|
|
Blood, Vol. 111, Issue 9, 4588-4595, May 1, 2008
Immunologic ignorance of vascular endothelial cells expressing minor histocompatibility antigen
Blood Bolinger et al.
111: 4588
Supplemental materials for: Bolinger et al
Files in this Data Supplement:
- Figure S1. βgal and CD8 staining of salivary gland, spleen, and liver sections of naïve Tie2-LacZ mice (JPG, 176 KB)
-
Freshly removed organs were immersed in HBSS and snap-frozen in liquid nitrogen. Frozen tissue sections were cut in a cryostat and fixed in acetone for 10 min. Sections were incubated with antibodies against  gal (MP Biomedicals), CD8 (clone YTS169.4.2) followed by goat anti-rat Ig (Caltag Labs) and alkaline phosphatase-labeled donkey anti-goat Ig (Jackson ImmunoResearch Labs). Alkaline phophatase was visualized by using AS-BI phosphate / New Fuchsin, and sections were counterstained with hemalum, and pictures were acquired using a Leica DM R microscope.
- Figure S2. LacZ mRNA copy numbers in liver, spleen, heart, kidney, thymus and BM of naïve Tie2-LacZ mice (JPG, 28.9 KB)
-
Organs were homogenized in Trizol (Sigma) using a MagNA Lyser instrument (Roche Diagnostics). RNA was isolated by isopropanol percipitation, washed with ethanol 70% and resuspended in DEPC-water. RNA (10 µg) was subjected to RT-PCR analysis. For RT-PCR the high capacity cDNA archive Kit from Applied Biosystem (ABI PRISM, Warrington, United Kingdom) was used according to the specifications of the manufacturer to generate cDNA from RNA samples. Quantitative real-time PCR was performed using a LightCycler (Roche Diagnostics) and the LightCycler FastStart DNA MasterPLUS HybProbe reaction mix (Roche Diagnostics) following the manufacturer’s protocol. Data analysis was performed with LightCycler Software 3 (Roche Diagnostics). Oligonucleotides were purchased from Microsynth (Balgach, Switzerland). The following oligonucleotides from LacZ sequences were used as primers for quantitative real-time PCR: 5′-GCGTGGATGAAGACCAGC-3′ and 5′-CGAAGCCGCCCTGTAAAC-3′. The following oligonucleotides were used as probes: 5′ CAGTCTTGGCGGTTTCGCTAA 3′ (probe 1) and 5′ TACTGGCAGGCGTTTCGTCAG 3′ (probe 2). Probe 1 carried a 3′ FAM reporter and probe 2 was Cy5 labeled at the 5′ end. Thermal cycling started with HotStarTaq activation during 15 min at 95°C. Thereafter 50 cycles of amplification were run consisting of 15 s at 95°C, 20 s 60°C, and 20 s of 72°C. A negative control, containing reagents only, and serial dilutions of plasmid containing the specific LacZ sequence were included in each run to generate a standard curve. The concentrations of the plasmid dilutions were: 280000, 28000, 2800, 280, and 28 copies per reaction. LacZ mRNA concentration in the unknown samples was calculated by the ABI Prism Software using the data from the standard curve. Each sample was measured twice and the average concentration was used. Final copy numbers were calculated per µg total RNA.
