|
|
Blood, Vol. 111, Issue 7, 3863-3866, April 1, 2008
Clonal heterogeneity in polycythemia vera patients with JAK2 exon12 and JAK2-V617F mutations
Blood Li et al.
111: 3863
Supplemental materials for: Li et al
Files in this Data Supplement:
- Document 1. Supplemental materials and methods (PDF, 1.38 MB)
- Table S1 Clinical features at diagnosis of patients carrying JAK2 exon12 mutations and JAK2-V617F mutation (PDF, 969 KB)
- Figure S1. Allele discrimination assay to quantitate JAK2 exon 12 mutations (JPG, 69.1 KB)
-
(A) Design of the PCR assay. One of the primers was fluorescently labeled (asterisk). Exon 12 mutations with deletions of nucleotides will yield PCR products that differ in length from the wild type allele. For genomic DNA we used the primers 5′-FAM-ACTTTCAGTGTATTTTGAAGTGAT-3′, and 5′-GTTTCTTGAATGTAAATCAAGAAAACAGA-3′ and for RNA/cDNA the primers 5′-FAM¬AAACTGTTCGCTCAGACAAT-3′ and 5′-GTTTCTTCTCTTCGTACGCCTTTA-3′. (B) Mixtures of plasmids containing wild type JAK2 and JAK2 exon 12 mutation were used as templates. The PCR products were separated by capillary electrophoresis and the peak fluorescent intensities were measured on an ABI3130 Genetic Analyzer (Applied Biosciences, Carlsbad, CA). The chromatograms of a dilution series for an exon 12 mutation with a 6 nucleotides deletion (I540¬E543delinsMK) is shown. (C) Standard curve. The percentages of exon 12 mutation in the DNA templates (x-axis) were plotted against the ratios of the fluorescent intensities (y-axis). Separate standard curves were generated with cloned fragments for each of the other exon 12 mutations studied and a detection limit of 1% was observe in all of them (not shown) Error bars (standard deviation) were smaller than the size of the symbols and were therefore omitted.
- Figure S2. Statistical analysis (JPG, 66.1 KB)
-
(A) Correlation between disease duration and the percentages of JAK2 mutations. The R squared, and p values are shown in each plot. (B) The correlations between the number of lineages involved and the percentages of JAK2 exon 12 mutations (left panel) and the percentages of JAK2-V617F (right panel) in granulocytes are shown.
- Figure S3 (JPG, 77.8 KB)
-
Single colonies with erythroid morphology were picked and RT-PCR analysis was performed with primers specific for human glycophorin A (CATCTCATCACAGACAAATGATACG, forward; TCAGAGAAATGATGGGCAAGT reverse). Beta actin (CTCTTCCAGCCTTCCTTCCT, forward ; ATGCTATCACCTCCCCTGTG, reverse) was used as a control for the quality of cDNA. A) Analysis in 3 patients is shown. wt, colonies with only wild type JAK2; GPA, glycophorin A. Only colonies expressing glycophorin A were included in the result presented in Figure 2. B) All colonies with wild type JAK2 were re-analyzed for glycophorin A. Colonies with non-erythroid morphology (CFU-G, CFU-M aand CFU-GM) are shown as negative controls.
|
|
