead to AV shunts (JPG, 96.3 KB) -
    The 2,3-BDM treatment, which blocks blood flow, leads to dilation of the caudal vein but not to AV shunts. (A,B) Cross-sections of the tail of a control larva, injected with std-MO (A), and a double morphant larva (B) at 3 dpf.





  • Video 1. Circulation in a 2 dpf tg(gata1:dsRed) control embryo, injected with std-MO (MOV, 3.82 MB) -
    Anterior to the left. Only rostral regions are shown (head, yolk and anterior trunk). Circulation can be seen both in the head and in the main axial vessels. H, heart; DA, dorsal aorta; PCV, posterior cardinal vein; CCV, common cardinal vein. Fluorescence movie was recorded under an Olympus SZX12 stereomicroscope.

  • Video 2. Reduced circulatory loop in a 2dpf tg(gata1:dsRed) double morphant, coinjected with sox18/sox7-MO1s (MOV, 3.82 MB) -
    Anterior to the left. Only rostral regions are shown (head, yolk and anterior trunk). Circulation in the double morphant is limited to the heart-yolk region and excluded from axial vessels. H, heart; CCV, common cardinal vein. Fluorescence movie was recorded under an Olympus SZX12 stereomicroscope.

  • Video 3. Circulation in the trunk/tail region of a 1.5 dpf control embryo, injected with std-MO (MOV, 9.56 MB) -
    Anterior to the left. Circulation is visible in the main axial vessels, up to the caudal region. The direction of arterial and venous blood flow is indicated by red and blue arrows, respectively. DA, dorsal aorta; PCV, posterior cardinal vein. The movie was recorded using a Leica MZFLIII stereomicroscope equipped with a DFC 480 R2 digital camera.

  • Video 4. Premature venous return in the posterior trunk of a sox18/sox7 double morphant at 1.5 dpf (MOV, 10.7 MB) -
    In a limited fraction of DMO1 injected embryos blood can be seen flowing directly from the dorsal aorta (DA) to the posterior cardinal vein (PCV) through an arteriovenous shunt (white arrow) around the anus. Anterior to the left. The movie was recorded using a Leica MZFLIII stereomicroscope equipped with a DFC 480 R2 digital camera.

  • Video 5. High magnification movie of the anterior trunk circulation in a 30 hpf control embryo, injected with std-MO (MOV, 2.07 MB) -
    Anterior to the left. Blood flows within the two distinct axial vessels; continuous vessels walls are clearly visible. Confocal images were recorded using DIC microscopy. DA, dorsal aorta; PCV, posterior cardinal vein.

  • Video 6. Arteriovenous (AV) shunts are clearly visible in the anterior trunk region of a sox18/sox7 double morphant at 30 hpf (MOV, 1.55 MB) -
    Blood cells directly flow from the dorsal aorta (DA) to the posterior cardinal vein (PCV) through two subsequent fusions (indicated by white arrows). A severe reduction in blood flow is noticeable caudally to each shunt. High magnification confocal movie was recorded using DIC microscopy.




This Article
Right arrow Abstract
Right arrow Full Text
Services
Right arrow Email this article to a friend
Right arrow Alert me to new issues of the journal
Right arrow reprints & permissions
Right arrow Rights and Permissions
Citing Articles
Right arrow Citing Articles via CrossRef

 click for free articles
home about blood authors subscriptions permissions advertising public access contact us
  Copyright © 2009 by American Society of Hematology         Online ISSN: 1528-0020