|
|
Blood, Vol. 112, Issue 9, 3856-3866, November 1, 2008
Kpm/Lats2 is linked to chemosensitivity of leukemic cells through the stabilization of p73
Blood Kawahara et al.
112: 3856
Supplemental materials for: Kawahara et al
Files in this Data Supplement:
- Figure S1. Expression levels of Kpm/Lats2 in several leukemic cell line (JPG, 40.1 KB)
-
(A) Semiquantitative RT-PCR analyses were performed in various cell lines including Hela, AML line (KG-1a, K562, U937, HL-60), B-ALL (Raji, Ramos), T-ALL (Molt-4, Jurkat) and T-CLL (Kit225). Twice independent experiments were performed and representative data are shown. (B) The amount of Kpm/Lats2 mRNA was measured in myeloid leukemic lines. Data normalized to  -actin is shown representatively in scale that value for PBMC is 1. Data normalized to gapdh had also the same tendency. Analyses were performed in duplicate independently twice and representative data are shown.
- Figure S2. Cell death detection assay (JPG, 87.4 KB)
-
Cell death detection assay was performed using FITC labeled Annexin-V and PI according to manufacture’s protocol. kpm/Lats2-knockdown cells and control cells of KG-1a were treated with 0.03 µg/ml ETP and subjected to cell death detection assay on day 0, 2, and 3 as described elsewhere.83 Cells were stained with FITC-labeled Annexin-V (CALTAG, Burlingame, CA) and propidium iodide (PI, Molecular Probes, Eugene, OR) and analyzed with a FACScan (BD Biosciences, San Jose, CA) and CellQuest software (BD Biosciences). The assays were performed independently three times and representative data are shown.
- Figure S3 (JGP, 109 KB)
-
(A) microRNA-37351 expression vector was constructed into pSINsi-hU6 RV vector as described elsewhere.84 Control vector is constructed as the one without microRNA-373 sequence. KG-1a cells were transducted with microRNA-373 containing RV or microRNA non-containing RV in the same method as using shRNA containing RV. Western blotting analyses showed that Kpm/Lats2 was knocked down in microRNA-373 transduced cells. Cell viability after treatment with Doxorubicin (DXR) or Etoposide (ETP) in each KG-1a line was measured by MTT assay. The assays were performed in quadruplicate independently twice and representative data are shown as Mean ± S.D (Welch’s t test; *p<0.01, **p<0.001). (B) Transient silencing of kpm/Lats2 in KG-1a cells. To transiently silence kpm/Lats2 in KG-1a cells, kpm/Lats2-specific siRNAs (Stealth™ RNAi purchased from Invitrogen) were transfected into KG-1a cells using the nucleofector system (AMAXA, Cologne, Germany). Kpm/Lats2 target sequences were aagcaaggcacacuucuccaaaggc, acagaguugaguguacccuuugcgg, and aagagaaucacuccaacacuccacc. Stealth™ RNAi negative control was that of Invitrogen catalogue number 12935-300. Western blotting analyses showed that Kpm/Lats2 was moderately knocked down at 4 days but recovered to baseline level at 7 days after transfection of 3 kpm/Lats2-specific siRNAs. MTT assay was done from 36 hours after transfection for 4.5 days after treatment with Doxorubicin (DXR) or Etoposide (ETP). The assays were performed in quadruplicate independently twice and representative data are shown as Mean ± S.D (Welch’s t test; *p<0.05).
- Figure S4. Western blot analysis of PUMA and p21 (JPG, 12.8 KB)
-
Western blot analyses were done with anti-PUMA and anti-p21 in whole cell lysates of kpm/Lats2-knockdown KG-1a cells without treatment of ETP (lane 1) or with treatment 0.03 µg/ml ETP for 3days (lane 2), control KG-1a cells without treatment of ETP (lane 3) or with treatment 0.03 µg/ml ETP for 3 days (lane 4). Independent experiments were performed twice and representative data are shown.
- Figure S5. Western blotting (JPG, 24.4 KB)
-
Analysis with anti-p73 in whole cell lysate of microRNA-373 transduced KG-1a cells without treatment of ETP (lane 1)
Analysis with anti-p73 in whole cell lysate of microRNA-373 transduced KG-1a cells without treatment of ETP (lane 1) or with treatment 0.03 µg/ml ETP for 3 days (lane 2), control (microRNA-373 non-containing RV transduced) KG-1a cells without treatment of ETP (lane 3) or with treatment 0.03 µg/ml ETP for 3 days (lane 4).
or with treatment 0.03 µg/ml ETP for 3 days (lane 2), control (microRNA-373 non-containing RV transduced) KG-1a cells without treatment of ETP (lane 3) or with treatment 0.03 µg/ml ETP for 3 days (lane 4).
- Figure S6. YAP2 is dominant in hematological cells (JPG, 33.6 KB)
-
By PCR analysis using our primers (see Table 1), 418 bp products is made from YAP1 and 520 bp products is made from YAP2 because 114 bp original sequence of YAP2 and 12 bp original sequence of YAP1 exists in between these primers. pYAP1 and pYAP2 means by pFLAG-CMV2-YAP1 and pFLAG-CMV2-YAP2 vector respectively. Twice independent experiments were performed and representative data are shown.
- Figure S7. Kpm/Lats2 can interact with YAP1 (JPG, 47.4 KB)
-
Either of HA-tagged kpm-wild type (wt) or kpm-kinase dead (kd) form and any one of FLAG-tagged YAP1-wild type (wt), YAP1-S127A (mutant form S127 to A; S127 is Akt-phosphorylation site), or YAP1-WW* (mutant form of WW domain) were cotransfected in 293T cells by the calcium phosphate method. Upper lanes indicate Western blotting with anti-HA. Middle lanes and lower lanes represent Western blotting with anti-FLAG and anti-HA, respectively, in coimmunoprecipitates by anti-FLAG. Three independent experiments were performed and representative data are shown.
- Figure S8. The protein level of p73 is increased by coexpression of YAP1 and wild type Kpm/Lats2 (JPG, 56.4 KB)
-
Any one of HA-tagged kpm-wild type (wt), kpm-kinase dead (kd), or mock was cotransfected with TAp73 and any one of FLAG-tagged YAP1-wt, YAP1-S127A, YAP1-WW*, or mock into 293T cells by FuGENE-HD reagent. Four rows of lanes from the top in this order represent Western blotting with anti-HA, anti-FLAG, anti-p73, and anti-actin in cell lysates, respectively. Two independent experiments were performed and representative data are shown.
|
|
