|
|
Blood, Vol. 112, Issue 4, 1154-1157, August 15, 2008
Angiopoietin-1 mediates the proangiogenic activity of the bone morphogenic protein antagonist Drm
Blood Mitola et al.
112: 1154
Supplemental materials for: Mitola et al
Files in this Data Supplement:
- Figure S1. Conditioned media from rDrm-treated SIE cells were added for 10 minutes to naïve serum-starved SIE cells in the absence or in the presence of neutralizing anti-Ang-1 antibodies (JPG, 50.3 KB)
-
Then, immunoprecipitation with anti-Tie-2 antibodies was performed on the cell extracts followed by Western blotting with anti-phosphotyrosine antibodies (Santa Cruz). Uniform loading of the gel was confirmed by incubation of the membrane with anti-Tie-2 antibodies.
- Figure S2 (JPG, 60.7 KB)
-
Nuclear extracts (2 µg) of SIE cells treated for 20 minutes with 50 ng/mL rDrm were incubated with a biotin-labeled NF-κB double-stranded DNA oligonucleotide probe (5′AGTTGAGGGGACTTTCCCAGGC) in the absence or in the presence of anti-RelA/p65 antibodies or of a molar excess of the unlabeled NF-κB probe or of a mutant NF-κB probe (5′AGTTGAGGCGACTTTCCCAGGC). The protein-DNA complexes were analyzed by EMSA onto a native 6% polyacrylamide gel.
- Figure S3. SIE cells were transfected with a fluorescein-conjugated control siRNA or a NF-κB p65 siRNA (a pool of four oligonucleotides from Santa Cruz Biotechnology) (JPG, 28.5 KB)
-
After 18 hours, cell cultures were treated for 0, 10, and 18 hours with 50 ng/mL rDrm and the steady-state levels of Ang-1 mRNA were measured by quantitative RT-PCR analysis using an iCycler system with a SYBR Green master mix (Bio-Rad) according to manufacturer’s instructions.
- Figure S4. VEGFR2-MAE cells were mock-transfected (−) or transfected with pcDNA3-human Ang-1 expression vector (+) using Lipofectamine (Invitrogen) (JPG, 35.1 KB)
-
After 24 hours, cells were further transfected with control siRNA or Ang-1 siRNA. After further 24 hours, cell aggregates of the transfectants were embedded in fibrin gel. Then, 50 ng/mL rDrm were added on the top of the gel in medium containing 10 µg/mL aprotinin. Formation of radially growing cell sprouts was observed during the next 48 hours. Sprouts were photographed at 40× magnification with an IX51 inverted microscope equipped with a 4×/0.10 numerical aperture objective and a Camedia C-4040 digital camera (Olympus, Melville, NY). Sprouting was quantified by computerized analysis of the digitalized images. Data are expressed as mean ± SEM (n = 10); *, p<0.01, Student’s t test.
- Figure S5 (JPG, 101 KB)
-
(A) Representative images of fibrin-embedded human umbilical artery rings incubated for 6 days with vehicle (a), 50 ng/mL rDrm alone (b) or rDrm added with 1.0 µg/mL neutralizing anti-Ang-1 antibodies (c) or 100 ng/mL sTie2 (d). rDrm causes the appearance of numerous EC sprouts (black arrows) that is potently inhibited by the Ang-1 antagonists. (B) Representative ex-ovo images of chick embryo CAMs implanted with alginate pellets containing vehicle (a), 100 ng of rDrm alone (b) or rDrm added with 1.0 µg of neutralizing anti-Ang-1 antibodies (c) or 100 ng of sTie2 (d). Note the numerous newly-formed microvessels converging versus the rDrm implant in a spoke-wheel pattern (red arrows in b) that were significantly reduced in the presence of the two Ang-1 antagonists (c, d).
|
|