- Figure S3. Expression of LacZ transcripts in sorted bone marrow cells (JPG, 25.5 KB)
-
For cell sorting, the FACS Aria (BD Biosciences) was used. Erythrocyte-depleted BM cells were stained in IMDM 2% FBS with saturating concentrations of anti-TCR, anti-CD3ε, anti-CD11b, anti-CD11c, anti-CD19, anti-CD117, and anti-Ly6A/E (SCA-1). Following a 30 min incubation at 4°C, cells were washed in PBS 2% FBS and resuspended in PBS, filtered through a 20 µm diameter nylon mesh, and resuspended at about 20 × 106/mL in filtered PBS 2% FBS prior to sorting. Reanalysis of sorted cells indicated purity >95%. Real-time RT-PCR for the quantification of LacZ expression in the sorted BM cells was performed essentially as described in Fig. S2 with the following modifications. Expression of the TATA-binding protein (TBP) was used for normalization. The following primers were used for amplification of TBP: TBPfor CCTTCACCAATGACTCCTATGAC, TBPrev CAAGTTTACAGCCAAGATTCAC. Amplification program for the LightCycler RT-PCR was 95°C 15 min; 50 cycles – 95°C 10 sec, 58°C 10 sec, 72°C 20 sec. The level of expression between samples derived from the different cell populations was calculated by the comparative CT method ( CT) with expression in total bone marrow cells set as reference.
- Figure S4. Functional avidity of TCR transgenic Bg1 CD8+ T cells (JPG, 26.8 KB)
-
(A) EL-4 cells pulsed with different concentration of the gal96-103 (DAPIYTNV) peptide or without peptide (negative control) were used as target cells in a standard 51Cr release assay. Cells were labeled with 200 µCi 51Cr (EGT Chemie, Tägerig, Switzerland) for 1 h at 37°C. A total of 104 target cells/well were incubated for 5h in 96-well round bottom plates with 3-fold serial dilutions of effector cells. CTL from naïve Bg1 mice that were restimulated with gal96-103 (DAPIYTNV) for three days and were tested at a effector:target ratio of 10:1. (B) MACS-purified CD8+ splenocytes from Bg1 mice were cocultured with gal96-103 (DAPIYTNV) peptide presenting DC. DC were generated from bone marrow of C57BL/6 mice using GM-CSF containing medium as described previously (Ludewig et al., 1998, J. Virol. 72:3812). DC were pulsed at the incidated concentration of the gal96-103 (DAPIYTNV) peptide or left unloaded as a negative control and plated onto a 96-well plate in RPMI 1640 (Sigma) supplemented with 5% FCS, 25mM L-glutamine, and 100U/ml penicillin with 100µg streptomycin sulfate. Responder to stimulator ratio of the displayed data was 30:1. Cells were incubated at 37°C for 60 hours. During the last 12 hours of coculture, 1 µCi of 3H thymidine (MP Biomedical, EGT Chemie, Tägerig, Switzerland) was added to each well. To measure incorporation into DNA, the plates were frozen, thawed, harvested, and counted on a beta liquid scintillation counter (TRI-CARB, Packard). The mean of triplicates (± SD) was calculated, background values from cultures with unpulsed DC were subtracted.
- Figure S5. Phenotype of MCMV-LacZ-activated of Bg1 TCR transgenic T cells in B6→B6 and B6→T2 chimeras (JPG, 48.7 KB)
-
The indicated bone marrow chimeric mice received 105 CD8+Thy1.1+ cells from naive Bg1 mice. Nine days following adoptive transfer, mice were infected with MCMV-LacZ and the phenotype of the activated Bg1 cells was assessed six days later. Bg1 T cells activation was measured as upregulation of CD44 (A), and down-regulation of CD62L (B). Progression of activation-induced cell death was measured as Annexin V upregulation (C). Expression of the respective markers on naïve CD8+ T cells from B6 mice is shown as controls. Mean fluorescence intensity is indicated (n=2-3).
- Figure S6. Fate of Bg1 TCR transgenic T cells in T2→T2 chimeric mice (JPG, 83.6 KB)
-
1.5 × 107 CFSE-labeled splenocytes (corresponding to 3 × 106 CD8+ TCR transgenic T cells) from Bg1 mice were adoptively transferred into T2→T2 bone marrow chimeras. Mice were sacrificed on days 4 and 8 following transfer and dividing Bg1 cells from spleens were analyzed by flow cytometry for CD44 (A), and Annexin V (B) upregulation. Total numbers of transgenic Bg1 cells in spleens of recipient T2→T2 and B6→B6 mice were determined (C) at the indicated time points.
|
|
